Method for regulating soybean plant height and its application

Abstract

The present invention relates to the field of biotechnology, and specifically provides a method for regulating the plant height of soybeans and its application. The method includes: overexpressing or knocking out any one or more of the following genes in soybeans: GmNRPE6a or GmNRPE6b; wherein, the nucleotide sequence of the above GmNRPE6a gene is SEQ ID NO: 1; the nucleotide sequence of the above GmNRPE6b gene is SEQ ID NO: 2. By knocking out or overexpressing the above genes, the plant height of soybeans can be regulated, enabling the soybean plants to better adapt to the local growth environment, which helps to improve the yield and quality of soybeans.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular, to a method for regulating the plant height of soybeans and its application. Background Art

[0002] Soybean is an important economic crop with economic values such as for food, oil, and feed. However, the current soybean yield far from meets the market demand. Therefore, it is very necessary to rapidly increase the soybean yield by using modern bio-breeding technologies.

[0003] Plant height is one of the important agronomic traits of crops and an important part of evaluating the ideal plant type of crops. Dwarf crops often have advantages such as lodging resistance and high-density planting tolerance, which are of great significance in crop yield-increasing breeding. How to reduce the plant height of soybeans, cultivate the ideal plant type of soybean varieties, increase the planting density of soybeans, and then increase the single yield of soybeans and the total domestic soybean yield is an urgent breeding and production technology problem to be solved.

[0004] The GmNRPE6 protein is an analog of the core subunit EAF6 of the nucleosome histone H4 acetyltransferase complex (NuA4). Many studies have shown that this gene is involved in the regulation of various life processes in organisms, including DNA damage repair and cell cycle regulation, etc., and affects plant etiolation and plant fertility in plants, etc. However, there is currently no report on applying the GmNRPE6 gene in soybeans to regulate plant height. Summary of the Invention

[0005] The main object of the present invention is to provide a method for regulating the plant height of soybeans and its application to solve the problem of the lack of a method for regulating the plant height of soybeans in the prior art.

[0006] To achieve the above object, according to the first aspect of the present invention, a method for regulating the plant height of soybeans is provided. The method includes: overexpressing or knocking out any one or more of the following genes in soybeans: GmNRPE6a or GmNRPE6b; wherein, the nucleotide sequence of the GmNRPE6a gene is SEQ ID NO: 1; the nucleotide sequence of the GmNRPE6b gene is SEQ ID NO: 2.

[0007] Further, the above-mentioned knockout is performed using the CRISPR-Cas9 gene editing system.

[0008] Further, the above CRISPR-Cas9 gene editing system includes sgRNA; the above sgRNA includes: sgRNA1 and sgRNA2 that simultaneously target the GmNRPE6a gene and the GmNRPE6b gene; wherein, the nucleotide sequence of the above sgRNA1 is SEQ ID NO: 9; the nucleotide sequence of the above sgRNA2 is SEQ ID NO: 10.

[0009] Further, the above GmNRPE6a gene is knocked out in the following manner: the C base at the 39th position of the nucleotide sequence of the above GmNRPE6a gene is deleted.

[0010] Further, the above GmNRPE6b gene is knocked out in the following manner: the C base at the 35th position of the nucleotide sequence of the above GmNRPE6b gene is deleted; or 5 bases from the 30th to the 34th positions of the nucleotide sequence of the above GmNRPE6b gene are deleted.

[0011] Further, the above method includes: knocking out the following two genes in soybeans: GmNRPE6a and GmNRPE6b.

[0012] Further, the above GmNRPE6a gene and the above GmNRPE6b gene are knocked out in the following manner: the C base at the 39th position of the nucleotide sequence of the above GmNRPE6a gene is deleted and 5 bases from the 30th to the 34th positions of the nucleotide sequence of the above GmNRPE6b gene are deleted.

[0013] Further, the above overexpression method includes: transferring an overexpression vector into the above soybeans; the overexpression vector contains the above GmNRPE6a gene and / or the above GmNRPE6b gene and a strong promoter.

[0014] Further, the above overexpression vector contains the above GmNRPE6a gene or the above GmNRPE6b gene and the above strong promoter.

