Production method and application of L-glutamine for cell culture

Abstract

The invention belongs to the technical field of gene engineering, and discloses a production method and application of L-glutamine for cell culture, and the production method comprises the following steps: knocking out glutaminase genes glsA and glsB in Escherichia coli BL21 (ACCC11171); a recombinant strain plasmid is constructed to over-express a glutamine synthase gene glnA and a polyphosphate kinase gene ppk, L-glutamic acid, ATP and ammonium salt are catalyzed by glutamine synthase to form L-glutamine, and ATP regeneration is catalyzed by polyphosphate kinase; culturing the recombinant strain to induce enzyme production, and configuring an enzyme reaction system to catalyze synthesis of L-glutamine; and separating and purifying to obtain the cell culture level L-glutamine. The glutamine synthase screened in the invention can efficiently catalyze the conversion of L-glutamic acid to L-glutamine, the highest yield of L-glutamine can reach 590 mM (86 g / L), and the molar conversion rate is 90%.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and relates to the biotechnology production of compounds, in particular to a production method and application of L-glutamine for cell culture. Background Art

[0002] L-glutamine is a neutral amino acid formed by the amidation of the gamma carboxyl group of glutamic acid. It is one of the 20 basic amino acids that make up biological proteins. L-glutamine plays an important role in maintaining human functions and life activities. Its content in the human body is very high, accounting for 61% of the free amino acids in the human body.

[0003] L-glutamine participates in the transamination reaction in cell metabolism. Amino acids such as L-glutamine are the material basis for cell growth and cell nutrition, and are essential amino acids for cell culture. They are also the biological reagents with the most types and the highest addition amounts in cell culture media. Antibodies and viral vaccines are biologically active and structurally unstable (such as glycosylation). Even a small amount of impurities may cause clinical harm. Therefore, cell culture has extremely high quality requirements for amino acid purity, endotoxin, and impurity content. The development of high-value-added high-end L-glutamine products can significantly reduce the production cost of cell culture medium biopharmaceutical products, which is of great significance to promoting the industrial upgrading of my country's biopharmaceutical industry and building an independent industrial chain.

[0004] The existing technology mainly utilizes microbial fermentation, and then separates and purifies the fermentation broth to prepare L-glutamine. Chinese patent publication CN111187178A proposes a method for preparing L-glutamine crystals, in which the fermentation broth is subjected to extraction treatment to obtain a refined L-glutamine clear liquid. The refined clear liquid is regulated to pH value. A crystallization aid is added to the refined liquid, and evaporation and concentration are started. After concentration, L-glutamine seed crystals are added. Evaporation and crystallization are continued until a certain concentration is reached and evaporation is terminated. The concentrated liquid obtained by evaporation and crystallization is cooled, pre-crystallized, separated, and dried to obtain a glutamine finished product and a refined mother liquor. The L-glutamine yield of the above method is 85%, and the purity is 99.5%.

[0005] Chinese patent publication CN108997159A proposes a method for preparing L-glutamine. L-glutamine is obtained by microfiltration, crystallization and decolorization of L-glutamine fermentation broth; the ion exchange step is not included. The ion exchange step is completely removed, which greatly improves the yield, saves acid, alkali and water, greatly reduces waste water and waste liquid, reduces pollution, reduces energy consumption and saves costs. The by-product retentate and crude mother liquor are used to make fertilizers, achieving zero emission of the glutamine extraction process. The L-glutamine yield of the above method is 68.3% and the purity is 98.6%.

[0006] Chinese patent publication CN113684165A proposes a recombinant Corynebacterium glutamicum and its application in producing L-glutamine, belonging to the field of bioengineering technology. The adenylylation activity of intracellular γ-glutamate kinase, glutamate secretion mechanical channel protein and glutamine synthetase of the recombinant Corynebacterium glutamicum is lost, and the glutamine synthetase derived from Saccharomyces cerevisiae and the polyphosphate kinase derived from Escherichia coli are co-expressed using plasmid pXMJ19. The recombinant Corynebacterium glutamicum is inoculated into a 5L fermentation tank and fermented for 66h, so that the output of L-glutamine in the fermentation liquid can reach 73.5g / L and the conversion rate of glycosamine can reach 36.5%. However, the technology still needs to use corn steep liquor, urea, a variety of inorganic salts and other complex culture medium to culture cells, affecting the extraction and purification of the product.

[0007] The main problem of the prior art is that the fermentation medium has complex components, resulting in a complex L-glutamine extraction process, low product yield, and excessive impurities such as endotoxins and metal ions, and the product does not meet the requirements of cell culture. In order to solve the problems of the prior art, the present invention provides a method for preparing L-glutamine by enzyme catalysis and separating and purifying L-glutamine for cell culture from an enzyme catalytic liquid. By constructing a recombinant Escherichia coli to express glutamine synthase from Lactobacillus bulgaricus and polyphosphokinase from Deinococcusgeothermalis, L-glutamate and a very small amount of ATP are catalyzed to efficiently synthesize L-glutamine, and the yield is higher than that of the prior art. Due to the high reaction temperature, the occurrence of side reactions is greatly suppressed, and the product can reach the cell culture grade standard through simple separation and purification steps. Summary of the invention

[0008] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a production method and application of L-glutamine for cell culture.

[0009] The technical solution adopted by the present invention to solve its technical problem is:

[0010] A method for producing L-glutamine for cell culture comprises the following steps:

[0011] Firstly, the glutaminase genes glsA and glsB in Escherichia coli BL21 (ACCC11171) were knocked out to reduce the degradation of the product L-glutamine. Secondly, a recombinant strain plasmid was constructed to overexpress the glutamine synthase gene glnA from Lactobacillus bulgaricus and the polyphosphate kinase gene ppk from Deinococcus geothermalis. Glutamine synthase catalyzes the formation of L-glutamine from L-glutamate, ATP and ammonium salt, and polyphosphate kinase catalyzes the regeneration of ATP. Then, the recombinant strain was cultured to induce enzyme production, and an enzyme reaction system was configured to catalyze the synthesis of L-glutamine. Finally, cell culture-grade L-glutamine was separated and purified from the enzyme reaction solution.

