Application of OsMADS15 protein and coding gene thereof in regulating and controlling resistance of plant to waterstraw dwarf virus

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of OsMADS15 protein and a coding gene thereof in regulating resistance of plants to waterstraw dwarf virus. The amino acid sequence of the OsMADS15 is as shown in SEQ ID NO. 2, and the nucleotide sequence of the coding gene of the OsMADS15 is as shown in SEQ ID NO. 1. It is found for the first time that inhibition of expression of the coding gene of the OsMADS15 protein in rice can reduce the resistance of rice to the rice straw-like dwarf virus. Therefore, the OsMADS15 protein and the coding gene thereof have important significance for researching the waterstraw dwarf disease and providing sensitive strains.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of OsMADS15 and a coding gene thereof in regulating plant resistance to rice grassy stunt virus. Background Art

[0002] The biological functions of at least 33 genes in the rice MADS-box gene family are known, mainly regulating the development of rice floral organs, panicle differentiation, flowering habit regulation, seed development, plant height and root system, and participating in stress response. For example, OsMADS5 and OsMADS34 can directly bind to the promoter region of RCN4 and regulate the development of rice spikelets by synergistically inhibiting the expression of RCN4. OsMADS1, as a SEPALLATA-class MADS-box gene, belongs to the E-class gene of plant floral organ development. It may be involved in the determination and development of lemma and palea, and play a role in the determination of floral meristem, which will lead to the phenomenon of leaf-shaped hull sterility in rice. MADS-box members form a complex regulatory network by interacting with each other or with other factors, mainly involving the synergistic effects of auxin (IAA), reactive oxygen species (ROS), ubiquitination pathway, DNA methylation and other pathways. For example, the variable splicing protein at the C-terminus of OsMADS1 will cause slender grains and affect rice yield. OsMADS1 affects floral meristem specificity by regulating the expression of IAA pathway-related genes (such as OsETTIN1, OsETTIN2, OsARF9, OsARF12, and OsPIN1). OsMADS1 can interact with OsMADS3, OsMADS13, OsMADS15, OsMADS16, OsMADS17 and OsMADS58 to exert its regulatory function. For example, OsMADS1 interacts with OsMADS3 to synergistically regulate meristem determinacy and floral organ development, and interacts with OsMADS13 to regulate meristem determinacy, but is partially independent of OsMADS13. It partially mediates the regulatory pathway of OsMADS16 through interaction with OsMADS16, thereby participating in the formation of lodicules and stamens, and directly regulates the expression of OsMADS17 to regulate floral organ development. It synergistically regulates the determinacy of floral meristem by interacting with OsMADS58 and OsMADS15, respectively. Among them, OsMADS15 mainly inhibits the formation of initial floral primordia in meristems. Its simultaneous mutation with OsMADS1 causes the reproductive habit of rice to change from sexual reproduction to pseudoviviparity. However, the mechanism of action of the MADS-box gene family in rice virus infection is still unknown. Efficient use of these gene resources to improve rice yield and disease resistance is a key focus in the future.

[0003] Rice is one of the most important food crops in my country and the world. It has long been attacked by a variety of pathogens, resulting in a reduction in its yield. Rice viruses are known as "rice cancer". Among them, Rice Grassy Stunt Virus (RGSV) is a member of the genus Tenuivirus in the family Bunyaviridae. RGSV is transmitted by the insect vector brown planthopper in a persistent proliferation manner, without being transmitted through eggs, seeds, pollen, soil, and mechanical damage. Once the brown planthopper acquires the virus, the virus will rapidly reproduce in the body of the brown planthopper and further spread to the host plant rice. The symptoms of rice infected with RGSV are mainly obvious dwarfing of the plant like a weed, a significant increase in tillers, chlorotic and yellowing of the leaves, narrow leaf shape, and the formation of brown rust spots (similar to lesions) on the leaves. Severe diseases can lead to failure to produce fruit or death. There is no effective prevention and control strategy for this disease. At present, there is no report on the function of OsMADS15 protein and its encoding gene expression in rice antiviral resistance. Summary of the invention

[0004] The object of the present invention is to provide application of OsMADS15 protein and its encoding gene in regulating plant resistance to rice grassy stunt virus.

[0005] To achieve the above object, the present invention adopts the following technical solution: Application of MADS15 protein and its encoding gene in regulating plant resistance to rice grassy stunt virus, wherein the MADS15 protein is any of the following proteins: 1) A protein having an amino acid sequence of SEQ ID NO.2; 2) A protein having the same function as the amino acid sequence shown in SEQ ID NO.2 after one or more amino acid residues are replaced and / or deleted and / or added; 3) A protein having 95% or more, 98% or more, or 99% or more identity with the amino acid sequence shown in SEQ ID NO. 2 and having the same function.