[0015] Further, the above strong promoter is selected from any one or more of the following: CaMV 35S promoter, UBQ10 promoter, Nos promoter, Actin2 promoter, RbcS promoter or 35S enhancer.

[0016] To achieve the above object, according to the second aspect of the present invention, there is provided an application of the above method in soybean cultivation.

[0017] Applying the technical solution of the present invention, overexpress or knockout any one or more of the following genes in soybeans: GmNRPE6a or GmNRPE6b; wherein, the nucleotide sequence of the above GmNRPE6a is SEQ ID NO: 1; the nucleotide sequence of the above GmNRPE6b is SEQ ID NO: 2.

[0018] Beneficial technical effects: When the above genes are overexpressed, the plant height of soybeans becomes shorter. When the above genes are knocked out, the plant height of soybeans increases. The increase and decrease of soybean plant height may affect the growth and development and yield of soybean plants. By regulating the plant height of soybeans, the plants can be made more adaptable to the local growth environment, and the yield and quality of soybeans can be improved. Brief Description of the Drawings

[0019] The specification drawings forming a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation to the present invention. In the drawings:

[0020] Figure 1 Shows the map of the recombinant empty vector pXL106 according to an embodiment of the present invention.

[0021] Figure 2 Shows the map of the gene knockout empty vector pFYS007 according to an embodiment of the present invention.

[0022] Figure 3 Shows the protein expression detection of overexpressing GmNRPE6a and GmNRPE6b according to an embodiment of the present invention.

[0023] Figure 4 Shows the RNA expression level detection of overexpressing GmNRPE6a and GmNRPE6b according to an embodiment of the present invention.

[0024] Figure 5 Shows the plant height phenotype map of the overexpressing GmNRPE6a and GmNRPE6b transgenic soybean materials according to an embodiment of the present invention.

[0025] Figure 6 Shows the statistical analysis map of the plant height of the overexpressing GmNRPE6a and GmNRPE6b transgenic soybean materials according to an embodiment of the present invention.

[0026] Figure 7 Shows the sequencing result map of the GmNRPE6a and GmNRPE6b gene knockout soybean materials according to an embodiment of the present invention.

[0027] Figure 8 Shows the plant height phenotype map of the GmNRPE6a and GmNRPE6b gene knockout materials according to an embodiment of the present invention.

[0028] Figure 9 Figure showing the statistical analysis of the plant height of the GmNRPE6a and GmNRPE6b gene knockout materials according to an embodiment of the present invention. Detailed implementation manners

[0029] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other. The present invention will be described in detail below with reference to the embodiments.

[0030] As mentioned in the background art, soybeans are important economic crops, and currently the yield of soybeans cannot meet the market demand. And the plant height of soybeans may affect the yield of soybeans. Therefore, in the present invention, the inventors tried to modify the genes of soybeans so that their plant height is easily regulated, and thus a series of protection schemes of the present invention were proposed.

[0031] In a first typical implementation manner of the present invention, a method for regulating the plant height of soybeans is provided, and the method includes: overexpressing or knocking out any one or more of the following genes in soybeans: GmNRPE6a or GmNRPE6b; wherein, the nucleotide sequence of the above-mentioned GmNRPE6a gene is SEQ ID NO: 1; the nucleotide sequence of the above-mentioned GmNRPE6b gene is SEQ ID NO: 2.

[0032] When overexpressing the above genes in soybeans, the plant height of the soybean plants becomes shorter. And the shorter plant height of soybeans helps to reduce the losses caused by lodging, promotes the effective absorption of nutrients and water by soybeans in the soil layer and increases the effective planting area, thereby further increasing the yield of soybeans. In addition, the shorter plant height of soybeans can improve the resistance, resource utilization efficiency and economic benefits of crops under certain conditions. Therefore, when breeding and cultivating, appropriately selecting short varieties helps to achieve high and stable yields.

[0033] When knocking out the above genes in soybeans, the plant height of the soybean plants becomes taller. The taller plant height helps to reduce the occurrence of pests and diseases. Because the taller plants are farther from the ground, which is beneficial to air circulation and reduces the spread of pests and diseases.

