Method for increasing growth speed of domestic rabbits

Abstract

The invention is suitable for the technical field of rabbit breeding, and provides a method for increasing the growth speed of domestic rabbits. According to the present invention, the advantages of the SpRY-CBE gene editing technology are utilized, the SpRY-CBE gene editing technology is not limited by the identification of the PAM region sequence, the specific sgRNA sequence is designed according to the New Zealand rabbit LTBP2 gene sequence, the single base mutation of the LTBP2 p.T908M site is achieved, the embryo transplantation is performed after the embryo injection, and the rabbit variety with the improved growth rate is obtained. According to the invention, a new idea of animal genetic breeding is developed by utilizing a gene editing technology, and development of livestock breeding industry in China is greatly promoted, economic benefits of animal industry in China are improved and international competitiveness is enhanced by promoting improvement of growth traits of rabbits and creating a new rabbit model or strain.

Description

Technical Field

[0001] The invention belongs to the technical field of rabbit breeding, and in particular relates to a method for improving the growth rate of rabbits. Background Art

[0002] Rabbits are important livestock and agricultural economic animals in my country, playing a key role in many aspects. First, in animal husbandry, rabbits can effectively convert roughage into high-quality meat, skin and fur products, which not only reduces the dependence on grain feed to a certain extent, but also makes the resource utilization of animal husbandry more reasonable. Secondly, rabbits provide meat and fur, the quality of which has an important impact on human health and life. For animal breeders, the growth rate and meat yield of rabbits are crucial. To achieve this goal, it is particularly important to identify the genetic factors that control growth, reproduction, carcass and meat quality traits. In recent years, new gene editing technologies and other means have been widely used to accelerate the genetic breeding program of important production traits of rabbits, aiming to improve the economic value of animals. In terms of scientific research, a considerable number of studies have used candidate gene methods to identify DNA markers associated with economically relevant traits of meat animals (such as meat quality and carcass traits, reproduction and growth traits). For example, latent transforming growth factor β-binding protein 2 (LTBP2) is considered to be associated with the number of vertebrae and body length development in animals, among which the p.M911T missense substitution is considered to affect the number of thoracic vertebrae in pig populations.

[0003] However, although my country has abundant local rabbit breed resources, they generally have defects such as slow growth rate and low meat production capacity. It is imperative to improve the growth capacity of domestic rabbit breeds and breed specialized meat rabbit breeds. To this end, the present invention provides a method for improving the growth rate of domestic rabbits. Summary of the invention

[0004] The object of the present invention is to provide a method for improving the growth rate of rabbits, aiming to solve the problems raised in the above background technology.

[0005] The purpose of the present invention is achieved through the following technical solutions: A method for increasing the growth rate of rabbits comprises the following steps: Step 1: Construction of sgRNA expression vector; A sgRNA target sequence was designed for the New Zealand rabbit LTBP2 p.T908M site, and a pair of oligonucleotide chains were synthesized and annealed to form a double-stranded sgRNA; the double-stranded sgRNA was connected to the linearized PUC57 vector to complete the construction of the PUC57-sgRNA vector, and then enzyme digestion, electrophoresis and gel recovery were performed in sequence; The oligonucleotide chain sequence is as follows: sgRNA-F: CTACACGCTGGCCACCGAGG, as shown in SEQ ID NO.1; sgRNA-R: CCTCGGTGGCCAGCGTGTAG, as shown in SEQ ID NO.2: Step 2: transcription synthesis of SpRY-CBE mRNA; The SpRY-CBE plasmid was digested overnight to form linear DNA, which was recovered by electrophoresis and purified for transcription and synthesis of SpRY-CBE; Step 3: Preparation of LTBP2 gene-edited rabbits using embryo microinjection technology; The synthesized sgRNA and SpRY-CBE were mixed and injected into fertilized eggs, which were then transplanted into the oviducts of recipient rabbits. After pregnancy, LTBP2 gene-edited rabbits were obtained. Step 4: Rabbit genome identification; DNA from LTBP2 gene-edited rabbits was extracted, PCR was performed, and sequencing was performed. If the C at the 5th position of the sgRNA sequence was mutated to T, it was confirmed that a single base mutation was obtained; PCR primers are as follows: Upstream primer: CCACTCCTCAAACTGGACATT, as shown in SEQ ID NO.3; Downstream primer: GCTCAGAATTCCTTAGGTCCTTTA, as shown in SEQ ID NO.4.