[0012] Furthermore, the gene sequence of the glutaminase gene glsA is SEQ ID NO.1, the gene sequence of the glutaminase gene glsB is SEQ ID NO.2, the gene sequence of the glutamine synthase gene glnA is SEQ ID NO.3, and the gene sequence of the polyphosphate kinase gene pppk is SEQ ID NO.4.

[0013] Furthermore, the specific steps are as follows:

[0014] (1) Knockout the glutaminase genes glsA and glsB in Escherichia coli BL21 (ACCC11171) to obtain the recombinant strain E. coli gln1;

[0015] (2) constructing a recombinant plasmid petDuet-glnA-ppk containing the glutamine synthase gene glnA from Lactobacillus bulgaricus and the polyphosphate kinase gene ppk from Deinococcus geothermalis, and electroporating the recombinant plasmid into the E. coli gln1 strain to obtain the recombinant strain E. coli gln2;

[0016] (3) culturing the recombinant strain E. coli gln2, inducing the production of glutamine synthase and polyphosphate kinase, and obtaining the recombinant strain E. coli gln2 having glutamine synthase and polyphosphate kinase activities;

[0017] (4) disrupting the cells of the recombinant strain E. coli gln2 having glutamine synthase and polyphosphate kinase activity obtained by culturing in step (3) to obtain disrupted bacteria;

[0018] (5) mixing the disrupted bacterial cells in step (4) with L-glutamic acid, ATP, sodium hexametaphosphate and magnesium sulfate, and reacting them under reaction conditions of pH 7.0 and 45° C. to synthesize L-glutamine, thereby obtaining an enzyme reaction solution;

[0019] (6) filtering the enzyme reaction solution in step (5) through a ceramic membrane to remove bacterial fragments and macromolecular proteins; then filtering through an ultrafiltration membrane to remove small molecular proteins and pigments; and finally filtering through a nanofiltration membrane to remove ATP, ADP, sodium hexametaphosphate and pigments to obtain a nanofiltration clear solution;

[0020] (7) subjecting the nanofiltration supernatant in step (6) to electrodialysis to separate L-glutamic acid, magnesium sulfate and L-glutamine, thereby obtaining an electrodialysis treated solution;

[0021] (8) concentrating the electrodialysis treatment solution in step (7), adding ethanol to cool and crystallize, and centrifuging to obtain crude L-glutamine wet crystals;

[0022] (9) Adding ethanol / water solution to the wet crystals of crude L-glutamine in step (8) for slurry washing, and centrifuging to obtain purified L-glutamine.

[0023] Furthermore, in the step (1), the glutaminase gene glsA is derived from Escherichia coli BL21 (ACCC11171), and the nucleotide sequence is shown in the sequence listing SEQ ID NO.1; the glutaminase gene glsB is derived from Escherichia coli BL21 (ACCC11171), and the nucleotide sequence is shown in the sequence listing SEQ ID NO.2;

[0024] Alternatively, in the step (2), the glutamine synthase gene glnA is derived from Lactobacillus bulgaricus, and the nucleotide sequence is shown in the sequence listing SEQ ID NO.3; the polyphosphate kinase gene ppk is derived from Deinococcusgeothermalis, and the nucleotide sequence is shown in the sequence listing SEQ ID NO.4; the recombinant plasmid petDuet is a commercial plasmid, and the nucleotide sequence is shown in the sequence listing SEQ ID NO.5.

[0025] Furthermore, the specific cultivation steps for culturing the recombinant strain E. coli gln2 in step (3) are:

[0026] ① Test tube slant culture: Use an inoculation loop to pick 3-4 loops of the recombinant strain E. coli gln2 from the glycerol tube and streak it onto LB solid medium with 100 mg / L ampicillin resistance, culture it in a 37°C incubator for 10-14 hours, and transfer it to the first generation;

[0027] ② Eggplant-shaped flask slant culture: Use an inoculation loop to pick all the bacteria from the slant of the test tube and streak them into LB solid medium with 100 mg / L ampicillin resistance, culture in a 37°C incubator for 10-14 hours, and transfer for the second generation;

[0028] ③ Fermentation tank culture: All the bacteria in the eggplant-shaped flask slope were inoculated into LB liquid culture medium with 100 mg / L ampicillin resistance; the fermentation tank filling factor was 60%, the ventilation volume was 2 L / min, the dissolved oxygen was controlled at 20% to 40% (0% dissolved oxygen was defined as the dissolved oxygen in a saturated sodium sulfite solution with a small amount of copper sulfate added, and 100% dissolved oxygen was defined as the dissolved oxygen in still air), the pH was controlled at 7.0 by automatic flow addition of ammonia water, and the culture temperature was 37°C; culture was continued until OD 600 =12-14, add IPTG (isopropyl-β-D-thiogalactoside) with a final concentration of 0.1 mM to induce the expression of the target protein, the induction temperature is 25°C, the induction culture is carried out for 8 h, and the bacteria are collected by centrifugation at 8000 r / min for 15 min.

[0029] Furthermore, the cell disruption method in step (4) is ultrasonic disruption, freeze-thaw disruption, liquid nitrogen grinding disruption or high-pressure homogenization disruption. The present invention prefers high-pressure homogenization disruption, and the disruption conditions are: 4°C, 800-1000 bar.

[0030] Alternatively, in step (5), the concentration of L-glutamic acid is 640-655 mM, the concentration of ATP is 32-35 mM, the concentration of sodium hexametaphosphate is 65-70 mM, the concentration of magnesium sulfate is 65-70 mM, and the amount of crude enzyme solution, i.e., the broken bacterial cells, added is 40-60 g / L.