[0034] It should be noted that gene knockout refers to deleting or inactivating a specific gene from the genome of an organism through gene editing technology to study the impact of the gene on the organism. The methods for achieving gene knockout include, but are not limited to: 1) Using homologous recombination to replace the target gene with a non-functional or disrupted version by introducing a modified DNA fragment. When the exogenous DNA undergoes homologous recombination with a gene having the same or similar sequence in the receptor cell genome, the target gene is replaced and inactivated; 2) Using RNA interference to silence or degrade the mRNA of the target gene by utilizing small RNA molecules, preventing its translation into protein, thereby achieving gene knockout; or 3) Using the CRISPR-Cas9 system to introduce targeted DNA breaks at specific positions in the genome by using sgRNA and Cas9 enzyme, resulting in gene disruption. CRISPR-Cas9 generates frameshift mutations or fragment deletions at the break site through the non-homologous end joining repair pathway, silencing the gene and causing loss of function.

[0035] In a preferred embodiment of the present invention, the above knockout is performed using the CRISPR-Cas9 gene editing system. Using the above method to knockout the above gene has the beneficial effect of simple operation.

[0036] In a preferred embodiment of the present invention, the above CRISPR-Cas9 gene editing system includes sgRNA; the above sgRNA includes: sgRNA1 and sgRNA2 that simultaneously target the GmNRPE6a gene and the GmNRPE6b gene; wherein, the nucleotide sequence of the above sgRNA1 is SEQ ID NO: 9; the nucleotide sequence of the above sgRNA2 is SEQ ID NO: 10. Using the above sgRNA for gene editing has the advantage of high editing efficiency.

[0037] It should be noted that the GmNRPE6a gene and the GmNRPE6b gene have high homology (96.41%), and their nucleotide sequences are basically the same, so both sgRNA1 and sgRNA2 can simultaneously target GmNRPE6a and GmNRPE6b.

[0038] In a preferred embodiment of the present invention, the above GmNRPE6a gene is knocked out in the following manner: the C base at the 39th position in the nucleotide sequence of the above GmNRPE6a gene is deleted. In a preferred embodiment of the present invention, the above GmNRPE6b gene is knocked out in the following manner: the C base at the 35th position in the nucleotide sequence of the above GmNRPE6b gene is deleted; or 5 bases from the 30th to the 34th positions in the nucleotide sequence of the above GmNRPE6b gene are deleted. When the GmNRPE6a gene and the GmNRPE6b gene undergo the above mutations, the functions of the genes are inactivated, and the plant height of soybeans becomes higher.

[0039] In a preferred embodiment of the present invention, the above method includes: knocking out the following two genes in soybeans: GmNRPE6a and GmNRPE6b. In a preferred embodiment of the present invention, the above GmNRPE6a gene and the above GmNRPE6b gene are knocked out in the following manner: a C base deletion at the 39th position of the nucleotide sequence of the above GmNRPE6a gene and a 5-base deletion at positions 30 to 34 of the nucleotide sequence of the above GmNRPE6b gene. By knocking out the GmNRPE6a and GmNRPE6b genes in soybeans in the above manner, the plant height of the soybeans becomes higher.

[0040] In a preferred embodiment of the present invention, the above overexpression method includes: introducing an overexpression vector into the above soybeans; the overexpression vector contains the above GmNRPE6a gene and / or the above GmNRPE6b gene and a strong promoter. Using the above overexpression method may help reduce the plant height of soybeans, and thus may help increase the yield of soybeans.

[0041] In a more preferred embodiment of the present invention, the above overexpression vector contains the above GmNRPE6a gene or the above GmNRPE6b gene and the above strong promoter. Using the above overexpression method may help reduce the plant height of soybeans.

[0042] The function of the strong promoter is to enhance the expression of the target gene. In a preferred embodiment of the present invention, the above strong promoter is selected from any one or more of the following: CaMV 35S promoter, UBQ10 promoter, Nos promoter, Actin2 promoter, RbcS promoter or 35S enhancer.

[0043] In the second typical embodiment of the present invention, an application of the above method in soybean cultivation is provided.

[0044] The present invention will be further described in detail below in conjunction with specific embodiments, and these embodiments should not be construed as limiting the scope claimed by the present invention.