[0006] Furthermore, in step 1, the specific process of the annealing treatment is: annealing the synthesized oligonucleotide chain at 95° C. for 5 minutes, cooling to room temperature, and forming a double-stranded sgRNA.

[0007] Furthermore, in step 1, the enzyme digestion system is: PUC57 plasmid 20 μL, 10×Buffer 20 μL, BbsⅠ 1 μL and ddH2O 159 μL.

[0008] Furthermore, in step 1, the process of performing enzyme digestion, electrophoresis and gel recovery in sequence is: performing enzyme digestion overnight at 37° C., running the gel by agarose electrophoresis, and then recovering the DNA using a common DNA agarose gel recovery kit.

[0009] Furthermore, in step 2, the enzyme digestion system is: AgeI 1 μL, xBaI 1 μL, SpRY-CBE plasmid 20 μL, rCut Smart Buffer 10 μL and ddH2O 18 μL; The transcription synthesis system was: linear SpRY-CBE 1.5 μg, NTP Buffer 10 μL, T7 RNA polymerase 2 μL, and ddH2O 6 μL; The transcription synthesis process is as follows: after mixing, incubate at 37°C for 1 h; after transcription is completed, add 1 μL DNaseI to digest the transcription template, react at 37°C for 15 min, and then add the polyA tail.

[0010] Furthermore, in step 4, the PCR reaction system is: 1 μL of template DNA, 1.5 μL of upstream primer, 1.5 μL of downstream primer, 12.5 μL of 2×Taq plus and 8.5 μL of ddH2O.

[0011] Furthermore, in step 4, the PCR reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 40 s; 38 cycles; extension at 72°C for 5 min.

[0012] Compared with the prior art, the present invention has the following beneficial effects: The present invention discloses a method for improving the growth rate of rabbits. The advantages of SpRY-CBE gene editing technology are utilized, that is, it is not limited by the recognition of PAM region sequences. A specific sgRNA sequence is designed for the New Zealand rabbit LTBP2 gene sequence to achieve a single base mutation of the LTBP2 p.T908M site. Embryo transplantation is performed after embryo injection to obtain a rabbit variety with improved growth rate. The present invention uses gene editing technology to open up new ideas for animal genetic breeding. By promoting the improvement of rabbit growth traits and creating new rabbit models or strains, the development of my country's animal husbandry industry is greatly promoted, the economic benefits of my country's animal industry are improved, and international competitiveness is enhanced. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a schematic diagram of sgRNA design.

[0014] Figure 2 This is the Sanger sequencing map of the LTBP2 gene mutation in newborn rabbits.

[0015] Figure 3 This is a comparison of body length between normal rabbits and LTBP2 gene-edited rabbits at different times from 20 to 50 days.

[0016] Figure 4 The weight changes of normal rabbits and LTBP2 gene-edited rabbits within 10-60 days are statistically analyzed; these include normal rabbits (WT), LTBP2 gene-edited rabbits with heterozygous mutation (LTBP2 T / M ) and LTBP2 gene-edited rabbit homozygous mutation (LTBP2 M / M ).