[0031] Furthermore, in step (6), the molecular weight cutoff of the ceramic membrane is 50 kD, the molecular weight cutoff of the ultrafiltration membrane is 3000D-6000D, and the molecular weight cutoff of the nanofiltration membrane is 300D-500D, all of which are made of polyethersulfone, the temperature is controlled not to exceed 35°C, and the working pressure is 0.5-1.0 MPa;

[0032] Alternatively, the electrodialysis in step (7) is bipolar membrane electrodialysis, and L-glutamic acid and L-glutamine are detected by PITC pre-column derivatization method, and the electrodialysis treatment is terminated when the content of L-glutamic acid in the concentration pool drops below 0.5 g / L.

[0033] Furthermore, the crystallization conditions of ethanol in step (8) are as follows: the electrodialysis solution is concentrated to 110-120 g / L, 95% ethanol is added in an amount of 1-2 times the volume of the concentrated solution, and the temperature is lowered to 5-10°C.

[0034] Alternatively, the slurry washing conditions of the ethanol / water solution in step (9) are: the volume concentration of the ethanol water solution is 75-90%, and the amount of the ethanol water solution added is 2-3 times the weight of the crude L-glutamine.

[0035] Application of the production method as described above in the production of L-glutamine for cell culture.

[0036] The advantages and positive effects achieved by the present invention are:

[0037] 1. The glutamine synthase from Lactobacillus bulgaricus screened in the method of the present invention can efficiently catalyze the conversion of L-glutamate to L-glutamine, and the maximum yield of L-glutamine can reach 590 mM (86 g / L), with a molar conversion rate of 90%.

[0038] 2. The polyphosphate kinase from Deinococcus geothermalis screened in the method of the present invention has a high enzyme activity under the reaction conditions of pH 7.0 and 45° C., and can be effectively coupled with glutamine synthase to achieve the cyclic regeneration of ATP. The amount of ATP used in the reaction is saved by 95%, effectively reducing the catalytic cost.

[0039] 3. In the method of the present invention, by knocking out the glutaminase of the host strain, the degradation of L-glutamine in the catalytic reaction is reduced, and the enzyme catalytic efficiency is improved. In addition, due to the high reaction temperature, the occurrence of side reactions is greatly suppressed, and the product can reach the cell culture grade standard through a simple separation and purification step.

[0040] 4. The separation and purification process of L-glutamine developed in the method of the present invention is simple, does not require the use of traditional separation methods such as ion exchange resins and activated carbon, avoids the use of acids and alkalis, and has a single extraction yield of 87.4%, a purity of 99.50%, and an endotoxin level of <1EU / ml. It has been verified through cell culture experiments that the products in the comparative documents are food grade or industrial grade products, and do not reflect the cell culture medium grade. The product indicators of the present invention can be benchmarked against Sigma's L-glutamine products for cell culture. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 is a production process flow chart of L-glutamine in the present invention;

[0042] Figure 2 Schematic diagram of the enzyme catalyzed reaction in the present invention;

[0043] Figure 3 It is the high performance liquid chromatogram of L-glutamine in the present invention. DETAILED DESCRIPTION

[0044] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0045] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0046] A method for producing L-glutamine for cell culture comprises the following steps:

[0047] Firstly, the glutaminase genes glsA and glsB in Escherichia coli BL21 (ACCC11171) were knocked out to reduce the degradation of the product L-glutamine. Secondly, a recombinant strain plasmid was constructed to overexpress the glutamine synthase gene glnA from Lactobacillus bulgaricus and the polyphosphate kinase gene ppk from Deinococcus geothermalis. Glutamine synthase catalyzes the formation of L-glutamine from L-glutamate, ATP and ammonium salt, and polyphosphate kinase catalyzes the regeneration of ATP. Then, the recombinant strain was cultured to induce enzyme production, and an enzyme reaction system was configured to catalyze the synthesis of L-glutamine. Finally, cell culture-grade L-glutamine was separated and purified from the enzyme reaction solution.

[0048] Preferably, the gene sequence of the glutaminase gene glsA is SEQ ID NO.1, the gene sequence of the glutaminase gene glsB is SEQ ID NO.2, the gene sequence of the glutamine synthase gene glnA is SEQ ID NO.3, and the gene sequence of the polyphosphate kinase gene pppk is SEQ ID NO.4.

[0049] Preferably, the specific steps are as follows:

[0050] (1) Knockout the glutaminase genes glsA and glsB in Escherichia coli BL21 (ACCC11171) to obtain the recombinant strain E. coli gln1;

[0051] (2) constructing a recombinant plasmid petDuet-glnA-ppk containing the glutamine synthase gene glnA from Lactobacillus bulgaricus and the polyphosphate kinase gene ppk from Deinococcus geothermalis, and electroporating the recombinant plasmid into the E. coli gln1 strain to obtain the recombinant strain E. coli gln2;

[0052] (3) culturing the recombinant strain E. coli gln2, inducing the production of glutamine synthase and polyphosphate kinase, and obtaining the recombinant strain E. coli gln2 having glutamine synthase and polyphosphate kinase activities;

[0053] (4) disrupting the cells of the recombinant strain E. coli gln2 having glutamine synthase and polyphosphate kinase activity obtained by culturing in step (3) to obtain disrupted bacteria;

[0054] (5) mixing the disrupted bacterial cells in step (4) with L-glutamic acid, ATP, sodium hexametaphosphate and magnesium sulfate, and reacting them under reaction conditions of pH 7.0 and 45° C. to synthesize L-glutamine, thereby obtaining an enzyme reaction solution;

[0055] (6) filtering the enzyme reaction solution in step (5) through a ceramic membrane to remove bacterial fragments and macromolecular proteins; then filtering through an ultrafiltration membrane to remove small molecular proteins and pigments; and finally filtering through a nanofiltration membrane to remove ATP, ADP, sodium hexametaphosphate and pigments to obtain a nanofiltration clear solution;

[0056] (7) subjecting the nanofiltration supernatant in step (6) to electrodialysis to separate L-glutamic acid, magnesium sulfate and L-glutamine, thereby obtaining an electrodialysis treated solution;

[0057] (8) concentrating the electrodialysis treatment solution in step (7), adding ethanol to cool and crystallize, and centrifuging to obtain crude L-glutamine wet crystals;

[0058] (9) Adding ethanol / water solution to the wet crystals of crude L-glutamine in step (8) for slurry washing, and centrifuging to obtain purified L-glutamine.