[0045] Example 1 Cloning of Soybean GmNRPE6 Gene

[0046] NuA4 (Nucleosome Acetyltransferase of H4) is an evolutionarily conserved histone acetyltransferase complex. It is a 13-subunit complex that can specifically acetylate the N-terminal tails of histone H4 and H2A. NuA4 histone acetyltransferase is involved in processes such as transcriptional regulation and the cell cycle in eukaryotes.

[0047] Arabidopsis thaliana AtEAF6 (Arabidopsis thaliana Esa1-Associated Factor 6) belongs to the core components of the histone acetyltransferase complex TIP60 / NuA4 and regulates chromatin structure and gene expression by mediating the acetylation modification of histone H4 and H2A.

[0048] Searching the Soybase database according to the protein sequence of Arabidopsis thaliana AtEAF6, it was found that there are two homologous genes of EAF6 in soybean, located on chromosome 10 and chromosome 13 respectively, and they were named GmNRPE6a (Glyma.10G036900) and GmNRPE6b (Glyma.13G123300) respectively. The nucleotide sequences of GmNRPE6a and GmNRPE6b are SEQ ID NO: 1 and SEQ ID NO: 2 respectively.

[0049] Primers for cloning GmNRPE6a and GmNRPE6b were designed according to their sequences respectively. Among them, the nucleotide sequences of the primers for PCR amplification of the GmNRPE6 gene are: upstream primer 1 of GmNRPE6a (SEQ ID NO: 3): ATGGAACCGGAAGGGCAAAAGGGTA; upstream primer 2 of GmNRPE6b (SEQ ID NO: 4): ATGGAATCGGAAGGGCAAAAGGGTA; downstream primer 1 of GmNRPE6a and GmNRPE6b (SEQ ID NO: 5): TCACAAGGTCAGGTCAGGATCATCT.

[0050] Using soybean leaf cDNA as a template, PCR amplification was carried out. The amplification conditions were as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 30 s; annealing at 55°C for 30 s; extension at 68°C for 30 s; the number of amplification cycles was 35; finally, extension at 68°C for 10 min; stored at 4°C. The PCR products were electrophoresed on a 1% agarose gel, and then the bands with a size of 474 bp were cut out in a UV gel cutting instrument, and the target bands were recovered using the Promega Mini Agarose Gel DNA Recovery Kit.

[0051] Taking an appropriate amount of the recovered product, the target band and the empty pCE2 vector were ligated using the TA / Blunt-Zero Cloning Kit (model: C601-01, manufacturer: Novoprotein) and transformed into Escherichia coli competent DH5α. After colony PCR identification, the positive colony plasmids pCE2-GmNRPE6a and pCE2-GmNRPE6b were extracted and sent to the company for sequencing.

[0052] Example 2 Construction of Overexpression Vectors and Knockout Vectors for Soybean GmNRPE6 Gene and Transformation of Agrobacterium

[0053] 1) Construction of overexpression vectors for soybean GmNRPE6a and GmNRPE6b: Specific primers for GmNRPE6a and GmNRPE6b (SEQ ID NOs: 6 - 8) were used to amplify the target bands of GmNRPE6a and GmNRPE6b from plasmids pCE2 - GmNRPE6a and pCE2 - GmNRPE6b respectively. Then, using a homologous recombination kit (2×Seamless Cloning Mix, CL117 - 01), GmNRPE6a and GmNRPE6b were respectively ligated to the pXL106 vector (the structure of this empty vector is shown in Figure 1 , and the nucleotide sequence of this empty vector is the sequence formed by sequentially connecting SEQ ID NO: 22 and SEQ ID NO: 29) stored in the laboratory to form overexpression vectors pXL106 - GmNRPE6a and pXL106 - GmNRPE6b. Among them, the nucleotide sequences of the primers for PCR amplification of the GmNRPE6 gene (including GmNRPE6a gene and GmNRPE6b gene) are as follows:

[0054] Upstream primer for GmNRPE6a (SEQ ID NO: 6): GGCGGAGTCGACTCCGGATCCATGGAATCGGAAGGGCAAAAGGGTAC.

[0055] Upstream primer for GmNRPE6b (SEQ ID NO: 7): GGCGGAGTCGACTCCGGATCCATGGAACCGGAAGGGCAAAAGGG.