[0006] The coding gene of the above-mentioned OsMADS15 protein is any one of the following genes: 1) A gene whose nucleotide sequence is shown in SEQ ID NO.1; 2) a gene encoding the above-mentioned OsMADS15 that has 95% or more, 98% or more, or 99% or more identity with the nucleotide sequence shown in SEQ ID NO.1; Furthermore, by inhibiting the expression of the gene encoding the OsMADS15 protein in the plant, the resistance of the plant to rice grassy stunt virus is reduced; Furthermore, the gene encoding the OsMADS15 protein is knocked out in the plant by CRISPR / Cas9 to inhibit the expression of the encoding gene; Furthermore, the target sequence of the CRISPR / Cas9 is shown in SEQ ID NO.3; Further, the plant is a monocotyledonous plant; Furthermore, the monocotyledonous plant is rice.

[0007] The present invention also provides a method for cultivating transgenic rice with reduced resistance to rice grassy stunt virus, which comprises the step of inhibiting the expression of the OsMADS15 protein encoding gene in a recipient rice to obtain transgenic rice, wherein the resistance of the transgenic rice to rice grassy stunt virus is lower than that of the recipient rice; the amino acid sequence of the OsMADS15 protein is shown in SEQ ID NO.2, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.1.

[0008] Furthermore, the expression of the gene encoding OsMADS15 in the recipient rice is inhibited by knocking out the gene encoding the OsMADS15 protein in the recipient rice through CRISPR / Cas9, and the target sequence of CRISPR / Cas9 is shown in SEQ ID NO.3.

[0009] The present invention also provides the use of the MADS15 protein and its encoding gene in breeding rice varieties with reduced resistance to rice grassy stunt virus. The amino acid sequence of the MADS15 protein is shown in SEQ ID NO.2, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.1.

[0010] The significant advantages of the present invention are: The biological functions of at least 33 genes in the rice MADS-box gene family are known, and they mainly regulate the development of rice floral organs, panicle differentiation, flowering habit regulation, seed development, plant height, root system and other organs, as well as participate in adversity response and other processes. At present, the role of OsMADS15 in rice grassy stunt virus resistance is unknown. The present invention provides the use of OsMADS15 protein and its encoding gene in regulating plant resistance to rice grassy stunt virus. The present invention first discovered that inhibiting the expression of the encoding gene of OsMADS15 protein in rice can reduce the resistance of rice to rice grassy stunt virus. Therefore, OsMADS15 protein and its encoding gene are of great significance for studying rice grassy stunt disease and providing sensitive strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 :change OsMADS15 CRISPR / Cas9 rice ( mads15# 1. mads15# 2) Identification.

[0012] Figure 2 :change OsMADS15 CRISPR / Cas9 rice ( mads15# 1. mads15# qRT-PCR detection of RGSV virus-related genes in 2) and wild-type rice (Zhonghua 11) after RGSV infection.

[0013] Figure 3 :change OsMADS15 CRISPR / Cas9 rice ( mads15# 1. mads15# 2) and wild-type rice (Zhonghua 11) after RGSV infection.

[0014] Figure 4 : Symptoms of different rice lines infected with RGSV. DETAILED DESCRIPTION

[0015] In order to make the contents of the present invention easier to understand, the technical solution of the present invention is further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.

[0016] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0017] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0018] Example 1: Rice OsMADS15 protein and its encoding gene OsMADS15 Acquisition 1. Rice OsMADS15 protein and its encoding gene OsMADS15 Acquisition Rice OsMADS15 protein and its encoding gene OsMADS15 The sequence of is publicly available in the Rice Genome Annotation Database (http: / / rice.plantbiology.msu.edu / ) and can be retrieved via LOC_Os07g01820. OsMADS15 The nucleotide sequence starting from the ATG initial codon of the gene CDS sequence is shown as SEQ ID NO.1, and the amino acid sequence of the protein encoded by it is shown as SEQ ID NO.2.

[0019] 2. Rice OsMADS15 Cloning of genes and obtaining recombinant vectors containing the fragments Primers were designed according to the sequence shown in SEQ ID NO.1, and the required restriction sites were added to both ends of the primers to obtain the primer sequence: OsMADS15-5'SfiI:5'-GGCCATTACGGCCATGGGGCGGGGGAA-3', OsMADS15-3'Sfi I: 5'-GGCCGAGGCGGCCTTACTCATTAAGCATTGAGGTGGCTCA-3'.