[0059] Preferably, in step (1), the glutaminase gene glsA is derived from Escherichia coli BL21 (ACCC11171), and the nucleotide sequence is shown in the sequence listing SEQ ID NO.1; the glutaminase gene glsB is derived from Escherichia coli BL21 (ACCC11171), and the nucleotide sequence is shown in the sequence listing SEQ ID NO.2;

[0060] Alternatively, in the step (2), the glutamine synthase gene glnA is derived from Lactobacillus bulgaricus, and the nucleotide sequence is shown in the sequence listing SEQ ID NO.3; the polyphosphate kinase gene ppk is derived from Deinococcusgeothermalis, and the nucleotide sequence is shown in the sequence listing SEQ ID NO.4; the recombinant plasmid petDuet is a commercial plasmid, and the nucleotide sequence is shown in the sequence listing SEQ ID NO.5.

[0061] Preferably, the specific cultivation steps for culturing the recombinant strain E. coli gln2 in step (3) are:

[0062] ① Test tube slant culture: Use an inoculation loop to pick 3-4 loops of the recombinant strain E. coli gln2 from the glycerol tube and streak it onto LB solid medium with 100 mg / L ampicillin resistance, culture it in a 37°C incubator for 10-14 hours, and transfer it to the first generation;

[0063] ② Eggplant-shaped flask slant culture: Use an inoculation loop to pick all the bacteria from the slant of the test tube and streak them into LB solid medium with 100 mg / L ampicillin resistance, culture in a 37°C incubator for 10-14 hours, and transfer for the second generation;

[0064] ③ Fermentation tank culture: All the bacteria in the eggplant-shaped flask slope were inoculated into LB liquid culture medium with 100 mg / L ampicillin resistance; the fermentation tank filling factor was 60%, the ventilation volume was 2 L / min, the dissolved oxygen was controlled at 20% to 40% (0% dissolved oxygen was defined as the dissolved oxygen in a saturated sodium sulfite solution with a small amount of copper sulfate added, and 100% dissolved oxygen was defined as the dissolved oxygen in still air), the pH was controlled at 7.0 by automatic flow addition of ammonia water, and the culture temperature was 37°C; culture was continued until OD 600 =12-14, add IPTG (isopropyl-β-D-thiogalactoside) with a final concentration of 0.1 mM to induce the expression of the target protein, the induction temperature is 25°C, the induction culture is carried out for 8 h, and the bacteria are collected by centrifugation at 8000 r / min for 15 min.

[0065] Preferably, the cell disruption method in step (4) is ultrasonic disruption, freeze-thaw disruption, liquid nitrogen grinding disruption or high-pressure homogenization disruption. The present invention prefers high-pressure homogenization disruption, and the disruption conditions are: 4°C, 800-1000 bar.

[0066] Alternatively, in step (5), the concentration of L-glutamic acid is 640-655 mM, the concentration of ATP is 32-35 mM, the concentration of sodium hexametaphosphate is 65-70 mM, the concentration of magnesium sulfate is 65-70 mM, and the amount of crude enzyme solution, i.e., the broken bacterial cells, added is 40-60 g / L.

[0067] Preferably, in step (6), the molecular weight cutoff of the ceramic membrane is 50 kD, the molecular weight cutoff of the ultrafiltration membrane is 3000D-6000D, and the molecular weight cutoff of the nanofiltration membrane is 300D-500D, all of which are made of polyethersulfone, the temperature is controlled not to exceed 35°C, and the working pressure is 0.5-1.0 MPa;

[0068] Alternatively, the electrodialysis in step (7) is bipolar membrane electrodialysis, and L-glutamic acid and L-glutamine are detected by PITC pre-column derivatization method, and the electrodialysis treatment is terminated when the content of L-glutamic acid in the concentration pool drops below 0.5 g / L.

[0069] Preferably, the crystallization conditions of ethanol in step (8) are as follows: concentrating the electrodialysis solution to 110-120 g / L, adding 95% ethanol in an amount of 1-2 times the volume of the concentrated solution, and cooling the solution to 5-10°C.

[0070] Alternatively, the slurry washing conditions of the ethanol / water solution in step (9) are: the volume concentration of the ethanol water solution is 75-90%, and the amount of the ethanol water solution added is 2-3 times the weight of the crude L-glutamine.

[0071] Application of the production method as described above in the production of L-glutamine for cell culture.

[0072] Specifically, the relevant preparation and detection are as follows:

[0073] Example 1 Construction of recombinant strain E. coli gln1

[0074] 1.1 Knockout of glsA gene

[0075] According to the upstream and downstream sequences of the glsA gene, upstream homology arm primers UP-glsA-S (SEQ ID NO.6) and UP-glsA-A (SEQ ID NO.7) and downstream homology arm primers DN-glsA-S (SEQ ID NO.8) and DN-glsA-A (SEQ ID NO.9) were designed, and the genome of the strain Escherichia coli BL21 (ACCC11171) was used as a template to amplify the upstream and downstream homology arms by PCR technology, and the knockout fragment of the gene (upstream homology arm-downstream homology arm) was obtained by the recombinant PCR method. A DNA fragment containing the target sequence of the target gene was obtained by annealing primers gRNA-glsA-S (SEQ ID NO.10) and gRNA-glsA-A (SEQ ID NO.11), and recombined with a linearized pGRB vector to obtain a recombinant pGRB-glsA. The integrated fragment and pGRB-glsA were electroporated into E. coli competent cells containing the pREDCas9 plasmid, and single colonies were obtained by resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-glsA used for gene editing was eliminated to obtain the recombinant strain E. coli gln1.