[0056] Downstream primer for GmNRPE6a and GmNRPE6b (SEQ ID NO: 8): GTTTGAACGATCTTAGGGCCCCAAGGTCAGGTCAGGATCATCTTCA.

[0057] 2) Construction of knockout vectors for soybean GmNRPE6a and GmNRPE6b genes: The knockout expression vector was constructed using the reported CRISPR - Cas9 technology. The vector used was the pFYS007 empty vector, and the structure of this empty vector is shown in Figure 2, and its nucleotide sequence is the sequence formed by sequentially connecting SEQ ID NO: 23, SEQ ID NO: 30, SEQ ID NO: 31, and SEQ ID NO: 32. The steps for knocking out the expression vector are as follows: First, use the website http: / / crispor.tefor.net / to design sgRNAs for the genomic exon region sequences of GmNRPE6a and GmNRPE6b. According to the scores, select sgRNA1 (nucleotide sequence: SEQ ID NO9: GCAATTCGTTCTCTCGAACATGG) and sgRNA2 (nucleotide sequence: SEQ ID NO 10: AAAGGGTACGGTGAACCCGTCGG), and then design the primers required for the knockout vector according to the sgRNA sequences. The nucleotide sequences of the primers are:

[0058] 007-EAF6-T1-F (SEQ ID NO: 11): TGGTCTCGTGCAGCAATTCGTTCTCTCGAACAGTTTTAGAGCTAGAAATAGC.

[0059] 007-EAF6-T1-R (SEQ ID NO: 12): TGGTCTCGACCGTACCCTTTTGCACCAGCCGGGAATCGAA.

[0060] 007-EAF6-T2-F (SEQ ID NO: 13): TGGTCTCGCGGTGAACCCGTGTTTTAGAGCTAGAAATAGC.

[0061] 007-EAF6-T2-R (SEQ ID NO: 14): TGGTCTCGAAACGTCCGCGATGTTAGCGTCTCTGCACCAGCCGGGAATCGAA.

[0062] The vector construction process is as follows: Using the pFYS007 empty vector as a template, perform PCR amplification with the primers containing sgRNAs to obtain the target fragment containing sgRNAs, and then ligate the target fragment with the pFYS007 empty vector and the restriction endonuclease BsaI-HF @v2 (manufacturer: NEB, model: R3733L), T4 DNA ligase (manufacturer: NEB, model: M0202L) and its corresponding buffer were mixed, and the reaction of cutting and ligating was carried out in a PCR instrument. Finally, the product was transformed into Escherichia coli DH5α. After successful sequencing, the vector construction was completed, and the GmNRPE6 gene knockout vector FYS007-GmNRPE6 was obtained. It should be noted that due to the randomness of gene knockout, the mutated site in the obtained gene knockout vector FYS007-GmNRPE6 may be the GmNRPE6a gene, or the GmNRPE6b gene, or both the GmNRPE6a gene and the GmNRPE6b gene may have mutated.

[0063] The amplification reaction system is shown in Table 1, and the amplification reaction program is shown in Table 2.

[0064] Table 1

[0065]

[0066] Table 2

[0067]

[0068] Transformation of Agrobacterium tumefaciens:

[0069] The constructed transgenic vectors (including the overexpression vectors pXL106-GmNRPE6a, pXL106-GmNRPE6b and the gene knockout vector FYS007-GmNRPE6) were transformed into the EHA105 Agrobacterium tumefaciens competent cells prepared and stored in the laboratory by heat shock. The specific process was as follows: 1 μL of the constructed transgenic vector was taken and added to 100 μL of EHA105 competent cells, placed on ice for 30 min, then quickly frozen in liquid nitrogen for 5 min, incubated at 37 °C for 5 min, 500 μL of liquid LB medium without antibiotics was added, and the cells were cultured with shaking at 28 °C for 2 h. Then the bacterial solution was spread on a solid plate containing the corresponding antibiotics to obtain the EHA105 strains for genetic transformation (referring to the Agrobacterium tumefaciens EHA105 strains containing the overexpression vectors pXL106-GmNRPE6a, pXL106-GmNRPE6b and the gene knockout vector FYS007-GmNRPE6 respectively).

