Cloning and Application of the Major Gene QT12 for Rice Quality and Yield Tolerant to Natural High Temperature in Paddy Fields

By cloning and utilizing the QT12 gene, combining CRISPR/Cas9 vector and molecular marker-assisted breeding technology, the problem of unstable quality and yield of rice under high temperature conditions was solved, the steady-state balance of rice storage substance content and yield improvement was achieved, and the heat resistance and market value of rice were improved.

CN119876248BActive Publication Date: 2025-07-04HUAZHONG AGRI UNIV +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510316742.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-18
Publication Date
2025-07-04
Estimated Expiration
2045-03-18

AI Technical Summary

Technical Problem

The prior art is difficult to accurately identify and utilize heat-resistant rice germplasm resources in high temperature environments in the field, resulting in poor rice quality and yield under high temperature conditions, especially high chalky rate and unstable storage substance content, which affects the market value of rice and farmers' income.

Method used

The QT12 gene in rice was cloned and used to regulate the heat resistance of rice quality and yield through gene editing and molecular marker-assisted breeding technology, including knocking out, inhibiting or improving QT12 gene expression, and using CRISPR/Cas9 vector and molecular marker-assisted breeding technology to improve the heat resistance of rice quality and yield.

Benefits of technology

Under high temperature conditions, the steady-state balance of rice storage protein and amylose is effectively maintained, the chalky rate is reduced, the fruiting rate and yield are improved, the food taste value and market competitiveness of rice are improved, and the heat resistance of rice quality and yield at high temperatures is solved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876248B_ABST
    Figure CN119876248B_ABST
Patent Text Reader

Abstract

The present invention relates to the application of the QT12 gene in rice to coordinately improve rice quality and yield under natural high-temperature field environments. Map-based cloning identified the QT12 gene. High-expression alleles under high temperature disrupt the homeostasis of endosperm storage substances and negatively regulate the heat tolerance of rice quality. Large-scale field high-temperature experiments showed that non-functional or weak-functional QT12 not only confers stronger heat tolerance on quality traits such as low chalkiness, high storage protein, and low amylose content in rice grains, but also significantly increases the seed setting rate and plot yield. The G / A variation within indica rice and the 6-bp insertion / deletion variation between indica and japonica rice explain the genetic basis of heat tolerance differences within indica rice and between indica and japonica rice, such that the A variation within indica rice has lower expression and higher heat tolerance compared to G, or the deletion of 6 bp within indica rice has lower expression and higher heat tolerance compared to the insertion of 6 bp within japonica rice, which is of great significance for breaking through the breeding bottleneck of the contradiction between crop resistance and growth, and between yield and quality.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular breeding, and particularly relates to the cloning and application of the major gene QT12 for rice quality and yield tolerance to natural high temperature in the field. Background Art

[0002] Global warming seriously threatens global agricultural production and poses a major threat to global food security. For every 1°C increase in the global average temperature, the average yield of major crops will decrease by 3.1–7.4%, posing a major threat to global food security. In addition, global food security is not only related to yield but also closely related to quality. Rice determines human nutrition, market value, and farmers' income, especially in Southeast Asia and Africa, where high temperatures occur frequently and there is a high dependence on grains. High temperature can deteriorate the appearance, milling, cooking, eating, and nutritional quality of grains. These problems highlight the necessity of sustainable agriculture that improves the high-temperature tolerance of crops to improve rice quality and yield under high temperature.

[0003] Rice has shifted from solely pursuing high yield in the past to now paying more attention to appearance and eating quality while pursuing high yield. Rice quality includes appearance, nutrition, cooking, eating, milling, and sensory characteristics, etc., and is an important indicator to measure the economic value and edible value of paddy rice. Its quality directly determines the market price of rice and consumers' willingness to buy, and greatly affects farmers' income. Chalkiness, as the most intuitive trait of rice appearance quality, is also the most direct and sensitive indicator of the deterioration of rice quality caused by high temperature. It directly affects rice appearance quality, cooking and eating quality, nutritional quality, and head rice rate / yield, and is a major issue determining the market value of rice in global rice-producing areas and the composition of human food consumption. At the same time, due to the complex composition factors of quality traits and being greatly affected by other factors, it has greatly restricted the pace of rice quality improvement.

[0004] The innovation of global high-quality rice faces huge challenges brought by frequent high temperatures, manifested as the low proportion and weak market competitiveness of global high-quality rice, because most modern high-quality rice varieties have low heat tolerance for rice quality. If rice does not have an attractive price, farmers' enthusiasm will be inhibited, and rice production will decline accordingly. To improve the heat tolerance of crops, it is crucial to identify germplasm resources that are stably heat-tolerant in various natural high-temperature environments. Traditional methods for identifying heat-tolerant phenotypes and potential QTLs or genes usually focus on identifying yield traits such as seedling survival rate or seed setting rate at the reproductive stage in controlled environments such as greenhouses, and cannot accurately simulate natural high temperature in the field environment, often resulting in the failure to successfully identify truly heat-tolerant germplasm. Therefore, there are still few germplasms and QTLs with true heat tolerance suitable for breeding purposes. Therefore, it is necessary to identify truly heat-tolerant germplasm under field high temperature, clone QTLs with true heat tolerance, and clarify the potential mechanisms to overcome the challenges of developing crops tolerant to natural high temperature for breeding. Summary of the Invention

[0005] The present invention isolated and cloned a major QTL gene that improves rice quality and yield under high-temperature conditions in natural paddy fields over the years from the high-quality rice varieties Chenghui 448 and OM1723. QT12 It provides a new gene resource for breeding to synergistically improve rice yield and quality under the background of global warming.

[0006] The object of the present invention is to provide the application of the QT12 gene or the protein encoded thereby in improving rice quality (chalky appearance quality, storage substance content, taste quality, etc.) and yield under high-temperature conditions in paddy fields over multiple years and multiple locations.

[0007] Analysis of the rice quality of the F2 genetic population of Chenghui 448 and OM1723 under high-temperature conditions in paddy fields in the present invention found that this gene has a great effect on the chalky rate. Using the F3 genetic population and the method of map-based cloning, QT12 it was finely mapped to a 14-kb chromosomal segment, which contains 1 ORF. Through further genotype and expression level analysis, it was determined as a reliable candidate gene. It has only 1 full-length cDNA. The full sequence of this gene in Chenghui 448 is shown as SEQ ID NO.1, the full sequence of this gene in OM1723 is shown as SEQ ID NO.2, and the full sequence of this gene in japonica rice ZH11 is shown as SEQ ID NO.3, including the promoter, 5’ UTR, CDS, intron, 3’ UTR, and its CDS sequence is shown as SEQ ID NO.4, and the encoded protein is shown as SEQ ID NO.5.

[0008] The protection scope of the present invention includes:

[0009] The application of the QT12 gene or the protein encoded thereby in regulating rice quality (chalky appearance quality and storage substance content, etc.) and yield under natural high temperature, and the QT12 gene sequences in Chenghui 448, OM1723 and ZH11 are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively, the CDS sequence is shown as SEQ ID NO.4, and the protein sequence is shown as SEQ ID NO.5.

[0010] The above-mentioned application specifically is:

[0011] Knocking out, inhibiting or reducing the QT12Improve the heat tolerance of rice under field high temperature by regulating the expression, function or activity of genes or their encoded proteins, that is, better maintain the homeostatic balance of storage substances such as rice storage proteins and amylose, low chalkiness (good appearance quality) and higher rice taste value and other quality traits under high temperature, while increasing the seed setting rate, the number of filled grains and the yield, etc.

[0012] Increase in rice QT12 The expression level of genes or the expression level or activity of their encoded proteins to reduce the heat tolerance of rice under field high temperature, that is, the quality deteriorates such as a decrease in rice storage proteins, an increase in amylose, an increase in chalkiness (poor appearance quality) and a decrease in rice taste value under high temperature, while the seed setting rate, the number of filled grains decrease and the yield decreases, etc.