[0076] 1.2 Knockout of glsB gene

[0077] According to the upstream and downstream sequences of the glsB gene, upstream homology arm primers UP-glsB-S (SEQ ID NO.12), UP-glsB-A (SEQ ID NO.13) and downstream homology arm primers DN-glsB-S (SEQ ID NO.14), DN-glsB-A (SEQ ID NO.15) were designed, and the genome of the strain Escherichia coli BL21 (ACCC11171) was used as a template to amplify the upstream and downstream homology arms by PCR technology, and the knockout fragment of the gene (upstream homology arm-downstream homology arm) was obtained by the recombinant PCR method. The DNA fragment containing the target sequence of the target gene was obtained by annealing primers gRNA-glsB-S (SEQ ID NO.16) and gRNA-glsB-A (SEQ ID NO.17), and the recombinant pGRB-glsB was obtained after recombination with the linearized pGRB vector. The integrated fragment and pGRB-glsB were electroporated into E. coli competent cells containing the pREDCas9 plasmid, and single colonies were obtained by resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-glsB used for gene editing was eliminated.

[0078] Example 2 Construction of recombinant strain E. coli gln2

[0079] ① Artificially synthesize the glutamine synthase gene glnA (SEQ ID NO.3) from Lactobacillus bulgaricus and the polyphosphate kinase gene ppk (SEQ ID NO.4) from Deinococcusgeothermalis.

[0080] ②Use Takara restriction endonucleases EcoR I and HindIII to perform double digestion steps to cut the plasmid petDuet and linearize the petDuet vector plasmid (SEQ ID NO.5). Design primers based on the upstream and downstream sequences of the glnA gene and the restriction sites of the plasmid petDuet. The upstream homology arm primer is UP-glnA-S (SEQ ID NO.18) and the downstream homology arm primer is DN-glnA-A (SEQ ID NO.19). Obtain gene fragments by PCR, and then use the obtained petDuet linear fragment and glnA target gene fragment to use Vazyme produced Ⅱ recombinase performs homologous recombination on the plasmid and target fragment after enzyme digestion, and finally obtains the recombinant expression plasmid petDuet-glnA.

[0081] ③Use Takara restriction endonucleases EcoR RV and Kpn I to cut plasmid petDuet-glnA to linearize plasmid petDuet-glnA. Design primers based on the upstream and downstream gene sequences of the plk gene and the restriction sites of plasmid petDuet-glnA. The upstream homology arm primer is UP-ppk-S (SEQ ID NO.20), and the downstream homology arm primer is DN-ppk-A (SEQ ID NO.21). Obtain gene fragments by PCR, and then use the obtained petDuet-glnA vector and the ppk target gene fragment to use the Vazyme produced II recombinase connects the ppk gene fragment in the above step and the petDuet-glnA linear vector to finally obtain the recombinant expression vector petDuet-glnA-ppk.

[0082] ④ The recombinant expression vector in step ③ is transformed into E. coli gln1 to obtain a recombinant strain E. coli gln2 having glutamine synthase / polyphosphate kinase activity.

[0083] Example 3 Fermentation of recombinant strain E. coli gln2 to produce enzymes and prepare crude enzyme solution

[0084] ① Test tube slant culture: Use an inoculation loop to pick 3-4 loops of strain E. coli DR from the glycerol culture tube and streak it onto LB solid medium with 100 mg / L ampicillin resistance, culture it in a 37℃ incubator for 10-14 hours, and transfer it to the first generation.

[0085] ② Eggplant-shaped flask slant culture: Use an inoculation loop to pick up all the bacteria from the slant of the test tube and streak inoculate them onto LB solid medium with 100 mg / L ampicillin resistance, culture in a 37°C incubator for 10-14 hours, and transfer for the second generation.

[0086] ③ Fermentation tank culture: All bacteria in the eggplant-shaped flask slope are inoculated into LB liquid culture medium with 100 mg / L ampicillin resistance. The fermentation tank filling factor is 60%, the ventilation volume is 2L / min, the dissolved oxygen is controlled at 20% to 40% (0% dissolved oxygen is defined as the dissolved oxygen in a saturated sodium sulfite solution with a small amount of copper sulfate added, and 100% dissolved oxygen is defined as the dissolved oxygen in still air). The pH is controlled at 7.0 by automatic flow addition of ammonia water, and the culture temperature is 37°C. Culture until OD 600 =12-14, add IPTG (isopropyl-β-D-thiogalactoside) with a final concentration of 0.1 mM to induce the expression of the target protein, the induction temperature is 25°C, the induction culture is carried out for 8 h, and the bacteria are collected by centrifugation at 8000 r / min for 15 min.

[0087] ④ Preparation of crude enzyme solution: Resuspend the bacteria in 9g / L physiological saline to a concentration of 65g / L. After uniform resuspension, perform high-pressure homogenization to disrupt the cells. The disruption conditions are: 4°C, 1000bar. The disruption solution is the crude enzyme solution.

[0088] Example 4 Enzymatic Synthesis of L-Glutamine

[0089] The reaction system was prepared with 50 g / L crude enzyme solution, 655 mM L-glutamic acid, 35 mM ATP, 70 mM sodium hexametaphosphate, 70 mM magnesium sulfate, and the rest water. During the reaction, ammonia water was used to control the pH value to 7.0, the reaction temperature was 45 °C, and the reaction time was 6 h. Figure 3 As shown), the L-glutamine yield was 590 mM, the remaining amount of L-glutamic acid was 65 mM, and the molar conversion rate of L-glutamic acid to L-glutamine was 90%.

