Application of GSK3 family genes in regulating naringenin chalcone synthesis and fruit color formation in tomato pericarp

Abstract

The application belongs to the technical field of biology, and particularly relates to application of a tomato GSK3 family gene in regulating naringenin chalcone synthesis and fruit color formation of tomato peel. The application provides application of a GSK3 family gene SlBIN2 in regulating naringenin chalcone synthesis and fruit color formation of tomato peel, and a nucleotide sequence of the SlBIN2 gene is shown in SEQ ID No:1. The SlBIN2 positively regulates naringenin chalcone synthesis and hue angle size of tomato peel.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to the application of tomato GSK3 family genes in regulating the synthesis of naringenin chalcone in tomato peel and the formation of fruit color. Background Technology

[0002] Tomato (Solanum lycopersicum) is not only one of the world's most important vegetable crops, but also a model system for studying fruit development and ripening. Thousands of structurally diverse metabolites have been discovered in tomato fruits, many of which make significant contributions to the human diet. Modern tomato breeding primarily focuses on yield and resistance to biotic and abiotic stresses, often neglecting fruit quality, which is therefore a major goal of tomato improvement. Fruit color is one of the most important appearance qualities of tomatoes, used to assess maturity and post-harvest life, and is also a major factor influencing consumer purchasing decisions. Tomato fruit color is determined by the levels and proportions of different pigments, mainly due to the accumulation of carotenoids in the pulp and flavonoids in the peel, as well as the degradation of chlorophyll during ripening.

[0003] Flavonoids are a class of polyphenolic compounds produced by secondary metabolism in plants, widely found in fruits, vegetables, and other food crops. In plants, flavonoids typically participate in the coloring of fruits and flowers, protecting plants from biotic and abiotic stresses. For humans, flavonoids are a major component of foods such as vegetables and fruits. Due to their antioxidant, antibacterial, and anti-inflammatory biological activities, they are now considered indispensable ingredients in various nutritional supplements, pharmaceuticals, medicines, and cosmetics. Flavonoids play a crucial role in determining fruit peel color and have been proven to be beneficial hydrophilic antioxidants with important functions for human health. Naringin chalcone (NarCh) is one of the most abundant flavonoids in tomatoes. Its accumulation in the peel gives it a yellow color, which, combined with the red flesh, forms the red appearance of the tomato fruit. Some tomatoes have a pink appearance due to a lack of naringin chalcone accumulation, resulting in a translucent peel.

[0004] The biosynthetic pathway of flavonoids begins with 4-coumaryl-CoA produced via the phenylalanine pathway. Chalcone synthase (CHS) was the first enzyme to participate in the flavonoid pathway and convert 4-coumaryl-CoA into naringenin chalcone. Most genes involved in the biosynthesis of flavonoids have been identified, such as chalcone isomerase (CHI), flavonoid 3-hydroxylase (F3H), flavonoid 3'-hydroxylase (F3'H), and flavonol synthase (FLS). The flavonoid biosynthesis pathway is mainly regulated by the transcription factors R2R3-MYB, bHLH, and WD40, either alone or in combination. In tomato, SlMYB12 is a major regulator of flavonoid biosynthesis, capable of regulating the accumulation of yellow naringenin chalcone in the tomato fruit epidermis by broadly targeting and activating the transcription of flavonoid biosynthesis genes.

[0005] Besides regulatory genes, flavonoid biosynthesis is also influenced by signals from plant hormones, including auxins, gibberellins, and ethylene. In recent years, there have been reports on the regulation of flavonoid biosynthesis by the sterol plant hormone brassinosteroids (BR), but the specific regulatory mechanisms and gene functions involved in its signal transduction pathways have not been fully verified. The GSK3 family gene SlBIN2 (Solyc07g055200) is a negatively regulating protein kinase in the BR signal transduction process, capable of phosphorylating BZR1 and BES1, thereby negatively regulating BR signaling. Its nucleotide sequence reference is SlBIN2 (Solyc07g055200) in the Accession numbers of the paper published at https: / / doi.org / 10.1111 / jipb.13491.

[0006] The invention CN113957086A, "Application of SlBIN2 gene in regulating tomato fruit ripening and carotenoid synthesis," states that SlBIN2 negatively regulates tomato fruit ripening and carotenoid synthesis; and that knocking out the SlBIN2 gene promotes the accumulation of carotenoids in tomato fruit.

[0007] It should be noted that the ripening of tomato fruit and the synthesis of carotenoids are not related to the synthesis of naringenin chalcone.

[0008] Currently known flavonoid structural genes include: chalcone synthase gene (CHS), chalcone isomerase gene (CHI), flavonoid 3-hydroxylase gene (F3H), flavonoid 3'-hydroxylase gene (F3'H), and flavonol synthase gene (FLS). The flavonoid biosynthesis pathway and flavonoid accumulation are mainly controlled by the transcriptional network regulated by SlMYB12.