[0017] Figure 5 The body length comparison between normal rabbits and LTBP2 gene-edited rabbits at 5 months old; A is the body length comparison between normal rabbit No. 2 (WT-2) and LTBP2 gene-edited rabbit No. 1 (LTBP2-1), B is the body length comparison between normal rabbit No. 3 (WT-3) and LTBP2 gene-edited rabbit No. 4 (LTBP2-4), C is the body length comparison between LTBP2 gene-edited rabbit homozygous mutation (LTBP2 M / M ), heterozygous mutation (LTBP2 T / M ) and normal rabbit (WT) body length statistical analysis. DETAILED DESCRIPTION

[0018] In order to have a clearer understanding of the technical features, purposes and beneficial effects of the present invention, the technical solution of the present invention is now described in detail below, but it should not be construed as limiting the applicable scope of the present invention.

[0019] The specific implementation of the present invention is described in detail below in conjunction with specific embodiments.

[0020] One embodiment of the present invention provides a method for increasing the growth rate of rabbits, the method comprising the following steps: Step 1: Construction of sgRNA expression vector (PUC57-sgRNA); Figure 1 This is a schematic diagram of sgRNA design. A sgRNA target sequence was designed for the New Zealand rabbit LTBP2 p.T908M (LTBP2 p.Thr908Met) site, and a pair of oligonucleotide chains were synthesized, namely sgRNA-F (sequence CTACACGCTGGCCACCGAGG, as shown in SEQ ID NO.1) and sgRNA-R (sequence CCTCGGTGGCCAGCGTGTAG, as shown in SEQ ID NO.2). The principle for selecting these two oligonucleotide chains is to ensure that the position of the mutant base is located at the 5th position paired with the target DNA sequence. Afterwards, the synthesized oligonucleotide chain was annealed at 95°C for 5 minutes and cooled to room temperature to form a double-stranded sgRNA. At the same time, the PUC57 vector was linearized using BbsI restriction endonuclease, and the linearized vector was recovered by gel after agarose electrophoresis. Finally, the double-stranded sgRNA was connected to the linearized PUC57 vector to complete the construction of the PUC57-sgRNA vector, and then enzyme digestion, electrophoresis and gel recovery were performed in sequence.

[0021] Enzyme digestion system: PUC57 plasmid 20μL; 10×Buffer 20μL; BbsⅠ 1μL; ddH2O 159μL.

[0022] The process of enzyme digestion, electrophoresis and gel recovery was as follows: overnight enzyme digestion at 37°C, agarose gel electrophoresis, and recovery using a common DNA agarose gel recovery kit (purchased from Shanghai Bioengineering Company, Shanghai, China), and the specific operations were carried out according to the instructions.

[0023] Step 2: transcription synthesis of SpRY-CBE mRNA; The SpRY-CBE plasmid (stored in this laboratory) was digested overnight at 37°C to form linear DNA, which was recovered by agarose gel electrophoresis. The recovered product was purified by chloroform extraction and then transcribed and synthesized by SpRY-CBE according to the instructions of the in vitro transcription kit.

[0024] The enzyme digestion system is: AgeI 1μL; xBaI 1μL; SpRY-CBE plasmid 20μL; rCut Smart Buffer 10μL; ddH2O 18μL.

[0025] The transcription synthesis system is: linear SpRY-CBE 1.5μg; NTP Buffer 10μL; T7 RNA polymerase 2μL; ddH2O 6μL.

[0026] The transcription synthesis process is as follows: after mixing, incubate at 37°C for 1 h. After transcription is completed, add 1 μL DNaseI to digest the transcription template, react at 37°C for 15 min, and then add the polyA tail.

[0027] Step 3: Preparation of LTBP2 gene-edited rabbits using embryo microinjection technology; Using a microinjector, the synthesized 15ng / μL sgRNA and 80ng / μL SpRY-CBE were mixed, and 3μL was aspirated into the injection needle for embryonic cell nucleus injection. The injected fertilized eggs were transplanted into the oviducts of recipient rabbits in estrus at the same time. The surrogate rabbits were provided with sufficient water and food, and after gestation for 25 days, they were transferred to the delivery room until the expected date of delivery, and finally the LTBP2 gene-edited rabbits were obtained.