[0090] Table 1 High performance liquid chromatography with a wavelength of 210 nm

[0091]

[0092] Example 5 Isolation and Purification of L-Glutamine

[0093] The L-glutamine content in the reaction solution is 86 g / L (590 mM), the L-glutamic acid content is 9.6 g / L (65 mM), and the volume is 2200 L. The filtration area is 2m 2 , 50kD molecular weight cut-off ceramic membrane filtration, and then 4000D molecular weight cut-off ultrafiltration membrane filtration, temperature 35°C, volume 2400L, L-glutamine content 78g / L, L-glutamic acid content 8.6g / L. Ultrafiltrate was filtered by 400D molecular weight cut-off nanofiltration, pressure 0.8MPa, nanofiltrate was treated by bipolar membrane electrodialysis, current density 33A / m 2 , until the L-glutamic acid content dropped to 0.35g / L, the treated liquid was vacuum concentrated at 50℃ to an L-glutamine concentration of 110g / L, 1.5 times the volume of 95% ethanol was added at a uniform rate, the temperature was lowered to 5℃, stirring was maintained for 2h, and 225kg of crude wet crystals were collected by centrifugation. The crude wet crystals were added with 3 times the weight of 75% ethanol for slurry washing at room temperature, and the wet crystals were collected by centrifugation again and dried to obtain 165.4kg of fine products, the content of which was 99.5% after detection, and the yield was 87.4%.

[0094] Comparative Example 1 (CN111187178A)

[0095] Take the fermentation liquid of glutamine workshop (the concentration of glutamine in glutamine fermentation liquid is 85g / L), and obtain 10L of refined clear liquid after pretreatment, with a glutamine content of 40g / L. Take 5L of refined clear liquid, adjust the pH of the refined clear liquid to 5.5 with sodium hydroxide, dilute to 30g / L, take 1L of clear liquid as the base material, add 1g of sucrose ester while evaporating (temperature is 50℃, vacuum degree is 0.09Mpa), add 29g of seed crystals (the mass volume ratio of glutamine seed crystals to evaporated concentrated liquid is 0.8:1.0) when concentrated to 55g / L, continue evaporation (temperature is 50℃, vacuum degree is 0.09Mpa) to crystallize, add 200mL of water to eliminate crystals when spontaneous nucleation occurs (so that the final concentration is 350g / L of glutamine content), concentrate 10 times and put into the tank. The crystallization liquid was cooled by gradient at 5°C per hour. When the temperature reached 5°C, it was centrifuged in a bag centrifuge (speed was 1000 r / min, time was 20 min). After separation and drying (temperature was 40°C, time was 360 min), 170 g of dry product was obtained, with a one-time yield of 85%.

[0096] Comparative Example 2 (CN108997159A)

[0097] Take 100L of fermentation broth, the fermentation broth produces 93g / L of acid, use 300kDa ceramic membrane microfiltration, the temperature is 38℃, the transmembrane pressure difference is 2.0bar, concentrate 7 times, obtain filtrate and dialyzate, concentrate and crystallize to the mass percentage of glutamine is 20%; cool to 7℃, pre-crystallize for 12h, separate and obtain crude L-glutamine, crude product 11.5kg, crude product water 35%. Add deionized water, prepare 185L crude product solution of 4.0% L-glutamine at 35-40℃, add 720g medicinal carbon decolorization, stir for 30min, filter to obtain decolorized clear night, the decolorized liquid is concentrated and crystallized, and the evaporation temperature is ≤40℃, and the mass percentage of glutamine is 35%; cool 10℃ to 8℃ per hour for separation, and dry the wet product to obtain 60.6kg of L-glutamine finished product. The first yield of L-glutamine is 68.3%, and the liquid content of the finished product is 98.6%.

[0098] Compared with the comparative example, this example has advantages in primary yield and purity, as shown in Table 2:

[0099] Table 2

[0100] Example 5 Comparative Example 1 Comparative Example 2 One-time yield 87.4％ 85％ 68.3％ purity 99.5％ 99.5％ 98.6％

[0101] Comparative Examples 1 and 2 are conventional production methods. In the production process of Comparative Example 1, the crystallizer sucrose ester is added, which may have a residual risk. Comparative Example 2 uses activated carbon. The metal residues in carbon production will be brought into the product, causing the metal elements to exceed the standard. The trace crystallizer and metal element residues have little effect on the food grade and industrial grade, but are not suitable for the high requirements of the culture medium grade. Example 5 does not need to use traditional separation methods such as ion exchange resins and activated carbon, avoids the use of acids and alkalis, and has less three wastes. Combined with the previous enzyme conversion production process, the product quality meets the strict requirements of the culture medium grade.

[0102] According to the quality standard of glutamine Sigma medium (G8540-BULK), the finished product of Example 5 was tested. The relevant testing methods are well known in the art. The relevant test results are shown in Table 3.

[0103] Table 3

[0104] project index Test results source Non-animal origin conform to Infrared spectrum Consistent with the reference conform to Optical rotation (10 in 2 M HCl at 20℃) +31.5°-+33° +32.2° chloride ≤0.02％ ＜0.02％ Ammonium salt ≤0.10％ ＜0.10％ Sulfate ≤0.02％ ＜0.02％ Iron ≤10ppm <10ppm Arsenic salts ≤1ppm <1ppm Loss on drying ≤0.30％ 0.15％ Ignition residue ≤0.10％ 0.05％ Ninhydrin positive substances Color conform to <![CDATA[pH(2%in H2O)]]> 4.5-6.0 5.4 Content (dry basis) 99.0％-101.0％ 99.50％ Solvent residue Meet the requirements conform to Endotoxin (30mg / ml) ≤1EU / ml <1EU / ml Cell culture assay pass pass Appearance White powder White powder Solution color colorless conform to Solution clarity (25mg / ml in H2O) clarify conform to

[0105] As can be seen from Table 3, the relevant detection indicators of L-glutamine prepared in the present invention meet the quality standard of glutamine Sigma culture medium (G8540-BULK SIGMA standard).

[0106] There is no report on the production process of glutamine suitable for cell culture in the existing published literature.