[0009] The hue angle refers to the angle of a color on the color wheel, also called hue; pure red is at 0 degrees, pure green at 120 degrees, and pure blue at 240 degrees. Compared to the Wt.T. (Wt), an increased hue angle makes a tomato appear orange; a decreased hue angle makes a tomato appear red. Summary of the Invention

[0010] The technical problem to be solved by this invention is to provide a new use for the SlBIN2 gene---regulating the synthesis of naringenin chalcone in tomato peel and fruit color formation.

[0011] To address the aforementioned technical problems, this invention provides an application of the GSK3 family gene SlBIN2 in regulating the synthesis of naringenin chalcone in tomato peel and fruit color formation. The nucleotide sequence of the SlBIN2 gene is shown in SEQ ID No: 1.

[0012] As an improvement to the application of this invention: SlBIN2 regulates (positively regulates) the synthesis of naringenin chalcone in tomato peel and the size of the hue angle.

[0013] As a further improvement to the application of the present invention: overexpression of the SlBIN2 gene promotes the synthesis of naringenin chalcone in tomato peel, and the hue angle is significantly increased.

[0014] As a further improvement to the application of the present invention:

[0015] SlBIN2 promotes the accumulation of naringenin chalcone by promoting the expression of flavonoid regulatory genes and structural genes;

[0016] The flavonoid regulatory gene is SlMYB12, and the flavonoid structural genes are SlCHS1, SlCHS2, and SlF3'H.

[0017] In this invention: the protein encoded by the gene SlBIN2 has the amino acid sequence shown in SEQ ID NO: 2.

[0018] The transgenic tomatoes obtained using the method of this invention can improve the content and color of naringenin chalcone in the tomato peel. Measurement of naringenin chalcone content revealed that the SlBIN2 gene plays a positive regulatory role in the accumulation of naringenin chalcone in tomato peel. Color difference analysis showed that compared with wild-type WT, the hue angle of the SlBIN2 gene overexpression material was significantly increased, while the hue angle of the SlBIN2 gene knockout material was significantly decreased. Overexpression of the SlBIN2 gene in tomatoes can cultivate tomato materials with higher naringenin chalcone content, showing promising application prospects in improving the sensory and nutritional quality of tomatoes.

[0019] It should be noted that the SlBIN2 (Solyc07g055200) gene belongs to the GSK3 family of transcription factors. Currently, the mechanisms by which GSK3 family transcription factors regulate tomato naringenin chalcone and fruit color formation are unclear. CN113957086A only indicates that SlBIN2 negatively regulates tomato fruit ripening and carotenoid synthesis, but tomato fruit ripening and carotenoid synthesis are not related to naringenin chalcone synthesis, and its relationship with fruit color has not been reported.

[0020] Therefore, those skilled in the art cannot determine whether SlBIN2 (Solyc07g055200) is related to naringenin chalcone and fruit color formation. Consequently, the role of SlBIN2 in regulating tomato naringenin chalcone synthesis and fruit color formation has not been reported to date. Attached Figure Description

[0021] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0022] Figure 1 The content of naringenin chalcone in the peel of SlBIN2 gene overexpression and gene-edited lines and wild-type tomatoes.

[0023] Figure 2 The expression levels of the flavonoid regulatory gene SlMYB12 and structural genes SlCHS1, SlCHS2, and SlF3'H in the peel of SlBIN2 gene overexpression, gene-edited lines, and wild-type tomatoes are shown.

[0024] Figure 3 It is the color angle of the red-ripe skin of SlBIN2 gene overexpression and gene-edited lines compared with wild-type tomatoes. Detailed Implementation

[0025] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0026] I. Obtaining the full-length sequence of the tomato SlBIN2 gene:

[0027] Refer to SlBIN2(Solyc07g055200) in the Accession numbers of the published paper https: / / doi.org / 10.1111 / jipb.13491.

[0028] The nucleotide sequence of the gene SlBIN2 is shown in SEQ ID No: 1; the amino acid sequence of the protein encoded by this gene is shown in SEQ ID No: 2.

[0029] II. Construction of the tomato SlBIN2 gene overexpression vector:

[0030] The construction of the SlBIN2 overexpression vector was carried out using pGWB17 as the final vector. The pGWB17-SlBIN2 vector with the CaMV35S recombinant overexpression promoter was constructed. For reference, see the published patent: CN113957086A "Application of SlBIN2 gene in regulating tomato fruit ripening and carotenoid synthesis".