[0020] According to the instructions, total RNA from Oryza sativa L. japonica cv. Zhonghua 11 (Xu Yu et al., "Cloning of the Glutelin Gt1 Gene from Zhonghua 11 Rice and Construction of the Gt1 Gene Expression Vector Guided by the Waxy Gene Promoter", Journal of Shanghai Normal University (Natural Science Edition), Vol. 39, No. 2, April 2010, p. 204, available to the public from Peking University) was extracted using TRIzol Reagent from Invitrogen, and reverse transcribed using SuperScript II reverse transcriptase from the company to obtain cDNA. The primer used for reverse transcription was a 16-nucleotide Oligod (T) primer.

[0021] The cDNA obtained by reverse transcription was used as a template and the primers OsMADS15-5'Sfi I and OsMADS15-3'Sfi I were used to perform PCR (Polymerase Chain Reaction) reaction to obtain a PCR product of 891 bp having the nucleotide sequence shown in SEQ ID NO.1.

[0022] After the above PCR product is recovered, it is digested with restriction endonuclease Sfi I to recover the target gene PCR product with sticky ends; the vector pPR3-N (Dualsystems Biotech, product catalog number: P01601-P01629) is digested with restriction endonuclease Sfi I to recover the vector digestion product; the above target gene PCR product with sticky ends and the vector digestion product are connected with T4 DNA ligase, and transformed into Escherichia coli strain DH5α to obtain transformants. The plasmid of the transformant is extracted and sent for sequencing to obtain the recombinant vector pPR3-N-OsMADS15. The recombinant vector pPR3-N-OsMADS15 is a rice shown in SEQ ID NO.1. OsMADS15 The gene was inserted into the Sfi I restriction site of the vector pPR3-N.

[0023] Embodiment 2: OsMADS15 Preparation of CRISPR / Cas9 mutant genetic material 1. Construction of expression vector pH-Ubi-cas9-OsMADS15:sgRNA: According to the website ftp: / / ftp.cbi.pku.edu.cn / pub / supplementary_file / . Based on the PAM site with the terminal sequence of NGG, the specific target sequence targeting the N-terminus of the OsMADS15 coding region was selected: GTTCAGCTGAATCCGAGAGTG (SEQ ID NO.3, which can guide Cas9 to cut the target gene OsMADS15 , thus causing the gene to mutate and lose its function). Primers were designed according to the target sequence, and BsaI restriction sites were added to both ends of the primers to obtain primer sequences of OsMADS15-5'BsaI: 5'-GTTCAGCTGAATCCGAGAGTGgttttagagctagaaatagc-3', OsMADS15-3'BsaI: 5'-CACTCTCGGATTCAGCTGAACaacacaagcgGcagcg-3'; the two primers were annealed to obtain primer annealing products, and then the intermediate vector pOs-sgRNA was digested with restriction endonuclease BsaI and the intermediate vector digestion product was recovered, and then the primer annealing product and the intermediate vector digestion product were connected with T4 DNA ligase to obtain a connection product. The connection product was transformed into Escherichia coli strain DH5α, coated with kana resistance medium, and colony PCR screening was performed to obtain positive transformants. The positive transformants and the plasmids of the final vector pH-Ubi-cas9-7 were extracted separately, and the two were recombined in a 1:1 ratio using the LR enzyme in the Gateway system. The Escherichia coli strain DH5α was transformed, and the transformants were obtained by coating the culture medium with spectinomycin resistance. The plasmids of the transformants were extracted and sent for sequencing. The positive transformants were the final recombinant vector, named pH-Ubi-cas9-OsMADS15:sgRNA.

[0024] two, OsMADS15 Obtaining CRISPR / Cas9 transgenic rice 1) Callus induction culture The seeds of Zhonghua 11 rice (hereinafter also referred to as wild-type rice) were shelled, soaked in 70% ethanol for 10 minutes, and then soaked in 0.1% mercuric chloride for 30 minutes; the surface was sterilized. The solution on the surface of the seeds was washed off with a large amount of sterile water, and the moisture on the surface of the seeds was absorbed with sterile filter paper. The seeds were placed on a plate of mature embryo callus induction medium, the edge of the plate was sealed with Parafilm film, and cultured in a 26°C incubator away from light. After about 15 days, the grown callus was carefully removed and transferred to the mature embryo subculture medium, and cultured under the same conditions. Subculture is required every two weeks. When used for transformation, it is necessary to select granular callus that has been subcultured for about 5 days and is light yellow.