[0107] The sequences used in the present invention are as follows:

[0108] SEQ ID NO.1: glsA

[0109] ATGTTAGATGCAAACAAATTACAGCAGGCAGTGGATCAGGCTTACACCCAATTTCA

[0110] CTCACTTAACGGCGGACAAAATGCCGATTACATTCCCTTTCTGGCGAATGTACCAGGTCAACTGGCGGCAGTGGCTATCGTGACCTGCGATGGCAACGTCTATAGTGCGGGTGACAGTGATTACCGCTTTGCACTGGAATCCATCTCGAAAGTCTGTACGTTAGCCCTTGCGTTAGAAGATGTCGGCCCGCAGGCGGTACAGGACAAAATTGGCGCTGACCCGACCGGATTGCCCTTTAACTCAGTTATCGCCTTAGAGTTGCATGGCGGCAAACCGCTTTCGCCACTGGTAAATGCTGGCGCTATTGCCACCACCAGCCTGATTAACGCTGAAAATGTTGAACAACGCTGGCAGCGAATTTTACATATCCAACAGCAACTGGCTGGCGAGCAGGTAGCGCTCTCTGACGAAGTCAACCAGTCGGAACAAACAACCAACTTCCATAACCGGGCCATAGCCTGGCTGCTGTACTCCGCCGGATATCTCTATTGTGATGCAATGGAAGCCTGTGACGTGTATACCCGTCAGTGCTCCACGCTCCTCAATACTATTGAACTGGCAACGCTTGGCGCGACGCTGGCGGCAGGTGGTGTGAATCCGTTGACGCATAAACGCGTTCTTCAGGCCGACAACGTGCCGTACATTCTGGCCGAAATGATGATGGAAGGGCTGTATGGTCGCTCCGGTGACTGGGCGTATCGTGTTGGTTTACCGGGCAAAAGCGGTGTAGGTGGCGGTATTCTGGCGGTCGTCCCTGGAGTGATGGGAATTGCCGCGTTCTCACCACCGCTGGACGAAGATGGCAACAGTGTTCGCGGTCAAAAAATGGTGGCATCGGTCGCTAAGCAACTCGGCTATAACGTGTTTAAGGGCTGA

[0111] SEQ ID NO.2:glsB

[0112] GTGGCAGTCGCCATGGATAATGCAATTTTAGAAAACATCTTGCGGCAAGTGCGGCCGCTCATTGGTCAGGGTAAAGTCGCGGATTATATTCCGGCGCTGGCTACAGTAGACGGTTCCCGATTGGGGATTGCTATCTGTACCGTTGACGGACAGCTTTTTCAGGCCGGAGACGCGCAAGAACGTTTTTCCATTCAGTCTATTTCCAAAGTGCTGAGTCTCGTTGTCGCCATGCGTCATTACTCCGAAGAGGAAATCTGGCAACGCGTCGGCAAAGATCCGTCTGGATCACCGTTCAATTCCTTAGTGCAACTGGAAATGGAGCAGGGTATACCGCGTAATCCGTTCATTAATGCCGGTGCGCTGGTGGTCTGCGATATGTTGCAAGGGCGATTAAGCGCACCACGGCAACGTATGCTGGAAGTCGTGCGCGGCTTAAGCGGTGTGTCTGATATTTCCTACGATACGGTGGTAGCGCGTTCCGAATTTGAACATTCCTCGCGAAATGCGGCTATCGCCTGGCTGATGAAGTCGTTTGGCAATTTCCATCATGACGTGACAACCGTTCTGCAAAACTACTTTCATTACTGCGCTCTGAAAATGAGCTGTGTAGAGCTGGCCCGGACGTTTGTCTTTCTGGCTAATCAGGGGAAAGCTATTCATATTGATGAACCAGTGGTGACGCCAATGCAGGCGCGGCAAATTAACGCGCTGATGGCGACCAGTGGTATGTACCAGAACGCGGGGGAGTTTGCCTGGCGGGTGGGGCTACCGGCGAAATCTGGCGTTGGTGGCGGTATTGTGGCGATTGTTCCGCATGAAATGGCCATCGCTGTCTGGAGTCCGGAACTGGATGATGCAGGTAACTCGCTTGCGGGTATTGCCGTCCTTGAACAATTGACGAAACAGTTAGGGCGTTCGGTTTATTAA

[0113] SEQ ID NO.3:glnA

[0114]

[0115] SEQ ID NO.5: Plasmid petDuet

[0116]

[0117] The primers used in the strain construction process are as follows:

[0118]

[0119]

[0120] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A method for producing L-glutamine for cell culture, characterized in that: The steps include: Firstly, the glutaminase genes glsA and glsB in Escherichia coli BL21 (ACCC11171) were knocked out to reduce the degradation of the product L-glutamine. Secondly, a recombinant strain plasmid was constructed to overexpress the glutamine synthase gene glnA from Lactobacillus bulgaricus and the polyphosphate kinase gene ppk from Deinococcus geothermalis. Glutamine synthase catalyzes the formation of L-glutamine from L-glutamate, ATP and ammonium salt, and polyphosphate kinase catalyzes the regeneration of ATP. Then, the recombinant strain was cultured to induce enzyme production, and the enzyme reaction system was configured to catalyze the synthesis of L-glutamine. Finally, cell culture-grade L-glutamine was separated and purified from the enzyme reaction solution.

2. The production method according to claim 1, characterized in that: The gene sequence of the glutaminase gene glsA is SEQ ID NO.1, the gene sequence of the glutaminase gene glsB is SEQ ID NO.2, the gene sequence of the glutamine synthase gene glnA is SEQ ID NO.3, and the gene sequence of the polyphosphate kinase gene pppk is SEQ ID NO.

4.