[0070] It should be noted that the antibiotic types used for pXL106-GmNRPE6a and pXL106-GmNRPE6b are rifampicin (Rif) and spectinomycin (Spec), and the antibiotic types used for FYS007-GmNRPE6 are rifampicin (Rif) and kanamycin (Kan).

[0071] Example 3 Creation of transgenic materials with overexpression and knockout of soybean GmNRPE6 gene

[0072] Creation of transgenic soybean materials by cotyledon node infection method: The soybean variety W82 (Williams 82) propagated and preserved in the laboratory was used as the recipient material to create transgenic soybean materials.

[0073] After 5 days of aseptic culture and germination of plump and disease-free W82 seeds, the cotyledon nodes were carefully excised with a scalpel and forceps as explants, placed in the EHA105 bacterial suspension, and cultured for 30 minutes at room temperature. The infected explants then underwent the processes of adventitious bud induction, bud elongation, rooting induction, growth acclimation of tissue culture seedlings, and transplantation to obtain T0 generation transgenic seedlings with GmNRPE6 gene knockout and overexpression. The T0 generation positive seedlings obtained by screening were preliminarily identified for transgenes using a PAT / bar transgenic test strip (manufacturer: AgeneFast, model: AG-002-SLF), and the seeds were harvested. Finally, 3 types of transformed materials were obtained, namely: the GmNRPE6 gene knockout material gmnrpe6, and the GmNRPE6 overexpression materials GmNRPE6aOE and GmNRPE6bOE. It should be noted that the above experiments were completed by the Modern Agricultural Transgenic Platform of Peking University, which is open to the public.

[0074] It should be noted that the transgenic materials of the T0 generation may not be stably inherited materials, and may be chimeras or heterozygotes. Therefore, it is necessary to identify the offspring of T0 to obtain stably heritable transgenic materials. The mutation site of the GmNRPE6 gene knockout material gmnrpe6 here may be a single mutation of the GmNRPE6a gene or the GmNRPE6b gene, or a double mutation of the GmNRPE6a + GmNRPE6b genes.

[0075] Example 4 Identification of Transgenic Materials with Overexpression and Knockout of Soybean GmNRPE6 Gene

[0076] 1) Extraction of soybean genomic DNA by CTAB method: Use a leaf sampling punch to take leaf tissue with a diameter of 6 mm, put it into a 2 mL Eppendorf tube, add steel beads with a diameter of 2 mm that have been cleaned, pre-cool in liquid nitrogen, and then sample at 50 Hz for 1 min with a sample grinder; add 300 μL of CTAB extraction buffer, shake well, incubate at 65 °C for 30 min; cool to room temperature, add 300 μL of phenol:chloroform:isoamyl alcohol (25:24:1), mix well; centrifuge at 12000 rpm for 10 min, pipette the supernatant into a new 1.5 mL centrifuge tube, add 0.6 times the volume of isopropanol, gently invert and mix well, let stand at -20 °C for 30 min; centrifuge at 12000 rpm at room temperature for 10 min, discard the supernatant, add 1 mL of 70% ethanol for rinsing; centrifuge at 12000 rpm at room temperature for 5 min and blow in a laminar flow hood for 5 - 10 min; add 50 μL of ddH2O, dissolve and store at 4 °C.

[0077] 2) Amplification and identification of the genome of gene-edited soybean in the T1 generation: Using the extracted genomic DNA of T1 transgenic soybean as a template, perform PCR amplification on the GmNRPE6a and GmNRPE6b genes respectively. Then sequence the PCR products for the first generation to obtain the sequence information of the GmNRPE6a and GmNRPE6b genes in the transgenic materials, and determine whether gene editing events have occurred in the transgenic materials by comparing with the reference genome sequence of the wild type W82. The amplification reaction system is shown in Table 3, and the amplification reaction program is shown in Table 4. Among them, the nucleotide sequences of the amplification primers are:

[0078] GmNRPE6a-CR-F (SEQ ID NO: 15): GGTTAATCCTCCGAGTTGCGAAG.

[0079] GmNRPE6b-CR-F (SEQ ID NO: 16): CCGCATTGTGAAGCAATTAGGG.

[0080] GmNRPE6-CR-R (SEQ ID NO: 17): CGGAATTGGTTCAACCAACCAAAC.