[0025] 2) Cultivation of Agrobacterium The recombinant vector pH-Ubi-cas9-OsMADS15:sgRNA was electroporated into Agrobacterium EHA105 to obtain the recombinant bacteria EHA105 / pH-Ubi-cas9-OsMADS15:sgRNA.

[0026] Streak the recombinant bacteria EHA105 / pH-Ubi-cas9-OsMADS15:sgRNA on an LB plate containing antibiotics (50 mg / L Kanamycin, 50 mg / L Rifampicin) and culture at 28°C for 2 days. Pick a single colony and inoculate it into liquid LB medium and culture it at 28°C with shaking until the OD 600 The value was about 0.5, and acetosyringone was added to a final concentration of 100 mM to obtain an Agrobacterium suspension for transforming rice callus.

[0027] 3) Co-culture of rice callus and Agrobacterium Place the subcultured callus in a sterilized conical flask and pour in the Agrobacterium suspension used to transform rice callus to submerge the callus. Leave at room temperature for 20 minutes and gently shake from time to time to allow the callus to fully contact the bacterial solution. Gently remove the callus with sterile tweezers, place it on a sterile filter paper to absorb the excess bacterial solution, and transfer it to a co-culture medium plate covered with a layer of sterile filter paper. Culture in the dark at 28°C for 3 days to obtain co-cultured callus.

[0028] 4) Screening and differentiation of resistant callus The co-cultivated callus tissue was washed with an appropriate amount of sterile water to remove the residual Agrobacterium on the surface, placed on the screening medium, and cultured in the dark at 26°C for screening. After two weeks, it was transferred to a new screening medium and continued to be screened for two weeks. Select the callus tissue that is in good condition after two rounds of screening, transfer it to the differentiation medium plate, culture it in the dark for 3 days, and then transfer it to the light incubator (15hr / day) for light culture. Differentiated seedlings can be seen after one month. When the differentiated seedlings grow to about 2cm, transfer them to the rooting medium in a conical flask and continue to culture for about two weeks. Select seedlings with good growth and developed root systems, wash the culture medium on the roots with tap water, and transplant them into the soil. Collect the seeds to obtain T1 generation OsMADS15 CRISPR / Cas9 rice seeds, and sow them to obtain T1 generation transgenic OsMADS15 CRISPR / Cas9 rice seeds. OsMADS15 CRISPR / Cas9 rice.

[0029] The T1 generation rice seeds were preliminarily screened by hygromycin or G418 (pH-Ubi-cas9-7 vector carries a hygromycin resistance screening gene), and the germinated seeds indicated that the vector was transferred into rice. The germinated seeds were planted in the soil. After growing for 2 weeks, 0.1g of leaves were taken and ground into powder with liquid nitrogen for genomic DNA extraction. The specific method refers to the High-Efficiency Plant Genomic DNA Extraction Kit (Tiangen Biochemical Technology Co., Ltd., Catalog No.: DP350). Afterwards, 0.5g of genomic DNA was used as a template, and the primers OsMADS15-F': 5'-ATGGGGCGGGGGAA-3' and primer OsMADS15-R': 5'-TTAAGCATTGAGGTGGCTCA-3' were used for PCR reaction. The PCR product was directly sent for sequencing, and then the sequence was compared. Figure 1 As shown, DNA sequencing results showed that the two positive strains were named mads15# 1. mads15# 2, among which, mads15# 1. The 11th to 14th bases of the gene coding region are missing. mads15# 2 strains OsMADS15 A "T" was inserted between the 14th and 15th bases in the gene coding region, causing the frameshift and premature termination of the amino acid sequence of the OsMADS15 protein, thereby resulting in the absence of the OsMADS15 protein.

[0030] Embodiment 3: OsMADS15 CRISPR / Cas9 can reduce rice resistance to RGSV.

[0031] 1) Identify the infection of RGSV by identifying the expression of RGSV CP by fluorescence quantitative PCR (qRT-PCR) The T1 generation was inoculated with brown planthoppers carrying RGSV (the pathogen is Rice Grassy Stunt Virus). OsMADS15 CRISPR / Cas9 transgenic rice and wild-type rice Zhonghua 11 were inoculated with 30 plants of each type of rice, and cultured at 30 degrees during the day, 22 degrees at night, and 60% humidity. Each plant was inoculated with 5 brown planthoppers, which were caught after three days of biting. The bitten rice was cultured in a sunny greenhouse (natural light, temperature. The experiment was repeated 3 times and the results were averaged.