3. The production method according to claim 1, characterized in that: The specific steps are as follows: (1) Knockout the glutaminase genes glsA and glsB in Escherichia coli BL21 (ACCC11171) to obtain the recombinant strain E. coli gln1; (2) constructing a recombinant plasmid petDuet-glnA-ppk containing the glutamine synthase gene glnA from Lactobacillus bulgaricus and the polyphosphate kinase gene ppk from Deinococcus geothermalis, and electroporating the recombinant plasmid into the E. coli gln1 strain to obtain the recombinant strain E. coli gln2; (3) culturing the recombinant strain E. coli gln2, inducing the production of glutamine synthase and polyphosphate kinase, and obtaining the recombinant strain E. coli gln2 having glutamine synthase and polyphosphate kinase activities; (4) disrupting the cells of the recombinant strain E. coligln2 having glutamine synthase and polyphosphate kinase activity obtained by culturing in step (3) to obtain disrupted bacteria; (5) mixing the disrupted bacterial cells in step (4) with L-glutamic acid, ATP, sodium hexametaphosphate and magnesium sulfate, and reacting them under reaction conditions of pH 7.0 and 45° C. to synthesize L-glutamine, thereby obtaining an enzyme reaction solution; (6) filtering the enzyme reaction solution in step (5) through a ceramic membrane to remove bacterial fragments and macromolecular proteins; then filtering through an ultrafiltration membrane to remove small molecular proteins and pigments; and finally filtering through a nanofiltration membrane to remove ATP, ADP, sodium hexametaphosphate and pigments to obtain a nanofiltration clear solution; (7) subjecting the nanofiltration supernatant in step (6) to electrodialysis to separate L-glutamic acid, magnesium sulfate and L-glutamine, thereby obtaining an electrodialysis treated solution; (8) concentrating the electrodialysis treatment solution in step (7), adding ethanol to cool and crystallize, and centrifuging to obtain crude L-glutamine wet crystals; (9) Adding ethanol / water solution to the wet crystals of crude L-glutamine in step (8) for slurry washing, and centrifuging to obtain purified L-glutamine.

4. The production method according to claim 3, characterized in that: In the step (1), the glutaminase gene glsA is derived from Escherichia coli BL21 (ACCC11171), and the nucleotide sequence is shown in the sequence table SEQ ID NO.1; the glutaminase gene glsB is derived from Escherichia coli BL21 (ACCC11171), and the nucleotide sequence is shown in the sequence table SEQ ID NO.2; Alternatively, in the step (2), the glutamine synthase gene glnA is derived from Lactobacillus bulgaricus, and the nucleotide sequence is shown in the sequence listing SEQ ID NO.3; the polyphosphate kinase gene ppk is derived from Deinococcusgeothermalis, and the nucleotide sequence is shown in the sequence listing SEQ ID NO.4; the recombinant plasmid petDuet is a commercial plasmid, and the nucleotide sequence is shown in the sequence listing SEQ ID NO.

5.

5. The production method according to claim 3, characterized in that: The specific cultivation steps for culturing the recombinant strain E.coligln2 in step (3) are: ① Test tube slant culture: Use an inoculation loop to pick 3-4 loops of the recombinant strain E. coli gln2 from the glycerol tube and streak it onto LB solid medium with 100 mg / L ampicillin resistance, culture it in a 37°C incubator for 10-14 hours, and transfer it to the first generation; ② Eggplant-shaped flask slant culture: Use an inoculation loop to pick all the bacteria from the slant of the test tube and streak them into LB solid medium with 100 mg / L ampicillin resistance, culture in a 37°C incubator for 10-14 hours, and transfer for the second generation; ③ Fermentation tank culture: All the bacteria in the slant of the eggplant-shaped flask were inoculated into LB liquid culture medium with 100 mg / L ampicillin resistance; The filling factor of the fermentation tank was 60%, the ventilation volume was 2 L / min, the dissolved oxygen was controlled at 20% to 40%, the pH was controlled at 7.0 by automatic flow addition of ammonia water, and the culture temperature was 37°C; the culture was continued until OD 600 =12-14, add IPTG with a final concentration of 0.1 mM to induce the expression of the target protein, the induction temperature is 25°C, the induction culture is carried out for 8 h, and the bacteria are collected by centrifugation at 8000 r / min for 15 min.

6. The production method according to claim 3, characterized in that: The cell disruption method in step (4) is ultrasonic disruption, freeze-thaw disruption, liquid nitrogen grinding disruption or high-pressure homogenization disruption, and the disruption conditions are: 4°C, 800-1000 bar; Alternatively, in step (5), the concentration of L-glutamic acid is 640-655 mM, the concentration of ATP is 32-35 mM, the concentration of sodium hexametaphosphate is 65-70 mM, the concentration of magnesium sulfate is 65-70 mM, and the amount of broken bacterial cells added is 40-60 g / L.

7. The production method according to claim 3, characterized in that: In step (6), the molecular weight cutoff of the ceramic membrane is 50 kD, the molecular weight cutoff of the ultrafiltration membrane is 3000D-6000D, and the molecular weight cutoff of the nanofiltration membrane is 300D-500D. The materials are all polyethersulfone, the temperature is controlled not to exceed 35°C, and the working pressure is 0.5-1.0 MPa; Alternatively, the electrodialysis in step (7) is bipolar membrane electrodialysis, and L-glutamic acid and L-glutamine are detected by PITC pre-column derivatization method, and the electrodialysis treatment is terminated when the content of L-glutamic acid in the concentration pool drops below 0.5 g / L.

8. The production method according to claim 3, characterized in that: The crystallization conditions of ethanol in step (8) are as follows: the electrodialysate is concentrated to 110-120 g / L, 95% ethanol is added in an amount of 1-2 times the volume of the concentrated solution, and the temperature is lowered to 5-10° C.; Alternatively, the slurry washing conditions of the ethanol / water solution in step (9) are: the volume concentration of the ethanol water solution is 75-90%, and the amount of the ethanol water solution added is 2-3 times the weight of the crude L-glutamine.

9. Use of the production method according to any one of claims 1 to 8 in the production of L-glutamine for cell culture.

Images