[0028] Step 4: Rabbit genome identification; DNA was extracted from the obtained LTBP2 gene-edited rabbit ear tissue according to the kit instructions (purchased from Tiangen Company, Beijing, China). Then, PCR was performed using the designed PCR primers. After the PCR was completed, electrophoresis was performed for identification. If the PCR amplification was successful, the PCR product was sequenced to obtain the genotype identification result.

[0029] The designed PCR primers are as follows: Upstream primer: CCACTCCTCAAACTGGACATT (as shown in SEQ ID NO.3); Downstream primer: GCTCAGAATTCCTTAGGTCCTTTA (as shown in SEQ ID NO.4); PCR reaction system: template DNA 1 μL; upstream primer 1.5 μL; downstream primer 1.5 μL; 2×Taq plus 12.5 μL; ddH2O 8.5 μL.

[0030] Reaction conditions: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 40 s; 38 cycles; extension at 72°C for 5 min.

[0031] The PCR product was sent to Sangon Biotech for sequencing. If the C at the 5th position of the sgRNA sequence mutated to T, it was confirmed that a single base mutation was obtained. Figure 2 As shown, the C at the 5th position of the sgRNA sequence was mutated into T, and the present invention obtained the LTBP2 gene mutant rabbit.

[0032] Example 1: Phenotypic analysis of LTBP2 gene-edited rabbits; 1) Comparison of body length between normal rabbits (WT) and LTBP2 gene-edited rabbits at different times from 20 to 50 days; The body lengths of normal rabbits and LTBP2 gene-edited rabbits were measured at 20, 30, and 50 days after birth. Figure 3 As shown in the figure, the body length of LTBP2 gene-edited rabbits was significantly greater than that of normal rabbits at day 20. After 50 days of observation, the body length of LTBP2 gene-edited rabbits was still significantly greater than that of normal rabbits.

[0033] 2) Statistics of body weight changes of normal rabbits (WT) and LTBP2 gene-edited rabbits within 10-60 days; The body weights of normal rabbits and LTBP2 gene-edited rabbits were recorded from 10 to 60 days after birth. Figure 4 As shown, homozygous mutations in LTBP2 gene-edited rabbits were found (LTBP2 M / M ) and LTBP2 gene-edited rabbit heterozygous mutation (LTBP2 T / M ) had a significantly higher weight gain rate than normal rabbits.

[0034] 3) Comparison of body length between normal rabbits and LTBP2 gene-edited rabbits at 5 months old; The body lengths of normal rabbits and LTBP2 gene-edited rabbits were observed at 5 months of age. Figure 5As shown in A and B, when the rabbits continued to grow to 5 months of age, the body lengths of LTBP2 gene-edited rabbits No. 1 (LTBP2-1) and No. 4 (LTBP2-4) were taller than those of normal rabbit No. 2 (WT-2) and normal rabbit No. 3 (WT-3), respectively. Figure 5 C in the figure shows LTBP2 gene-edited rabbits (including homozygous mutant LTBP2 M / M and heterozygous mutations in LTBP2 T / M ) and normal rabbits (WT) showed that the body length of LTBP2 gene-edited rabbits was still significantly larger than that of normal rabbits at 5 months of age.

[0035] In summary, the present invention successfully bred a new breed of LTBP2 gene-edited rabbits, which have the characteristics of significantly better growth traits such as body length and weight than normal rabbits, which is of great significance for improving the growth ability of domestic rabbit breeds and promoting the sound development of my country's animal husbandry industry.

[0036] The above are only preferred embodiments of the present invention. It should be pointed out that, for those skilled in the art, several modifications and improvements can be made without departing from the concept of the present invention. These should also be regarded as the protection scope of the present invention. These will not affect the effect of the implementation of the present invention and the practicality of the patent.