[0013] The substance that inhibits the expression level or function of QT12 protein in rice is the CRISPR / Cas9 vector with the knockout target sequence being the polynucleotide shown in SEQ ID NO.6. The rice with improved heat tolerance of quality under field high temperature after editing by the CRISPR / Cas9 system has the following polynucleotides:

[0014] ①AATGGCGATGGCCCTGCTCAGAGG

[0015] ②AATGGCGATGGCCCTGCCTAGAGG

[0016] AATGGCGATGGCCCTCCAGAGG

[0017] ③AATGGCGATGGCCCTGCCGCAGAGG

[0018] AATGGCGATGGCCCTGCTCAGAGG

[0019] Using any molecular markers designed with QT12 two main allelic functional variations G / A, including CAPS and KASP, etc., for marker-assisted breeding or gene editing technology to introduce / replace the low-expression QT12 allele QT12 A (high-quality variety Chenghui 448) into / replace the high-expression QT12 allele QT12 G (high-quality main cultivar Huazhan) to improve the heat tolerance of rice under field high temperature, that is, better maintain the homeostatic balance of storage substances such as rice storage proteins and amylose, low chalkiness (good appearance quality) and higher rice taste value and other quality traits under high temperature, while increasing the seed setting rate, the number of filled grains and the yield, etc. Containing the low-expression QT12The allele is the genomic fragment shown in SEQ ID NO.1. Using marker-assisted selection to generate QT12 Huazhan introgression line A Contains the genomic fragment with the allele shown in SEQ ID NO.1.

[0020] Using indica-japonica QT12 Any molecular markers designed based on two major 6-bp InDel variations, including CAPS, KASP, and InDel, etc., for marker-assisted breeding or gene editing technology to introgress / replace the low-expressed QT12 I allele into / japonica rice ( QT12 J ) to improve the heat tolerance of japonica rice under field high temperature, that is, to better maintain the steady-state balance of storage substances such as rice storage protein and amylose, low chalkiness (good appearance quality), and higher rice taste value and other quality traits under high temperature, while increasing the seed setting rate, the number of filled grains, and the yield, etc.

[0021] Using any molecular markers designed based on QT12 two major allelic functional variations G / A, including CAPS and KASP, etc., for marker-assisted breeding or gene editing technology to introgress / replace the high-expressed QT12 allele QT12 G (high-quality variety OM1723) into / replace the low-expressed QT12 allele QT12 A (high-quality variety Chenghui 448) or introduce substances that can increase the expression level of the protein encoded by QT12 in rice to reduce the heat tolerance of rice under field high temperature, that is, the rice storage protein decreases, the amylose increases, the chalkiness increases (poor appearance quality), and the rice taste value decreases and other quality deteriorates under high temperature, while the seed setting rate, the number of filled grains decrease, and the yield decreases, etc. Contains the high-expressed QT12 alleles are the genomic fragments shown in SEQ ID NO.2 and SEQ ID NO.3, and the substances are nucleic acid molecules or their expression cassettes, recombinant vectors, recombinant microorganisms containing the nucleic acid molecule encoding the QT12 protein, and the nucleic acid molecule encoding the QT12 protein is shown in SEQ ID NO.4. Using marker-assisted selection to generate QT12 Chenghui 448 introgression line NIL OM Contains the genomic fragment with the allele shown in SEQ ID NO.2.

[0022] Using indica-japonica QT12Any molecular markers designed for two major 6-bp InDels, including CAPS, KASP, and InDels, etc., are used for marker-assisted breeding or gene editing technology to highly express in japonica rice (ZH11). QT12 allele QT12 J is introduced into indica rice (Sanhuangzhan-2; QT12 I ) to reduce the heat tolerance of rice under field high temperature, that is, the quality deteriorates, such as the reduction of rice storage protein, the increase of amylose, the increase of chalkiness (poor appearance quality), and the decrease of rice taste value under high temperature. At the same time, the seed setting rate, the number of filled grains, and the yield decrease, etc. The QT12 allele in japonica rice ZH11 is the genomic fragment shown in SEQ ID NO.3.

[0023] Specifically, the present invention provides any of the following applications:

[0024] A) The application of rice QT12 protein, the nucleic acid molecule encoding the protein, or the expression cassette, recombinant vector, transgenic cell line or recombinant bacterium containing the nucleic acid molecule in regulating the heat tolerance of rice quality and yield or in preparing a product for regulating the heat tolerance of rice quality and yield;

[0025] B) The application of a reagent that reduces the functional activity of QT12 protein in cultivating heat-tolerant rice germplasm with quality and yield or in preparing a product for cultivating heat-tolerant rice germplasm with quality and yield;

[0026] The amino acid sequence of the QT12 protein is shown in SEQ ID NO.5.

[0027] Furthermore, the rice quality includes chalky appearance quality, storage substance content, and taste quality. Among them, the chalky appearance quality includes chalky rice rate and chalkiness degree; the storage substances include storage protein and amylose; the nucleotide sequence encoding the QT12 protein is shown in SEQ ID NO.4.

[0028] The present invention provides a method for enhancing rice quality and yield under high temperature and / or cultivating heat-tolerant rice germplasm with quality and yield. By knocking out, inhibiting or reducing the expression, function or activity of the QT12 gene or its encoded protein in rice, the heat tolerance of rice quality and yield is improved, that is, the obtained rice can better maintain the steady-state balance of rice storage protein and amylose content, low chalkiness and higher rice taste value under high temperature. At the same time, the seed setting rate, the number of filled grains increase, and the yield increases. The protein sequence encoded by the QT12 gene is shown in SEQ ID NO.5.

[0029] Furthermore, the substance that inhibits the expression level or function of QT12 protein in rice is a CRISPR / Cas9 vector, and the target sequence targeted by the CRISPR / Cas9 vector is the polynucleotide site shown in SEQ ID NO.6.

[0030] The present invention provides an SNP molecular marker capable of distinguishing the heat tolerance of rice quality and yield within indica rice and between indica-japonica rice. The SNP molecular marker is located at the -1455 position upstream of the QT12 gene promoter (corresponding to the 3718373rd base on chromosome 12 of rice, and the reference genome version is MSU version 7.0), with A / G polymorphism. Specifically, there is an A / G mutation at the 2372nd position of the sequence shown in SEQ ID NO.3. Among them, when the SNP site is A, the rice is identified as indica rice, and it shows a lower quality heat damage index, that is, higher quality heat tolerance, and a lower QT12 expression level.

[0031] The present invention provides an indel molecular marker capable of distinguishing indica-japonica rice and related to the heat tolerance of rice quality and yield. The indel molecular marker specifically has a 6bp deletion or not at the 2828-2833 positions of the sequence shown in SEQ ID NO.3 (corresponding to the 3718829-3718834th bases on chromosome 12 of rice, and the reference genome version is MSU version 7.0). When the result is -6bp, it is identified as indica rice.

[0032] The present invention provides a molecular marker combination related to the QT12 expression level and the heat tolerance of rice quality and yield. The molecular marker combination is the SNP defined above and the indel defined above. Further, according to the SNP and indel results, the rice germplasm is divided into three haplotypes: Hap1: G / + 6bp, Hap3: G / -6bp, Hap7: A / -6bp. Among them, the haplotype Hap7 has the lowest QT12 expression level, Hap3 is in the middle, and the expression level of QT12 in Hap1 is the highest. The lower the QT12 expression level, the higher the quality heat tolerance.

[0033] The present invention provides the application of any of the above-mentioned molecular markers or their combinations in identifying and assisting in identifying indica-japonica rice and / or cultivating heat-tolerant rice germplasm with quality and yield. The rice with SNP result of A and / or indel result of -6bp is identified as indica rice, and the rice with indel result of +6bp is identified as japonica rice. And according to the SNP and / or indel results, the rice with A, -6bp, or A / -6bp is selected for the co-cultivation of heat-tolerant rice germplasm with quality and yield.