[0032] Four weeks after exposure, T1 generation OsMADS15 The rice leaf powder of CRISPR / Cas9 transgenic rice and wild-type rice Zhonghua 11 after infection was added with Trizol reagent (Invitrogen) and RNA was extracted according to the instructions. Then, the genomic DNA in the RNA was digested with RQ1 DNase (Promega, catalog number: M610A) according to Table 1 below: Table 1 Digestion system

[0033] Take 2 μg of digested RNA for reverse transcription qRT-PCR. For specific methods, refer to invitrogen M-MLVReverse Transcriptase (Cat. No.: 28025-021). OsEF1a As an internal control, the primers for internal control were EF1a-F: 5′-GCACGCTCTTCTTGCTTTCACTCT-3′ and EF1a-R: 5′-AAAGGTCACCACCATACCAGGCTT-3′, and to detect the expression of RGSVCP, the primers for RGSV CP were CP-F: 5′-AGAGCAGTTTCCTGTAGTCCC-3′, and CP-R: 5′-CCAGTTCGGCTGTTCAGATTAG-3′.

[0034] The results are as follows Figure 2 As shown, it can be seen that OsMADS15 RGSV in CRISPR / Cas9 Transgenic Rice CP The accumulation of α-glutamic acid in α-glutamic acid was higher than that in wild-type rice Zhonghua 11 (the asterisks in the figure indicate significant differences). OsMADS15 CRISPR / Cas9 can weaken rice resistance to RGSV.

[0035] 2) Determine RGSV infection rate by phenotype Four weeks after infection, 30 T1 transgenic plants were observed. OsMADS15Symptoms of CRISPR / Cas9 rice and 30 wild-type rice Zhonghua 11 (those infected with RGSV showed dwarfing, increased tillering, and yellow and elongated leaves, while those not infected with RGSV showed no dwarfing, increased tillering, and yellow and elongated leaves). Figure 3 As shown, the number of symptomatic plants was counted and the virus rate was calculated = (number of phenotypic plants / total number of plants) × %.

[0036] The results are shown in Table 2. OsMADS15 The susceptibility rate of CRISPR / Cas9 rice is relatively high.

[0037] Table 2 Statistical results of virus infection rate of transgenic rice after virus infection

[0038] In addition, we took photos of different strains of diseased rice, such as Figure 4 Shown is 4 weeks after infection. OsMADS15 Disease symptoms of CRISPR / Cas9 transgenic rice. OsMADS15 CRISPR / Cas9 transgenic rice showed stronger disease symptoms, with a stronger degree of dwarfing and significant yellowing and elongation of leaves ( Figure 4 , WT in the figure represents wild-type Zhonghua 11 rice, mads15 ( # 1 and # 2) Representative OsMADS15 CRISPR / Cas9 transgenic rice). Compared with wild-type rice, OsMADS15 CRISPR / Cas9 transgenic rice is more susceptible.

[0039] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. Application of OsMADS15 protein and its encoding gene in regulating plant resistance to rice grassy stunt virus, characterized in that: The amino acid sequence of the OsMADS15 protein is shown in SEQ ID NO.2, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: Inhibit the expression of the gene encoding the OsMADS15 protein in the plant, thereby reducing the plant's resistance to rice grassy stunt virus.

3. The use according to claim 2, characterized in that: The gene encoding OsMADS15 protein was knocked out in plants through CRISPR / Cas9 to inhibit the expression of the encoding gene.

4. The use according to claim 3, characterized in that: The target sequence of the CRISPR / Cas9 is shown in SEQ ID NO.

3.

5. The use according to claim 1, characterized in that: The plant is a monocotyledonous plant.

6. The use according to claim 5, characterized in that: The monocot plant is rice.

7. A method for cultivating transgenic rice with reduced resistance to rice grassy stunt virus, characterized in that: The method comprises the steps of inhibiting the expression of the gene encoding the OsMADS15 protein in the recipient rice to obtain the transgenic rice, wherein the resistance of the transgenic rice to the rice grassy stunt virus is lower than that of the recipient rice; the amino acid sequence of the OsMADS15 protein is shown in SEQ ID NO.2, and the nucleotide sequence of the gene encoding the OsMADS15 protein is shown in SEQ ID NO.

1.

8. The method according to claim 7, characterized in that: The method of inhibiting the expression of the gene encoding the OsMADS15 protein in the recipient rice is to knock out the gene encoding the OsMADS15 protein in the recipient rice through CRISPR / Cas9.

9. The method according to claim 8, characterized in that: The target sequence of the CRISPR / Cas9 is shown in SEQ ID NO.

3.

10. Use of OsMADS15 protein and its encoding gene in breeding rice varieties with reduced resistance to rice grassy stunt virus, characterized in that: The amino acid sequence of the OsMADS15 protein is shown in SEQ ID NO.2, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.1.

Images