Claims

1. A method for increasing the growth rate of rabbits, characterized in that: The following steps are involved: Step 1: Construction of sgRNA expression vector; A sgRNA target sequence was designed for the New Zealand rabbit LTBP2 p.T908M site, and a pair of oligonucleotide chains were synthesized and annealed to form a double-stranded sgRNA; the double-stranded sgRNA was connected to the linearized PUC57 vector to complete the construction of the PUC57-sgRNA vector, and then enzyme digestion, electrophoresis and gel recovery were performed in sequence; The oligonucleotide chain sequence is as follows: sgRNA-F: CTACACGCTGGCCACCGAGG, as shown in SEQ ID NO.1; sgRNA-R: CCTCGGTGGCCAGCGTGTAG, as shown in SEQ ID NO.2: Step 2: transcription synthesis of SpRY-CBE mRNA; The SpRY-CBE plasmid was digested overnight to form linear DNA, which was recovered by electrophoresis and purified for transcription and synthesis of SpRY-CBE; Step 3: Preparation of LTBP2 gene-edited rabbits using embryo microinjection technology; The synthesized sgRNA and SpRY-CBE were mixed and injected into fertilized eggs, which were then transplanted into the oviducts of recipient rabbits. After pregnancy, LTBP2 gene-edited rabbits were obtained. Step 4: Rabbit genome identification; DNA from LTBP2 gene-edited rabbits was extracted, PCR was performed, and sequencing was performed. If the C at the 5th position of the sgRNA sequence was mutated to T, it was confirmed that a single base mutation was obtained; PCR primers are as follows: Upstream primer: CCACTCCTCAAACTGGACATT, as shown in SEQ ID NO.3; Downstream primer: GCTCAGAATTCCTTAGGTCCTTTA, as shown in SEQ ID NO.

4.

2. The method for increasing the growth rate of rabbits according to claim 1, characterized in that: In step 1, the specific process of the annealing treatment is: annealing the synthesized oligonucleotide chain at 95° C. for 5 minutes, cooling to room temperature, and forming a double-stranded sgRNA.

3. The method for increasing the growth rate of rabbits according to claim 1, characterized in that: In the step 1, the enzyme digestion system is: PUC57 plasmid 20 μL, 10×Buffer 20 μL, BbsⅠ 1 μL and ddH2O 159 μL.

4. The method for increasing the growth rate of rabbits according to claim 1, characterized in that: In step 1, the process of performing enzyme digestion, electrophoresis and gel recovery in sequence is: performing enzyme digestion overnight at 37° C., running the agarose gel by agarose electrophoresis, and then recovering the DNA using a common DNA agarose gel recovery kit.

5. The method for increasing the growth rate of rabbits according to claim 1, characterized in that: In step 2, the enzyme digestion system is: AgeI 1 μL, xBaI 1 μL, SpRY-CBE plasmid 20 μL, rCut Smart Buffer 10 μL and ddH2O 18 μL; The transcription synthesis system was: linear SpRY-CBE 1.5 μg, NTP Buffer 10 μL, T7 RNA polymerase 2 μL, and ddH2O 6 μL; The transcription synthesis process is as follows: after mixing, incubate at 37°C for 1 h; after transcription is completed, add 1 μL DNaseI to digest the transcription template, react at 37°C for 15 min, and then add the polyA tail.

6. The method for increasing the growth rate of rabbits according to claim 1, characterized in that: In step 4, the PCR reaction system is: 1 μL of template DNA, 1.5 μL of upstream primer, 1.5 μL of downstream primer, 12.5 μL of 2×Taq plus and 8.5 μL of ddH2O.

7. The method for increasing the growth rate of rabbits according to claim 1, characterized in that: In step 4, the PCR reaction conditions are: pre-denaturation at 95° C. for 5 min; denaturation at 95° C. for 30 s, annealing at 58° C. for 30 s, extension at 72° C. for 40 s; 38 cycles; and extension at 72° C. for 5 min.

Images