[0034] The present invention provides a method for identifying and assisting in the identification of indica and japonica rice. Using any one of the above-mentioned molecular markers or their combinations to detect rice, rice with SNP result of A and / or indel result of -6bp is identified as indica rice, and rice with indel result of +6bp is identified as japonica rice.

[0035] The present invention provides a method for cultivating heat-tolerant rice germplasm with good quality and high yield. Using any one of the above-mentioned molecular markers or their combinations to detect rice, and selecting rice with A, -6bp, or A / -6bp according to the SNP and / or indel results for co-cultivating heat-tolerant rice germplasm with good quality and high yield.

[0036] Beneficial effects: The present invention has cloned a major gene that negatively regulates the heat tolerance of rice quality and yield at high temperatures in rice, providing a new gene resource for high-quality and high-yield breeding of cereal crops such as rice. Due to its highly conserved characteristics, it also provides a genetic basis for heat tolerance breeding and research in other crops. Brief Description of the Drawings

[0037] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required in the embodiments. It should be understood that the following drawings only show some embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings.

[0038] Figure 1 It is a technical flow chart of the present invention.

[0039] Figure 2 In the present invention QT12 of the initial mapping. a, The chalkiness rate of the appearance quality traits of rice grains at the filling stage of Chenghui 448 and OM1723 under six different natural field temperatures. Adjust the sowing time according to the heading dates of the two parents to keep the heading and filling times consistent. b, The grain width of Chenghui 448 and OM1723 under different field temperatures. c, Identification of the QTL gene for high temperature tolerance of rice grain chalkiness appearance quality using RICE 6K chip technology QT12 . The area within the ellipse is QT12 the locus. d, Determining the candidate QT12 locus using the co-segregation criterion, that is QT12 two homozygous genotypes can significantly distinguish the two extreme chalkiness phenotypes, where A (yellow), B (gray), and H (brown) respectively represent QT12 the high-value homozygous, low-value homozygous, and heterozygous genotypes of the

[0040] Figure 3 In the present invention QT12Identification of candidate genes. a, Using the chalkiness phenotypes and genotypes of 57 recombinant individuals screened from a large F3 population of 4310 plants QT12 for fine mapping and cloning. By performing phenotypic analysis on the offspring of each recombinant individual to infer QT12 the genotype. b, Comparative sequencing of QT12 in the two parents. c, Expression levels of two QT12 alleles in the endosperm of two NILs at 5-DAF (5 days after flowering) under different temperatures. d, Hap CH ( QT12 A ) and Hap OM ( QT12 G ) in the rice mini-core collection, including the quality heat injury index and the expression level of QT12 in the 5-DAF endosperm. The chalkiness of rice at high temperature minus the chalkiness of rice at normal temperature is defined as the quality heat injury index, and the lower the quality heat injury index, the stronger the quality heat tolerance.

[0041] Figure 4 This is the analysis of the expression level and heat tolerance of different QT12 genotypes in the mini-core collection of the present invention. a, Expression levels of QT12 in the 5-DAF endosperm of heat-tolerant (R) and sensitive (S) varieties identified from multi-year field high-temperature experiments. b, Distribution of the G / A variation of QT12 in 533 accessions of the mini-core collection. QT12 A and QT12 G are the resistant haplotype and the sensitive haplotype, respectively. c, Quality heat injury index and expression level of QT12 A and QT12 G in the 5-DAF endosperm of indica rice. QT12 Expression level.

[0042] Figure 5 This is the haplotype analysis and indica-japonica differentiation analysis of QT12 in the present invention. a, Haplotype analysis of QT12 in 4726 accessions of the rice core collection. Green letters indicate the functional G / A SNP variation on the QT12 promoter between Chenghui 448 and OM1723. The QT12 G of OM1723 and the QT12 A of Chenghui 448 are marked with circles, respectively. The ratios after the corresponding haplotypes are the numbers of indica and japonica varieties. b, QT12Natural variations between typical indica rice varieties Sanhuangzhan-2 (SHZ) / OM1723 (OM) / Chenghui 448 (CH) / Huazhan (HZ) and japonica rice variety ZH11. The variations in the box are the representative variations G / A in this study QT12 c QT12 Distribution of the 6-bp InDel in indica, japonica, Aus, and Intermediate rice. +6bp and -6bp indicate the presence or absence of the 6-bp variation, respectively. d QT12 Transient dual-luciferase reporter gene assay of the promoter in indica and japonica rice at different temperatures. e QT12 Expression levels in the three haplotypes determined by the 6-bp InDel and the functional variation G / A

[0043] Figure 6 in this invention QT12 Quality phenotypes of transgenic complementary lines at different field temperatures. a QT12 Appearance quality phenotypes of chalkiness in transgenic complementary lines at different field temperatures in Wuhan in 2022. b QT12 Appearance quality phenotypes of chalkiness in transgenic complementary lines at different field temperatures in Wuhan in 2023. c QT12 Contents of various storage substances in transgenic complementary lines at different field temperatures. d QT12 Ratios of the contents of various storage substances in transgenic complementary lines at different field temperatures

[0044] Figure 7 in this invention QT12 Quality phenotypes of transgenic knockout lines at different field temperatures. a QT12 Appearance quality phenotypes of chalkiness in transgenic knockout lines at different field temperatures in Wuhan in 2022. b QT12 Appearance quality phenotypes of chalkiness in transgenic knockout lines at different field temperatures in Wuhan in 2023. c QT12 Contents of various storage substances in transgenic knockout lines at different field temperatures. d QT12 Ratios of the contents of various storage substances in transgenic knockout lines at different field temperatures

[0045] Figure 8 For the rice quality phenotypes of the complementary lines in which the allele of japonica rice variety ZH11 is complemented to indica rice variety SHZ QT12 J under natural high temperature and normal temperature. a QT12 I ). Appearance quality phenotypes of chalkiness in complementary lines at different field temperatures. b QT12 J Appearance quality phenotypes of chalkiness in complementary lines at different field temperatures. b QT12 JContents of various storage substances in rice of complementary families. c, Under different field temperatures QT12 J Ratio of storage protein to amylose content in rice of complementary families.

[0046] Figure 9 In the present invention QT12 Quality phenotypes of two NIL materials under different field temperatures. a, QT12 Chalky appearance quality phenotypes of two NIL materials under different field temperatures in Wuhan in 2022. b, QT12 Contents of various storage substances of two NIL materials under different field temperatures. c, QT12 Ratio of contents of various storage substances of two NIL materials under different field temperatures.

[0047] Figure 10 In the present invention QT12 Observation on subcellular structure of endosperm of two NIL materials under different field temperatures. a, Scanning electron microscopy observation of mature endosperm of two NILs under natural high temperature and normal temperature conditions. b, Transmission electron microscopy observation on subcellular structure of endosperm cells of NIL CH and NIL OM at 10 - DAF. PBI and PBII represent protein body I and II respectively; SG represents starch granule. Scale bar, 2 µm. The statistical field area for the size and area of protein bodies and starch granules is 875 µm 2 . c, d, Number and area of starch granules (c) and protein bodies (d) in the abdominal part of endosperm of NIL CH and NIL OM at 10 - DAF (per 875 µm 2 ). e, Ratio of number and area of protein bodies to starch granules. f, Degree of maintenance of ratio of protein bodies to starch granules. The degree of maintenance refers to the ratio of the number or area of protein bodies to starch granules at high temperature compared to that at normal temperature.

[0048] Figure 11 Under natural high temperature and normal temperature conditions QT12 Plant type and various quality traits of Huazhan introgression lines. a, Plant type and chalky appearance quality trait phenotypes of Huazhan introgression lines under natural high temperature and normal temperature conditions. b, Contents of various storage substances of Huazhan introgression lines under natural high temperature and normal temperature conditions. c, Ratio of contents of various storage substances of Huazhan introgression lines under natural high temperature and normal temperature conditions.