[0081] Table 3:

[0082]

[0083] Table 4:

[0084]

[0085] Take 2 μL of the PCR product for detection by 1% agarose gel electrophoresis, and sequence and compare the remaining products. After sequencing and comparison, we obtained the single mutants of gmnrpe6a-1 and gmnrpe6b-1, as well as the double mutant gmnrpe6a-1+gmnrpe6b-2. The results are shown in Figure 7 . Among them, the mutation type of gmnrpe6a-1 is a 1-base deletion at the 39th position of the nucleotide sequence of the GmNRPE6a gene; the mutation type of gmnrpe6b-1 is a 1-base deletion at the 35th position of the nucleotide sequence of the GmNRPE6b gene; the mutation type of gmnrpe6b-2 is a 5-base deletion from the 30th to the 34th positions of the nucleotide sequence of the GmNRPE6b gene.

[0086] 3) Extraction of soybean leaf proteins and Western blot detection: Use a leaf sampling punch to take circular leaves with a diameter of 6 mm, put them into a 2 mL EP tube, quickly freeze them in liquid nitrogen, and then break the leaves with a tissue grinder. Add 40 μL of SDS-PAGE protein loading buffer (2×) to the EP tube, vortex, incubate at 95°C for 5 minutes, then centrifuge at 12,000 g for 1 minute, and take 10 μL of the supernatant for protein electrophoresis detection. After electrophoresis, transfer the protein to a PVDF membrane using a Bio-Rad semi-dry transfer apparatus; first stain the PVDF membrane with Ponceau S staining solution to detect the transfer efficiency, then wash the dye clean with PBS solution, and block the PVDF membrane with 5% skim milk powder at room temperature for 1 hour. Replace the fresh blocking solution, then add the antibody to the blocking solution at a ratio of 1:3,000, and hybridize for 1 h or incubate overnight at 4°C; wash the membrane 3 times in TBST, 5 min each time; perform chemiluminescent detection.

[0087] The experimental results are as shown in Figure 3 . Two overexpression transgenic lines of GmNRPE6a and GmNRPE6b each (GmNRPE6aOE-1, GmNRPE6aOE-2, GmNRPE6bOE-1, and GmNRPE6bOE-2) were obtained, showing obvious signals.

[0088] 4) RNA extraction from soybean leaves and detection of GmNRPE6 gene expression: The trifoliate leaves of wild-type W82 and GmNRPE6 overexpression materials (GmNRPE6aOE-1, GmNRPE6aOE-2, GmNRPE6bOE-1, and GmNRPE6bOE-2) grown to the V2 stage were quickly frozen in liquid nitrogen and then ground in a mortar. Total RNA of the leaves was extracted using the Promega RNA extraction kit (LS1040), and then single-stranded cDNA was synthesized using the Novoprotein reverse transcription kit (R323-01) for fluorescence quantitative PCR to detect gene expression. After diluting the synthesized cDNA 5-fold, 2 μL was taken as a template, and the Novoprotein fluorescence quantitative PCR Mix was used to detect the gene expression of GmNRPE6a and GmNRPE6b.

[0089] The nucleotide sequences of the primers used for overexpression detection are as follows:

[0090] GmNRPE6aOE-F (SEQ ID NO: 18): AACCCGTCCGCGATGTTAGCGT.

[0091] GmNRPE6aOE-R (SEQ ID NO: 19): CATTCCCACATTGTCCAGGATCT.

[0092] GmNRPE6bOE-F (SEQ ID NO: 20): AACCCGTCGGCAATGTTAGCTT.

[0093] GmNRPE6bOE-R (SEQ ID NO: 21): CATTACCACACTGTCCAGGATCC.

[0094] The results showed that the GmNRPE6 gene expression levels in the GmNRPE6a and GmNRPE6b overexpression lines (including GmNRPE6aOE-1, GmNRPE6aOE-2, GmNRPE6bOE-1, and GmNRPE6bOE-2) with detectable protein expression were significantly higher than those in the wild-type W82 ( Figure 4 ).