[0031] Specifically, the target fragment (i.e., the sequence described in SEQ ID No: 1) was transferred from the pQB-V3 initial vector to the pGWB17 final vector using the LR reaction. The Enzyme Mix (Thermo Fisher) kit was used, following the instructions in the kit's package insert. After the reaction, the pGWB17-SlBIN2 plasmid was transformed into *E. coli* DH5α competent cells. Screening was performed using the plating method, and colony PCR was used to identify pGWB17 recombinant plasmids carrying the target fragment. Sequencing was then used for identification. The sequencing results were analyzed using DNAMAN software. This yielded the pGWB17-SlBIN2 vector (pGWB17-35S::SlBIN2) with the CaMV35S recombinant overexpression promoter.

[0032] III. Construction of CRISPR / Cas9 vector for tomato SlBIN2 gene knockout:

[0033] Reference: CN113957086A "Application of SlBIN2 gene in regulating tomato fruit ripening and carotenoid synthesis".

[0034] Specifically, the following steps were taken: Using online professional software (http: / / crispr.mit.edu / ), a CRISPR / Cas9 editing target sgRNA sequence was designed in the coding sequence of the SlBIN2 gene (SEQ ID NO:1): 5'-CTGGGACCTCAGCACCATAA-3'; and corresponding target primer sequences were synthesized at a biotechnology company: 5'-ATTGTTATGGTGCTGAGGTCCCAG-3' and 5'-AAACCTGGG ACCTCAGCACCATAA-3'. The target primers were annealed and ligated into the intermediate vector AtU6-26-sgRNA-SK. Plasmids that were PCR-verified and correctly sequenced were extracted, double-digested with Nhe I and SpeI, and after electrophoresis, fragments of approximately 642 bp were gel-cleaved and recovered; the recovered fragment is the sgRNA cassette. Then, sgRNA cassette was ligated into the pCAMBIA1300-pYAO:Cas9 plasmid digested with Spe I. Colony PCR was performed using primer sequences on the binary vector for identification. Correctly identified single clones were picked, propagated, and plasmids were extracted. Restriction digestion with Sal I and Kpn I was performed for verification. The plasmid with a digested fragment length of approximately 670 bp was the CRISPR / Cas9 gene editing vector of SlBIN2.

[0035] IV. Study on the content of citric acid tannin in the peel of genetically modified tomatoes

[0036] The Ailsa Craig (AC) variety is designated as a wild-type tomato and denoted as WT.

[0037] The pGWB17-SlBIN2 vector plasmid was transformed into Agrobacterium LBA4404 strain, and tomato cotyledons were infected. Tissue culture seedlings were obtained through callus induction, resistance-induced differentiation, and rooting culture. Positive transgenic plants were verified using PCR and RT-PCR. T2 generation seeds were sown on kanamycin (50 mg / L) medium for germination, thus obtaining the SlBIN2 transgenic material SlBIN2-OE.

[0038] The CRISPR / Cas9 vector plasmid with the SlBIN2 gene knocked out of tomato was transformed into Agrobacterium LBA4404 strain. Tomato cotyledons were used as explants and co-cultured with bacterial solution to obtain callus tissue. The callus tissue was processed into differentiation medium and rooting medium to obtain transgenic positive seedlings. The positive transgenic plants were verified by PCR and RT-PCR, thus obtaining the SlBIN2 transgenic material bin2.

[0039] Wild-type and SlBIN2 transgenic materials were grown in the same greenhouse at the Huajiachi Vegetable Base of Zhejiang University. Thirty-five days after flowering, the fruits reached the green-ripe stage (MG). Three days after the green-ripe stage, the fruit tip turned red, marking the color-breaking stage (B). Seven days after the color-breaking stage, the fruits reached the red-ripe stage (B+7). Whole fruit peel samples were taken from the SlBIN2 overexpressing transgenic line SlBIN2-OE and the gene-edited line bin2, along with wild-type tomato WT, when the fruits reached the red-ripe stage.

[0040] The fruit peel sample was ground with liquid nitrogen, and approximately 1 g of powder was extracted with 3 ml of 50% methanol. The extraction was performed by sonication for 30 min (power supply voltage 220V, operating frequency 53 kHz, power consumption 350 W, temperature 4℃), followed by centrifugation at 12000 rpm for 15 min. The supernatant was collected and filtered through a 0.22 μm nylon membrane filter for HPLC analysis. Flavonoids were analyzed using a Shimadzu high-performance liquid chromatograph with an SPD-M20A diode array detector and a C18 column (5 μm particle size, 4.6 mm x 250 mm, Elite analytical instruments Co., Ltd., Dalian, China). The mobile phase was (A) water and (B) acetonitrile, using gradient elution. The elution gradient was: solution B 80%-80% (5 min), solution B 80%-55% (15 min), solution B 55%-55% (6 min), solution B 55% to B 0% (4 min), solution B 0%-0% (5 min), solution B 0%-80% (1 min), solution B 80%-80% (9 min). The flow rate was 1.0 mL / min, the column temperature was 25℃, and the detection wavelength was 370 nm. The content was calculated using the external standard method with naringin chalcone standard (Sigma, St Louis, MO, USA). Results are expressed in μg / g. -1 FW (fresh weight) is the unit of measurement.