[0049] Figure 12 In the present invention QT12 Yield and eating quality phenotypes of different genetic materials under field high temperature. QT12 NIL (a), complementary transgenic family (b), knockout family (c) and QT12J Seed setting rate, yield per plant, and rice eating quality value of complementary families (d) under different field temperature conditions.

[0050] Figure 13 In the present invention QT12 Effect on other yield traits of rice under high field temperature. a, Seed setting rate of two QT12 haplotypes in 533 rice mini-core germplasms and indica subpopulation. b, Other yield traits and chalkiness phenotypes of two NILs under high field temperature. c–e, Under natural high field temperature QT12 1000-grain weight, number of grains per plant, and number of spikelets per plant of complementary families (c), CRISPR families (d), and QT12 J complementary families (e).

[0051] Figure 14 In the present invention QT12 Phenotypes of yield traits of different genetic materials under normal field temperature in Wuhan. QT12 of complementary transgenic families (a), knockout families (b), and QT12 J Seed setting rate, number of filled grains per plant, number of spikelets per plant, and 1000-grain weight of complementary family (c) under normal field temperature.

[0052] Figure 15 For two elite varieties QT12 Large-scale field high temperature tests of NILs and introgression lines. a, Maximum air temperatures during rice flowering and grain filling stages in Wuhan, Hangzhou, and Changsha from 2000 to 2024. b–h, QT12 Plot yields (5 square meters), seed setting rates, number of filled grains per plant, yields per plant, chalkiness rates, and chalkiness degrees of NILs (b–e) and Huazhan introgression lines (f–h) under natural high temperature conditions in Wuhan, Hangzhou, and Changsha in 2024. Genetic materials in each city were based on large-scale field tests with a randomized block design, with 3–4 plot replicates for each family, each plot having an area of approximately 5 square meters and 12×15 = 180 individual plants.

[0053] Figure 16 In the present invention QT12 Large-scale field high temperature tests of different transgenic genetic materials. a–g, QT12 Plot yields (5 square meters), seed setting rates, number of filled grains per plant, yields per plant, chalkiness rates, and chalkiness degrees of complementary families (b–d) and CRISPR knockout families (e–g) under natural high temperature conditions in Wuhan, Hangzhou, and Changsha in 2024.

[0054] Figure 17 In the present invention QT12 Grain width of different genetic materials in the high temperature environment of Wuhan in 2024.

[0055] Figure 18 In the present invention QT12 Plant heights and growth periods of different genetic materials under normal temperatures in Wuhan in 2024. QT12 Plant heights and heading dates of near-isogenic lines (g, h), Huazhan introgression lines (i, j), transgenic complementary families (k), and transgenic CRISPR knockout families (l).

[0056] Figure 19 In the present invention QT12 mRNA and protein expression levels at different temperatures in wild-type ChengHui 448 and QT12 complementary families. Detailed implementation manners

[0057] The following examples are only used to more clearly illustrate the technical solutions of the present invention, and thus are only examples and cannot be used to limit the protection scope of the present invention. It should be noted that unless otherwise specified, the technical terms or scientific terms used in this application should be the ordinary meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field. Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0058] The parents used in the present invention are rice ChengHui 448 and OM1723, both belonging to the rice micro-core germplasm resources, and having the same grain width.

[0059] Example 1 Natural high-temperature treatment in the paddy field during the rice filling period

[0060] To subject each rice genetic material to natural high temperature and normal temperature treatments during the filling period, we planted each genetic material in batches according to the sowing time, adjusted the planting time for each material according to the length of its heading period, generally sowing once every half month or so, and tried to ensure that the heading and early filling stages were during the high temperature period in the Wuhan fields. For materials with a relatively long heading period (>95 days), such as genetic materials with Chenghui 448 or OM1723 as the background, they were usually sown in the middle or late April; for materials with a relatively short heading period (<80 days), they were sown around mid-May. Different sowing dates enabled genetic materials with different growth periods to start heading and filling uniformly in the middle or late July or early August. During this period, extreme high temperature weather exceeding 35 °C often occurred in Wuhan, and this record had lasted for more than 60 years. For the normal temperature treatment experiment, all materials were sown in mid-June or at the end of June. In this way, short-heading materials usually started heading and filling in the first or second ten days of September, while long-growth-period materials started heading and filling in the last ten days of September. During this period, the average temperature in Wuhan was relatively low and normal (about 30 °C). The dynamic air temperature data were automatically recorded every 5 minutes using a USB temperature and humidity recorder (USB-TH) in the fields of Huazhong Agricultural University from June to October and in the Nanshan Base in Lingshui from February to May. The early filling stage was the most sensitive period for rice endosperm. Therefore, the daily average temperature during the early filling stage, 6 - 12 days after flowering of each material, was statistically calculated from 9 am to 7 pm. When the chalkiness rate of sensitive materials such as OM1723, NIL OM or ZH11 significantly increased, it indicated that these materials had undergone high temperature treatment during the filling period. On the contrary, when all sensitive wild-type materials still maintained a relatively low grain chalkiness rate, it indicated that they had filled under normal temperature.

[0061] Example 2: Identification of Quality and Yield of Rice in the Field under Natural Temperature

[0062] Before examining appearance quality traits such as rice chalkiness, the harvested mature seeds were fully dried or sun-dried and stored at room temperature for at least three months. Rice chalkiness, including belly white, heart white, and back white, was generally detected by visual inspection. The mature and dry seeds were threshed and husked into brown rice. 100 intact grains were randomly selected, and the percentage of grains with chalkiness was counted and expressed as the grain chalkiness rate (GCR). The rice with chalkiness was laid flat and the percentage of the projected area of the chalky part in the entire projected area of the rice was visually inspected and expressed as the grain chalkiness area (GCA). The chalkiness degree (GCD) was the product of the grain chalkiness rate and the chalkiness area. All chalkiness traits were expressed as percentages. Chalkiness in rice would reduce the appearance, milling, cooking, and eating quality of rice, as well as the head rice yield. Therefore, an increase in chalkiness was the most direct indicator of rice quality, and high temperature was extremely likely to cause sensitive changes in chalkiness. Therefore, lower rice chalkiness under high temperature indicated stronger high temperature tolerance of rice quality.

[0063] The total protein content of rough rice grains and the amylose content of milled rice flour were measured using an XDS near-infrared rapid content analyzer (FOSS) and near-infrared reflectance spectroscopy. The milled rice was ground into flour, and the total starch content was measured using a conventional chemical method. The amylopectin content was equal to the total starch content minus the amylose content. The total storage substance content was approximately equal to the total starch content plus the total protein content. The ratio between different storage substances could better understand the balance and imbalance of storage substance content at different temperatures. The taste value of cooked rice was measured using a STA1B device (Satake, Japan). Briefly, 30 g of whole milled rice was weighed, washed, and soaked in water for 30 minutes according to the ratio (1:1.4 for indica rice, 1:1.35 for japonica rice), then cooked for 40 minutes, kept warm for 10 minutes, and cooled in a cooler for 20 minutes. 7 g of rice was taken to test its taste value, twice for each side, with a total of 6 replicates. The scoring range was from 0 to 100, representing the comprehensive value of taste quality. Yuzhenxiang (YZX) is a famous high-quality cereal and high cereal taste value variety in China, with very similar excellent qualities to the well-known KDML105 variety consumed globally. We set the cereal taste value of YZX to 90 as a calibration standard, measured the taste value simultaneously with the experimental samples, and finally calibrated and standardized the taste value of each sample. The higher the value, the higher the taste quality.