[0095] Example 5 Determination of plant height of transgenic materials with overexpression and knockout of soybean GmNRPE6 gene

[0096] Seeds of wild-type soybean material W82 and GmNRPE6 overexpression (GmNRPE6aOE-1, GmNRPE6aOE-2, GmNRPE6bOE-1, and GmNRPE6bOE-2) and gene knockout (gmnrpe6a-1, gmnrpe6b-1, and gmnrpe6a-1+gmnrpe6b-2) materials were planted in nutrient pots filled with substrate soil for germination and placed in a soybean growth chamber for growth. The light intensity in the soybean growth chamber was 300 μmol / m 2 / s, the light duration was 16 hours, the lights were turned off for 8 hours, and the temperature was 25°C. When the transgenic soybean materials showed significant differences in plant height from the control materials during the growth stage (at 30 days after planting), their plant heights were measured and statistically analyzed. The measurement standard was the length from the emergence position of the soybean to the highest position at the top of the soybean plant stem.

[0097] By observing and measuring the plant height phenotypes of GmNRPE6a and GmNRPE6b overexpression materials, it was found that compared with the wild-type control material W82, overexpression of either GmNRPE6a or GmNRPE6b significantly reduced the plant height of soybeans ( Figure 5 and Figure 6 ). In addition, by observing the plant height phenotypes of mutant materials of GmNRPE6, including single mutants gmnrpe6a-1 and gmnrpe6b-1 and double mutant gmnrpe6a-1+gmnrpe6b-2, it was found that there was no difference in the plant height of single mutants gmnrpe6a-1 and gmnrpe6b-1 compared with W82, and only the double mutant gmnrpe6a-1+gmnrpe6b-2 with simultaneous mutations in genes GmNRPE6a and GmNRPE6b showed a phenotype of increased plant height compared with W82 ( Figure 8 and Figure 9 ). From the above results, it can be seen that the present invention can achieve the regulation of soybean plant height by overexpressing or knocking out the GmNRPE6 gene.

[0098] In various determination and analysis experiments involved in this patent, each sample was measured in parallel three times, and the results were expressed as mean ± standard deviation. The significance of the differences between each sample and the control was analyzed by two-tailed t-test (p value).

[0099] From the above description, it can be seen that the above embodiments of the present invention achieved the following technical effects: The present invention first discovered that soybean GmNRPE6a and GmNRPE6b genes have the function of regulating plant height, and the present invention also demonstrated through experiments that overexpression and knockout of the GmNRPE6 gene (including GmNRPE6a gene and GmNRPE6b gene) can cause significant changes in plant height.

[0100] The present invention has for the first time created double mutants with gene editing of gmnrpe6 and soybean materials with overexpression of GmNRPE6a and GmNRPE6b. This provides necessary genetic materials for in-depth understanding of the mechanism of soybean plant height regulation and good germplasm resources for the establishment and application of ideal plant types of soybeans.

[0101] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various changes and modifications. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A method for regulating the plant height of soybeans, characterized in that, The method includes: overexpressing any one or more of the following genes in soybean: GmNRPE6a or GmNRPE6b or knocking out the following two genes in soybean: GmNRPE6a and GmNRPE6b ; Among them, the GmNRPE6a nucleotide sequence of the gene is SEQ ID NO: 1; the GmNRPE6b nucleotide sequence of the gene is SEQ ID NO:

2.

2. The method according to claim 1, wherein Knock out the said GmNRPE6a gene and the said GmNRPE6b gene as follows: At the GmNRPE6a deletion of the C base at the 39th position of the nucleotide sequence of the GmNRPE6b gene and deletion of 5 bases at positions 30 to 34 of the nucleotide sequence of the gene.

3. The method according to claim 1, wherein The overexpression method includes: transferring an overexpression vector into the soybean; the overexpression vector contains the GmNRPE6a gene and / or the GmNRPE6b gene and a strong promoter.

4. The method according to claim 3, characterized in that The overexpression vector contains the said GmNRPE6a gene or the said GmNRPE6b gene and the said strong promoter.

5. The method according to claim 4, characterized in that, The strong promoter is selected from any one or more of the following: CaMV 35S promoter, UBQ10 promoter, Nos promoter, Actin2 promoter, RbcS promoter or 35S enhancer.

6. Use of the method according to any one of claims 1-5 in soybean cultivation.

Images