[0041] The content of naringin chalcone in the peel of SlBIN2 gene overexpression and gene-edited lines compared with that in wild-type tomato peels is as follows: Figure 1 The results showed that the naringin chalcone content in the SlBIN2 gene overexpression lines was significantly higher than that in the wild type, while the naringin chalcone content in the bin2 gene-edited lines was significantly lower than that in the wild type. This indicates that SlBIN2 gene overexpression promotes the accumulation of naringin chalcone in tomato peel.

[0042] V. Study on the expression level of flavonoid genes in transgenic tomato peel

[0043] Whole fruit peel samples were taken from WT, SlBIN2-OE, and bin2 fruits during the color-breaking stage. RNA was extracted, reverse transcribed into cDNA, and gene expression levels were detected using real-time quantitative PCR.

[0044] The primers corresponding to the flavonoid regulatory gene SlMYB12 are F: AGCTTGTGATAGTGCCATGGAA, R: CTCGAGTCTTGGCCATTCGATA.

[0045] The primers corresponding to the flavonoid structural gene SlCHS1 are F: GGCTTACATTCCACTTACTC, R: GAGAGTTCCAGTCAGATATACC;

[0046] The primers corresponding to the flavonoid structural gene SlCHS2 are F: TTAGCTGAGAACAACAAGGG, R: CCAACCATACTATCCAAATGAG;

[0047] The primers corresponding to the flavonoid structural gene SlF3'H are F:GCTTTAGATGACTTCCGCC, R:GTTCCTTCGATTCTCCAACTC;

[0048] The primers corresponding to the internal reference gene Actin are F: CCTCAGCACATTCCAGCAG, R: CCACCAAACTTCTCCATCCC.

[0049] Real-time quantitative PCR was performed using the SYBR Green PCR Master Mix kit, with Actin as an internal control gene. –ΔΔCT The relative gene expression level was calculated using a method. The reaction system for real-time quantitative PCR was 20 μL, containing 10 μL of SYBR Green Master Mix, 1 μL each of the upper and lower primers, and 8 μL of a mixture of template DNA and sterile ultrapure water. The reaction program was 95℃ for 5 min; 95℃ for 10 sec, 60℃ for 30 sec, for 40 cycles.

[0050] The results are as follows Figure 2 As stated above. Figure 2 This indicates that the expression levels of both the flavonoid regulatory gene SlMYB12 and the structural genes SlCHS1, SlCHS2, and SlF3'H were significantly increased in SlBIN2-OE and significantly decreased in bin2. According to... Figure 2 The following conclusion can be drawn: SlBIN2 can inhibit the accumulation of naringenin chalcone by suppressing the expression of flavonoid regulatory genes and structural genes.

[0051] Note: SlMYB12 is a regulatory gene of the flavonoid pathway, while SlCHS1, SlCHS2, and SlF3'H are structural genes of the flavonoid pathway. They all play a positive regulatory role in the accumulation of flavonoids.

[0052] VI. Research on the Fruit Color of Genetically Modified Tomatoes

[0053] Color difference analysis was performed on tomato fruits of WT, SlBIN2-OE, and bin2 varieties at the red ripening stage. The L, a, and b values ​​of the fruits were measured using a 3nh spectrophotometer (SN:41000735). Color change was assessed by the change in hue angle, indicating color saturation. The hue angle value was calculated using the following formula: Hue angle = tan... -1 (b / a)(a>0)or 180+tan -1 (b / a)(a<0).

[0054] The results are as follows Figure 3 According to Figure 3 It can be seen that the hue angle of SlBIN2-OE increases significantly, and the OE series eventually exhibits an orange phenotype.

[0055] In summary, SlBIN2 can improve the color of tomato fruit and positively regulate the synthesis of naringenin chalcone.

[0056] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.

Claims

1. SlBIN2 The application of gene overexpression in promoting the accumulation of naringenin chalcone in tomato peel and increasing the hue angle is characterized by: SlBIN2 The nucleotide sequence of the gene is shown in SEQ ID No:

1.

2. The application according to claim 1, characterized in that: SlBIN2 promotes the accumulation of naringenin chalcone by promoting the expression of flavonoid regulatory genes and structural genes; Flavonoid regulatory genes are SlMYB12 The flavonoid structural gene is SlCHS1 , SlCHS2 , SlF3'H .

Images