[0064] For the investigation of different yield traits, after harvesting seeds from individual plants manually and threshing, the number of filled grains, empty grains, and yield were manually counted at the individual plant level, and other traits were further calculated based on these three traits. The number of spikelets = the number of filled grains + the number of empty grains; the seed setting rate = the number of filled grains / the number of spikelets; the 1000-grain weight = the yield per individual plant / the number of filled grains × 1000. Wuhan, Hangzhou, and Changsha are the three major cities in the rice production area of the Yangtze River Basin in China, where extreme high temperatures often occur, especially in the summer of 2024. The data of plot yield and other yield and quality traits of all genetic materials in each city were based on large-scale field trials, using a randomized block design, with 3 - 4 replicates for each family in each plot, and the area of each plot was approximately 5 square meters, with about 12×15 = 180 individual plants.

[0065] Example 3: Discovery of genes related to chalkiness heat tolerance in rice appearance quality traits QT12 Discovery

[0066] The RapMap method was used for QT12 rapid mapping and cloning, and the process was as Figure 1 shown below:

[0067] 1) QT12 Initial gene mapping:

[0068] Using natural temperature treatments over multiple years and in multiple locations, a heat-tolerant parent for high-temperature quality, Chenghui 448 (CH), and a high-temperature sensitive parent, OM1723 (OM), were identified. Since the grain widths of the two parents were the same, the influence of grain width on chalkiness quality was excluded ( Figure 2 a, b). Rice Chenghui 448 was crossed with OM1723 to obtain F1, which was self-crossed to produce an F2 genetic segregation population. The phenotypes of rice chalkiness in this population were investigated under the high-temperature environment of natural fields. According to the BSA method, extreme high and low pools were constructed. For each individual plant in the extreme pools, 10 plump seeds were selected, and the high and low pools were mixed and germinated separately. After two weeks, an equal amount of leaves from each plant was ground with liquid nitrogen and sent to China National Seed Group (Wuhan) for RICE6K SNP chip detection ( Figure 2 c);

[0069] The "Variation ID" of InDel polymorphic variations was searched using the RiceVarMap database (http: / / ricevarmap.ncpgr.cn / ), and then InDel markers were designed through the "Design Primer by Variation ID" function. Priority was given to selecting InDel differences with 3 - 8 bp deletions and PCR fragments of approximately 100 - 200 bp in design. The template DNAs of Chenghui 448 and OM1723 were amplified with all the designed primers / markers, and detected by 4% PAGE gel electrophoresis. Primers L12W1, L12W2, L12W3, L12W4, and L12W5, which were polymorphic between the two parents, were screened, and the genotypes of each individual plant in this population were identified with these primers.

[0070] Based on the analysis of the genotypes and individual plant phenotypes of markers L12W1 and L12W2 ( Figure 2 d), the homozygous genotypes in this region could separate the two extreme chalkiness phenotypes under high temperature, and the difference in chalkiness rate reached an extremely significant level, indicating that this locus belongs to single-factor Mendelian inheritance and can be used for further fine mapping and map-based cloning.

[0071] 2) QT12 Gene fine mapping:

[0072] To further narrow down QT12 the mapping interval, F2 individual plants that were all heterozygous in the initially mapped region were developed into a large F3 population of 4310 plants, and recombinant individual plants were screened from them.

[0073] First, screen using the Indel markers L12W1 and L12W2 (Table 1). A total of 57 recombinant individuals were screened from 4,310 individuals. The phenotypes of their previous generations were confirmed through progeny tests: families with trait segregation indicated that the phenotype of the previous generation was heterozygous; families with non-segregating and high-value traits in the progeny indicated that the phenotype of the previous generation was homozygous for OM1723; low values indicated that the phenotype of the previous generation was homozygous for Chenghui 448. Then, analyze these 57 recombinant individuals using the 5 developed InDel markers (L12W1, L12W7, L12W8, L12W9, L12W10, and L12W2). Therefore, QT12 It was finally mapped between L12W7 and L12W8, and this interval corresponded to a physical range of approximately 14 kb on the genomic sequence of Nipponbare. This region contained only 1 candidate gene. Through genotyping and expression analysis, a reliable candidate gene was identified, called QT12 gene ( Figure 3 a).

[0074] Table 1 Primers for map-based cloning and gene function verification in the present invention

[0075]

[0076] In the genomes of Chenghui 448 and OM1723 of rice, the full sequences of this gene are shown as SEQ ID NO.1 and SEQ ID NO.2 respectively, including the promoter, 5' UTR, CDS, intron, and 3' UTR. The CDS sequence is shown as SEQ ID NO.4, and the encoded protein is shown as SEQ ID NO.5.

[0077] Example 4: QT12 Analysis of candidate genes

[0078] Sequencing of the target region of Chenghui 448 and OM1723 revealed 9 polymorphic variations between the two varieties within the 3-kb promoter and CDS range, all of which occurred in the promoter upstream of the translation start site. These variations included three mutation types: substitution, insertion, and deletion ( QT12 b). qRT-PCR in the 5-DAF endosperm under natural field temperature conditions showed that there was no significant difference in gene expression between the two NILs Figure 3 b). However, under natural high-temperature conditions, the expression of QT12 in NIL OM increased significantly, while the expression level of QT12 in NIL CH remained basically unchanged ( QT12 c), indicating that high temperature could induce the expression of Figure 3 in NIL OM in QT12expression, i.e., in the sensitive parent OM1723 QT12 The haplotype is the dominant genotype.

[0079] For QT12 Analysis of the two haplotypes found that among 533 micro-core germplasms, Hap CH Compared with Hap OM had a lower quality heat injury index (the quality heat injury index is the difference in chalkiness between 533 germplasm materials at high temperature and normal temperature, that is, the degree of increase in chalkiness of grains at high temperature. The lower the quality heat injury index, the better the heat tolerance), indicating that the Hap CH haplotype variety had higher quality heat tolerance ( Figure 3 d). Analysis of the 5-DAF endosperm expression data of 119 core germplasms found that Hap CH had a lower QT12 expression level ( Figure 3 d), which was consistent with the low-expression pattern in NIL CH . These results suggest that the resistant haplotype may have lower expression QT12 at high temperature, resulting in higher quality heat tolerance.

[0080] Example 5: Natural variation analysis in both parents QT12 Natural variation analysis

[0081] RNA-Seq analysis was performed on the endosperms sampled from resistant (R) and sensitive (S) varieties identified through years of natural high-temperature field identification in Wuhan at different field temperatures. It was found that the expression level of QT12 in the resistant varieties at high temperature was significantly lower than that in the sensitive varieties, while there was no significant difference at normal temperature ( Figure 4 a). Further analysis found that a G / A SNP variation in the promoter of Chenghui 448 QT12 was almost only distributed in indica rice ( Figure 4 b). Within indica rice varieties, varieties containing QT12 A had a lower quality heat injury index and a lower QT12 expression level ( Figure 4 c), indicating that QT12 A in indica rice had higher heat tolerance, explaining the genetic basis of heat tolerance differences within indica rice. The above results indicate that QT12 the G / A variation existing only in indica rice in the promoter may lead to a lower expression level of QT12 at high temperature, thereby enhancing the heat tolerance and explaining the reason for heat tolerance differences within indica rice.

[0082] Example 6: Haplotype analysis in 533 core germplasm resources QT12 Haplotype analysis

[0083] UsingQT12 Seven representative mutations on QT12 were divided into seven haplotypes, among which Chenghui 448 belongs to Hap7 and OM1723 belongs to Hap3 ( Figure 5 a). Analysis of the distribution of each haplotype in indica and japonica subgroups found that QT12 there was obvious indica-japonica differentiation ( Figure 5 a). In addition, QT12 There is a 6-bp InDel (CGCCGC) in the 5’ UTR region of Figure 5 which can basically distinguish indica rice (-6bp) from japonica rice (+6bp) ( QT12 b, c). In order to further compare the QT12 promoter activities between indica and japonica rice, we used the dual-luciferase reporter gene assay and found that at 25°C and 37°C, the QT12 J promoter activity of japonica rice was significantly higher than that of indica rice. And at high temperature, the QT12 I promoter activity of japonica rice was significantly enhanced, but the Figure 5 promoter activity of indica rice did not change significantly ( QT12 d). In the early stage of this invention, the functional mutation G / A identified in Figure 4 was only present in indica rice ( Figure 5 b), so the functional mutation G / A only present in indica rice and the 6-bp InDel mutation between indica and japonica can be combined to form three main haplotypes Hap1, Hap3 and Hap7 ( QT12 a, b). These three haplotypes can clearly distinguish the QT12 A expression levels in the endosperm of 119 core germplasms, and show a gradient change, that is, the QT12 haplotype in indica rice has the lowest QT12 G expression level, the QT12 G expression level in indica rice is at the middle level, while the Figure 5 e) explains the genetic basis of heat tolerance differences within indica rice and the fact that indica rice is more heat tolerant than japonica rice.

[0084] Example 7: Application of rice QT12 gene in regulating heat tolerance of rice quality (chalky appearance quality, storage substance content, eating quality, etc.)

[0085] 1) OM1723 sensitive genotype QT12 G Complementation to the resistant parent Chenghui 448 reduces grain quality

[0086] Design PCR specific primer QT12-flag with restriction endonuclease KpnI and EcoRI adapters (Table 1) to amplify OM1723 QT12 gene. The amplified sequence contains the sequence shown in SEQ ID NO.2, that is, add TATGACATGATTACGAATTC at the 5' end of SEQ ID NO.2 and add GGTACCCGGGGATCCTCTAG at its 3' end. Connect it to pCAMBIA 1301 by Gibson ligation method (Gibson et al., 2009, Nat. Methods 6:343–345) to obtain the recombinant vector pCAMBIA 1301-QT12 OM1723 .

[0087] Using the transgenic method, the plasmid of the correct clone obtained was introduced into Chenghui 448 through the Agrobacterium-mediated indica rice genetic transformation system. After induction, subculture, infection, co-culture, screening for hygromycin-resistant calli, differentiation, rooting, hardening off and transplanting, transgenic rice plantlets were obtained. Detect transgenic complementary positive single plants with QT12-F / 1301-flag-R (Table 1), and use agarose gel electrophoresis for detection. The presence of a band indicates a positive single plant

[0088] Investigate the heat tolerance of the rice grain quality of the transgenic positive families compared with the wild-type family Chenghui 448. Under the natural normal temperature in the field in Wuhan, the transgenic complementary positive families QT12 -Com and the wild-type Chenghui 448 both showed a relatively low chalkiness rate. However, under natural high temperature conditions QT12- the chalkiness rate of the Com family was significantly increased compared with Chenghui 448 ( Figure 6 a, b), showing poor grain quality. At the same time, compared with the normal temperature condition, under high temperature QT12 -Com had a significantly reduced storage protein content and an increased amylose content, resulting in a significant decrease in the ratio of storage protein to amylose or starch content, leading to an imbalance in storage substances, thus leading to the formation of grain chalkiness ( Figure 6 c, d). In contrast, Chenghui 448 maintained a relatively balanced state of storage substance content and showed a low chalkiness phenotype ( Figure 6 ). These results indicate that the QT12 allele from the sensitive parent can significantly reduce the heat tolerance of rice grain quality by disrupting the balance of storage substance content in the endosperm tissue

[0089] 2) After CRISPR knockout of the sensitive parent OM1723 ( QT12 G ), the grain quality was synergistically improved (the knockout target is the sequence shown in SEQ IDNO.6)

[0090] Using the U3 plasmid as a template, amplify with the forward primer of QT12-U3 and the reverse primer of U3; using the U3 plasmid as a template, amplify with the reverse primer of QT12-U3 and the forward primer of U3; after separately recovering the above two amplification products, mix them in equal amounts. Using the mixture as a template, amplify with the U3 primer. After recovering the product, introduce it into pCXUN-CAS9 the plasmid (first digested with KpnI) (refer to CN201610639854.3) to obtain pCXUN-CAS9 -QT12-U3 knockout vector.

[0091] By using the transgenic method, introduce the correctly cloned pCXUN-CAS9- QT12-U3 knockout vector into OM1723 through the Agrobacterium-mediated indica rice genetic transformation system. After induction, subculture, infection, co-culture, screening for hygromycin-resistant calli, differentiation, rooting, and acclimatization and transplanting, obtain transgenic rice plantlets. Through QT12 -CR (Table 1) detect the obtained transgenic single plants, and use QT12-U3-SEQ (Table 1) to sequence and confirm the positive single plants with successful knockout.

[0092] Investigate the rice grain quality of CRISPR transgenic positive plants compared with the wild-type OM1723 rice under field high temperature. Under the natural normal temperature in the fields of Wuhan, the transgenic knockout lines QT12 -CR and the sensitive wild-type OM1723 both showed a relatively low chalkiness rate, while under the natural high temperature condition QT12 -CR lines still maintained a relatively low chalkiness, showing better grain quality ( Figure 7 a, b). Compared with normal temperature, QT12 -CR lines had almost no change in total protein and amylose / starch content under high temperature, better maintaining the balance of storage substances in the endosperm tissue, and thus maintaining a relatively low grain chalkiness degree and better quality ( Figure 7 c, d), which indicates that QT12 mutation or low expression can endow rice with high temperature tolerance by better balancing the content of storage substances, thereby obtaining better rice grain quality under high temperature.

[0093] 3) QT12 Verification of indica-japonica heat tolerance differentiation: Complementary of the japonica rice genotype QT12 J into the indica rice variety Sanhuangzhan-2 (SHZ; QT12 I ) reduces the grain quality:

[0094] Design PCR specific primer QT12-flag (Table 1) with restriction endonuclease KpnI and EcoRI adapters to amplifyQT12 Genes, the amplified sequence contains the sequence shown in SEQ ID NO.3, that is, TATGACATGATTACGAATTC is added to the 5' end of SEQ ID NO.3, and GGTACCCGGGGATCCTCTAG is added to its 3' end. It is ligated to pCAMBIA 1301 using the Gibson assembly method (Gibson et al., 2009, Nat. Methods 6:343–345) to obtain the recombinant vector pCAMBIA 1301-QT12 ZH11 。

[0095] Using the transgenic method, the plasmid of the correct clone obtained was introduced into indica rice SHZ through an Agrobacterium-mediated indica rice genetic transformation system. After induction, subculture, infection, co-culture, screening for hygromycin-resistant calli, differentiation, rooting, and acclimatization and transplantation, transgenic rice plantlets were obtained. QT12-F / 1301-flag-R (Table 1) was used to detect transgenic complementation positive single plants, and agarose gel electrophoresis was used for detection. The presence of a band indicates a positive single plant

[0096] Examine the heat tolerance of the rice grain quality of transgenic positive families compared with the wild-type family SHZ. Since QT12 there is obvious indica-japonica differentiation, in order to study QT12 the effect of indica-japonica differentiation on the differentiation of indica-japonica heat tolerance differences, the constructed japonica rice QT12 J genotype complementary genetic material into indica rice SHZ QT12 J -Com was planted in different field temperature environments. At normal temperature, both the complementary positive family and the wild-type SHZ showed a low chalkiness phenotype ( Figure 10 a), while in the field high-temperature environment, the storage protein content of the complementary positive family decreased significantly, and the amylose content increased significantly, resulting in a significant decrease in the ratio of protein to amylose, the balance of storage substances was broken, resulting in an increase in chalkiness and a deterioration in quality ( Figure 8 ). While the wild-type SHZ was able to maintain a certain balance in the ratio of storage protein to amylose, and thus showed better quality ( Figure 8 ). These results indicate that the QT12 J genotype of japonica rice can reduce the heat tolerance of the quality of indica rice, while QT12 indica-japonica differentiation may explain the genetic basis for indica rice being more heat-tolerant than japonica rice

[0097] 4) Construct near-isogenic lines (NILs) with the background of Chenghui 448 to verify QT12 the effects of two allelic genotypes on quality heat tolerance

[0098] Using Chenghui 448 as the donor parent and OM1723 as the recurrent parent, backcrossing was carried out more than 4 times continuously (each backcross was supplemented with MAS, and the single plants with heterozygous L12W7 and L12W8 markers and the same plant type as Chenghui 448 were selected as male parents), and then self-crossing and segregation were carried out, and the pure NIL was screened out from them. CH and NIL OM .

[0099] NIL OM and NIL CH showed similar plant types, but NIL CH showed lower rice chalkiness, lower amylose and higher protein content at high temperature ( Figure 9 ). Compared with normal temperature, NIL CH maintained relatively lower rice chalkiness by maintaining the balance of protein and amylose / starch ratio at high temperature. However, NIL OM showed a lower ratio of protein to amylose / starch content, and the balance was disrupted, resulting in the formation of chalkiness.

[0100] 5) Verification by cytological electron microscopy of near-isogenic lines (NILs) QT12 Effect of two allelic genotypes on the development of endosperm storage substances at high temperature

[0101] To evaluate the effect of QT12 on grain storage substances at high temperature, we observed the starch structure of storage substances in the mature endosperm of two NILs by scanning electron microscopy (SEM). The chalky endosperm of NIL OM at high temperature was filled with loosely packed spherical storage starch granules with large voids, while the non-chalky grains of NIL CH under the same high temperature conditions were composed of densely and regularly packed polyhedral crystal storage granule structures. And at normal temperature, NIL CH and NIL OM had non-chalky endosperm structures consistent with those of NIL CH at high temperature, showing a dense crystal structure ( Figure 10 a). To further analyze the subcellular reasons for the change in the structure of grain endosperm storage substances at high temperature QT12 , we used transmission electron microscopy (TEM) to compare the ultrastructures of endosperm cells at 10-DAF in NIL CH and NIL OM under different temperature conditions. Compared with normal temperature, the number and area of starch granules in the two NILs at high temperature did not change significantly, while the number and area of protein bodies I and II in the two NILs both decreased, but the degree of reduction of the two protein bodies in the heat-tolerant line NIL CH was much lower than that in the sensitive line NIL OM, resulting in resistant NIL CH The ratio of the area and number of protein bodies to starch granules in CH was maintained at a higher level, better maintaining the homeostatic balance of these two storage substances ( Figure 10 b–f). These subcellular evidences further supported the above conclusion on the relationship between storage substance content and chalkiness quality: the balance and imbalance between storage protein and starch contents at high temperature led to heat-resistant and heat-sensitive phenotypes, respectively.

[0102] 6) Construction of Huazhan introgression lines to verify QT12 The breeding potential of resistant genotypes in improving the heat tolerance of main cultivated high-quality varieties

[0103] To evaluate QT12 the breeding potential of the gene in improving rice quality, we selected the most common restorer line widely used in high-yielding hybrid rice breeding in China at present - the elite variety Huazhan ( QT12 The allele is a genotype sensitive to high temperature for rice quality QT12 G ) as the improvement object. Using Chenghui 448 as the donor parent and Huazhan as the recurrent parent, backcrossed continuously for more than 4 times (each backcross was supplemented with MAS, and plants with the same plant type as Huazhan were selected as male parents), and then self-crossed and segregated, from which Huazhan A and Huazhan G ( Figure 11 ) were screened out. Under natural high-temperature conditions, Huazhan A ( QT12 A ) had lower chalkiness and amylose content and higher protein content than Huazhan G ( QT12 G ), showing better rice appearance and eating quality ( Figure 11 ). There were no significant differences in various quality traits between the Huazhan A / G heterozygous family lines and Huazhan G homozygous family lines ( Figure 11 ), indicating that QT12 G is a dominant allele. In summary, these results indicate that QT12 has great potential to improve the quality of high-quality rice varieties at high temperature.

[0104] Example 8: Large-scale field trials in multiple years and locations to verify the application of the rice QT12 gene in coordinately improving rice quality (chalkiness appearance quality, storage substance content, eating quality, etc.) and yield heat tolerance

[0105] Among 533 core germplasm and indica rice subgroup germplasm,QT12 A The seed setting rate of the haplotype was significantly higher than that of QT12 G ( Figure 13 a). Therefore, the yield traits and eating quality of QT12 genetic materials were investigated at different temperatures. Among them, the rice eating quality value represents the evaluation of the taste and texture of cooked rice. The rice eating quality value of the famous high-quality rice variety Yuzhenxiang (YZX) in China was set at 90, and it was used as a calibration standard. The eating quality value of each experimental sample was obtained through conversion and standardization.

[0106] There were no significant differences in chalkiness rate, seed setting rate, and yield per plant between the two NILs under normal temperature in Wuhan in the summer of 2023. However, under high temperature, the CH seed setting rate and yield per plant of NIL OM were significantly higher (+18.1%) than those of NIL OM , but the grain chalkiness rate was significantly lower than that of NIL CH . In addition, under the two temperature conditions, the rice eating quality value of NIL OM was always higher than that of NIL OM , and the eating quality value of NIL Figure 12 decreased significantly under high temperature ( QT12 a, 13b). QT12 The seed setting rate, yield per plant, and rice eating quality value of the complementary family Figure 12 -Com were significantly lower than those of the wild type Chenghui 448 (high resistance), the chalkiness rate was significantly higher, and the yield per plant decreased by 40.7% ( QT12 b, 13c). In the CRISPR family Figure 12 -CR, the seed setting rate, grain number, and 1000-grain weight increased significantly, resulting in a 1.7-fold increase in the grain yield per plant. At the same time, the rice chalkiness rate decreased significantly, and the eating quality value of cooked rice also increased significantly ( QT12 J c, 13d). At the same time, the positive families of the complementary material Figure 12 -Com of the japonica rice genotype complemented to the indica rice SHZ had a significant decrease in seed setting rate and yield under high temperature, and the rice eating quality value further decreased ( QT12 d, 13e). However, under normal temperature, there were no significant changes in the yield traits of various Figure 14 transgenic families (

[0107] To further evaluate the QT12 effects on rice quality and yield, in the summer of 2024, we QT12A large-scale field experiment was conducted on various genetic materials in three major cities (Wuhan, Hangzhou, and Changsha) of three provinces in the Yangtze River Basin of China (3 or 4 plots were planted for each genetic material family, and the area of each plot was approximately 5 square meters, 12×15 = 180 plants). The Yangtze River Basin is the main rice-producing area in China, and extreme high temperatures have continuously broken records in the past 20 years, especially in the summer of 2024 ( Figure 15 a). By examining various yield traits, we found that under field high-temperature conditions, compared with NIL OM , the seed setting rates of NIL CH increased by 50.6%, 55.8%, and 14.6% respectively, and the yield per plant increased by 62.4%, 74.2%, and 34.9% respectively ( Figure 15 b-d). At the same time, large-scale field experiments showed that compared with NIL OM under high temperature, the plot yields of NIL CH (4×5 m 2 or 3×5 m 2 ) increased by 67.4%, 68.1%, and 40.6% respectively ( Figure 15 c). Further examination of the rice quality phenotypes found that the chalky rice rate and chalkiness degree of NIL CH were significantly lower than those of NIL OM ( Figure 15 d, e). In addition, we further evaluated the breeding potential of the QT12 gene in improving the yield heat tolerance of the Chinese elite variety Huazhan (Huazhan G ). We introgressed QT12 A from Chenghui 448 into Huazhan by backcrossing, generating an introgression line Huazhan A . Large-scale field experiments in Wuhan, Hangzhou, and Changsha showed that compared with Huazhan G , Huazhan A could significantly increase the grain seed setting rate by 13.6%, 32.5%, and 10.9% respectively, the yield per plant by 46.9%, 80.8%, and 28.0% respectively, and at the same time the plot yield increased by 49.1%, 77.9%, and 31.2% respectively ( Figure 15 f, g). At the same time, we found that the grain chalky rice rate and chalkiness degree of Huazhan A were also much lower than those of Huazhan G ( Figure 15 g, h). These large-scale field experiments at multiple locations further demonstrated the impact of QT12 A on grain yield and quality under high temperature.

[0108] In addition, in the summer of 2024, we also conducted large-scale field trials on two main genetically modified materials of QT12 under the same high-temperature treatment in three major cities and carried out phenotypic investigations. Compared with the wild-type Chenghui 448 (high resistance), QT12 the seed setting rates of the complementary families decreased significantly by 30.23%, 31.5% and 23.0% respectively under high temperature, and the yield per plant decreased by 52.6%, 50.0% and 44.1% respectively ( Figure 16 a–c). At the same time, compared with Chenghui 448 (high resistance), QT12 the plot yields of the complementary families decreased significantly by 49.7%, 52.1% and 40.3% respectively under high temperature ( Figure 15 b). Further investigation of the grain quality showed that the chalky rice rate and chalkiness degree in the complementary families increased significantly ( Figure 16 c, d). In contrast, the seed setting rates of the CRISPR knockout families were significantly increased by 37.6%, 43.5% and 24.6% compared with the sensitive family OM1723, resulting in a significant increase in the yield per plant by 88.2%, 67.9% and 60.5% respectively ( Figure 16 e, f). At the same time, in the three major cities of Wuhan, Hangzhou and Changsha, the plot yields of the CRISPR families increased by 92.5%, 64.1% and 54.7% respectively ( Figure 16 e), showing strong high-temperature tolerance. Further investigation of the rice quality found that the CRISPR families showed lower chalky rice rates and chalkiness degrees, showing better rice quality ( Figure 16 f, g). It should be noted that other agronomic traits (grain width, plant height, growth period, etc.) of all QT12 related genetic materials did not change significantly ( Figure 17 , 18). These results indicate that low expression or non-functional QT12 can simultaneously improve the heat tolerance of rice quality and yield in the natural field high-temperature environment, which is of great significance for synergistically improving rice quality and yield under high temperature and is conducive to breaking the breeding bottleneck of the contradiction between crop stress and growth, and between yield and quality.

[0109] Example 9: Effects of high temperature on QT12 mRNA and encoded protein expression levels

[0110] In Figure 3 c, high temperature can significantly up-regulate the mRNA expression level of NIL OM in QT12 . In order to further verify the effects of high temperature on the expression levels of QT12 mRNA and protein, we used the QT12-Com transgenic families to perform qPCR and immunoblotting experiments on the QT12-Flag fusion protein and found that high temperature can significantly induceQT12 - QT12 in -Com G mRNA and protein expression levels, while the heat - tolerant wild - type QT12 A showed no significant change in mRNA level ( Figure 19 ). These results further demonstrated that high temperature negatively regulates the heat tolerance of rice grains by inducing QT12 G the protein level of QT12 in the sensitive haplotype.

[0111] The above results indicate that QT12 the gene is a negative regulator controlling the heat tolerance of rice quality and yield, demonstrating that this gene can be used to improve rice varieties through means such as genetic transformation and molecular - marker - assisted breeding, including but not limited to using QT12 to improve the heat tolerance of rice quality and yield.

[0112] The above - mentioned specific embodiments have described the implementation of the present invention in detail. However, the present invention is not limited to the specific details in the above - mentioned embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple variations all fall within the protection scope of the present invention.

Claims

1. The application is any one of the following: A) The application of rice QT12 protein, the nucleic acid molecule encoding said protein, or an expression cassette, recombinant vector, transgenic cell line or recombinant bacterium containing said nucleic acid molecule, in regulating the heat tolerance of rice quality and yield or in preparing a product for regulating the heat tolerance of rice quality and yield; B) The application of a reagent for reducing the functional activity of QT12 protein in cultivating heat-tolerant rice germplasm with quality and yield or in preparing a product for cultivating heat-tolerant rice germplasm with quality and yield; The amino acid sequence of said QT12 protein is as shown in SEQ ID NO.5; Said rice quality includes rice chalky appearance quality, storage substance content, and eating quality.

2. The application according to claim 1, characterized in that Said chalky appearance quality includes chalky rice rate and chalkiness degree; said storage substances include storage protein and amylose; the nucleotide sequence encoding said QT12 protein is as shown in SEQ ID NO.

4.

3. A method for enhancing rice quality and yield at high temperatures and / or cultivating heat-tolerant rice germplasm with quality and yield, characterized in that, Knocking out, inhibiting or reducing the expression, function or activity of QT12 gene or its encoded protein in rice to improve the heat tolerance of rice quality and yield, that is, the obtained rice can better maintain the steady-state balance of storage protein and amylose content in rice at high temperature, with low chalkiness and higher rice eating quality value, and at the same time, the seed setting rate, the number of filled grains increase and the yield increases. The protein sequence encoded by said QT12 gene is as shown in SEQ ID NO.

5.

4. The method according to claim 3, wherein The substance for inhibiting the expression level or function of QT12 protein in rice is a CRISPR / Cas9 vector, and the target sequence targeted by said CRISPR / Cas9 vector is the polynucleotide site shown in SEQ ID NO.

6.

5. A SNP molecular marker related to heat tolerance that can distinguish the quality and yield of indica rice and indica-japonica rice, characterized in that, Said SNP molecular marker is as shown in SEQ ID NO.3, and there is an A / G variation at the 2372nd position. Among them, when the SNP site is A, the rice is identified as indica rice, and it shows a lower QT12 expression level and a lower quality heat damage index at high temperature, that is, a higher quality heat tolerance.

6. An indel molecular marker related to heat tolerance that can distinguish the quality and yield of indica and japonica rice, characterized in that, Said indel molecular marker is as shown in SEQ ID NO.3, and there is a 6bp deletion of CGCCGC or not at the 2828 - 2833rd positions. When the result is -6bp, it is identified as indica rice.

7. A molecular marker combination related to the expression level of QT12 and the heat tolerance of rice quality and yield, characterized in that, Said molecular marker combination includes the SNP molecular marker as claimed in claim 5 and the indel molecular marker as claimed in claim 6. Further, according to the SNP and indel results, rice germplasm is divided into three haplotypes: Hap1: G / + 6bp, Hap3: G / -6bp, Hap7: A / -6bp. Among them, haplotype Hap7 has the lowest QT12 expression level, Hap3 is in the middle, and the expression level of QT12 in Hap1 is the highest. The lower the QT12 expression level, the higher the quality and yield heat tolerance.

8. Use of the molecular marker or its combination according to any one of claims 5-7 in identifying or assisting in identifying indica and japonica rice and / or cultivating heat-tolerant rice germplasms with good quality and high yield, characterized in that, Identify the rice with SNP result of A and / or indel result of -6bp as indica rice, identify the rice with indel result of +6bp as japonica rice, and select the rice with A, -6bp, A / -6bp according to the SNP and / or indel results for co-cultivating heat-tolerant rice germplasm with quality and yield.

9. A method for identifying and assisting in the identification of indica and japonica rice, characterized in that, Detect rice using any one of the molecular markers or their combinations described in claims 5-7, and identify rice with an SNP result of A and / or an indel result of -6bp as indica rice, and identify rice with an indel result of +6bp as japonica rice.

10. A method for cultivating heat-tolerant rice germplasm with high quality and yield, characterized in that, Detect rice using any one of the molecular markers or their combinations described in claims 5-7, and select rice with SNP and / or indel results of A, -6bp, or A / -6bp for co-cultivation of heat-tolerant rice germplasms with good quality and high yield.

Citation Information

Patent Citations

  • Rice efficient conversion vector pCXUN-Cas9-sgRNA and construction method thereof

    CN107686845A