Method for producing beta-cyclodextrin through immobilized continuous catalysis

Abstract

The invention relates to a method for preparing beta-cyclodextrin, in particular to a method for producing beta-cyclodextrin through immobilized continuous catalysis. Based on an immobilization technology, catalytic conditions such as time, temperature and pH value are optimized, cyanamide is added in a thallus growth stage, multi-batch immobilized continuous catalytic production of beta-cyclodextrin can be realized under a non-sterilization condition, and high enzyme activity and high product conversion rate are maintained in a continuous reaction process. Experimental results show that when the method is used for multi-batch immobilized catalysis under a non-sterilization condition, the enzyme activity and the product conversion rate both show good stability and repeatability. Compared with a traditional method, the method has the advantages that the operation steps are simplified, the production cost is reduced, the production efficiency and the product quality are improved, and the method has a wide industrial application prospect.

Description

Technical Field

[0001] The invention relates to a method for preparing beta-cyclodextrin, in particular to a method for producing beta-cyclodextrin by immobilized continuous catalysis. Background Art

[0002] β-cyclodextrin is a multifunctional molecule composed of cyclic oligosaccharides. Due to its unique physical and chemical properties, it is widely used in the food, medicine, cosmetics and other industries. For example, β-cyclodextrin can improve the stability and solubility of drugs by forming inclusion complexes, and can also mask the unpleasant odors in food and cosmetics. However, the traditional preparation method of β-cyclodextrin has some disadvantages, such as the enzyme-catalyzed reaction is susceptible to contamination, the enzyme has poor stability, and it is difficult to achieve continuous production.

[0003] In the prior art, the preparation of β-cyclodextrin is mainly carried out by using cyclodextrin glucosyltransferase (CGTase) to catalyze starch hydrolysis. However, CGTase faces the problems of decreased enzyme activity and susceptibility to contamination in practical applications. In addition, the traditional method usually adopts a batch reaction mode, which not only has low production efficiency, but also is difficult to meet the needs of large-scale industrial production. At the same time, in actual production, all operations must be carried out in a sterile environment, and the reagents and culture media used must be sterilized at high temperature, which takes a lot of time and cost.

[0004] Immobilization technology can fix cells and enzymes on a carrier, thereby achieving continuous catalytic reaction and improving production efficiency. How to improve the stability and anti-pollution properties of CGTase and achieve continuous production of β-cyclodextrin has become an important topic of current research. Based on the above background, the present invention proposes a method for immobilized continuous catalytic production of β-cyclodextrin under non-sterile conditions. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a method for producing beta-cyclodextrin by immobilization and continuous catalysis in view of the problems existing in the prior art such as poor enzyme stability and difficulty in continuous production.

[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0007] A method for producing β-cyclodextrin by immobilized continuous catalysis, comprising the following steps:

[0008] Step (1): in a fermentation tank, inoculating a seed liquid of a strain displaying β-cyclodextrin glucosyltransferase on its surface into a fermentation medium containing an immobilized carrier for fermentation, discharging the fermentation liquid after the fermentation is completed, adding an enzymatic reaction liquid for catalytic reaction, and discharging the catalytic reaction liquid when the relative enzyme activity drops below 70%, thereby terminating the first reaction batch;

[0009] Step (2): continue to add the fermentation medium in the fermentation tank in an amount equal to that in step (1) to carry out fermentation, and after the fermentation is completed, discharge the fermentation liquid, add the enzymatic reaction liquid to carry out catalytic reaction, and when the relative enzyme activity drops below 70%, discharge the catalytic reaction liquid, and end the second reaction batch;

[0010] Step (3): repeating step (2), and when the number of catalytic reactions in the reaction batch is ≤ 4 times and the conversion rate of β-cyclodextrin is lower than 35%, the reaction is terminated;

[0011] Wherein, in step (1), during the fermentation, cyanamide is added;

[0012] Wherein, steps (1), (2) and (3) are carried out under non-sterile conditions, that is, production can be carried out directly in an external environment, and materials such as culture medium and reagents do not need to be sterilized at high temperature.

[0013] Among them, in some embodiments of the present invention, the strain displaying β-cyclodextrin glucosyltransferase on the surface is Bacillus subtilis 168Δ9*cah*bslA-cgt.

[0014] Specifically, the Bacillus subtilis 168Δ9*cah*bslA-cgt is constructed by first transforming the plasmid pMA5-cah into the competent cells of Bacillus subtilis 168Δ9 to obtain the strain 168Δ9*cah, and then transforming the plasmid pBE2R-bslA-cgt into the competent cells of the strain 168Δ9*cah.

[0015] The immobilization carrier includes but is not limited to cotton fiber, and any material that can be used for carrier immobilization in the prior art can be used as the immobilization carrier of the present invention.

[0016] Specifically, in some embodiments of the present invention, in order to improve the immobilization efficiency, the cotton fiber surface is chemically modified with 2.5% glutaraldehyde.

[0017] The fermentation medium is a defective MOPS-2 medium, and its specific formula is: 20-40 mM CN2H2, 1-2 mM KH2PO4, 0.4-0.6 mM MgCl2, 0.1-0.5 mM K2SO4, 0.01-0.03 mM FeSO4, 4×10 -4 ~6×10 - 4 mM CaCl2, 40-60mM NaCl, 60-90mM MOPS, 3-6mM Tricine, 0.4-0.6mL / L trace element solution, 40-60mg / L tryptophan, 5-15g / L glucose, pH 6.0-7.5;

[0018] Specifically, the trace element liquid is: 3×10 -4 ~6×10 -4 M H3BO3, 2×10 -5 ~4×10 -5 M CoCl2, 1×10 -5 ~2×10 -5 M CuSO4, 6×10 -5 ~10×10 -5 M MnCl2 and 1×10 -5 ~2×10 -5 M ZnSO4.

[0019] Preferably, the formula of the fermentation medium is: 30mM CN2H2, 1.32mM KH2PO4, 0.523mM MgCl2, 0.276mM K2SO4, 0.01mM FeSO4, 5×10 -4 mM CaCl2, 50mM NaCl, 80mM MOPS, 4mM Tricine, 0.5mL / L trace element solution, 50mg / L tryptophan, 10g / L glucose, adjusted to pH 7.0-7.2 with KOH solution;

[0020] Specifically, the trace element liquid is: 4×10 -4 M H3BO3, 3×10 -5 M CoCl2, 10 -5 M CuSO4, 8×10 - 5 M MnCl2 and 10 -5 M ZnSO4.

[0021] The fermentation time of the fermentation is determined by detecting the β-CGTase activity and glucose consumption after different fermentation times.

[0022] Specifically, the fermentation conditions are: 25-40° C., 100-300 rpm for 2-6 days; preferably, the fermentation conditions are: 37° C., 180 rpm for 72 hours.

[0023] The specific formula of the enzymatic reaction solution is as follows: 10 to 20 g of potato starch is added to 1 L of 20 to 40 mmol / L Na2HPO4-KH2PO4 buffer.

[0024] Preferably, the enzymatic reaction solution has a specific formula of: adding 10 g of potato starch to 1 L of 25 mmol / L Na2HPO4-KH2PO4 buffer, and gelatinizing it in a boiling water bath for 10 min. The solution must be prepared and used immediately.

[0025] Specifically, during the catalytic reaction, the enzymatic reaction solution is replaced every 12 to 30 hours; preferably, the enzymatic reaction solution is replaced every 12 hours.

[0026] Wherein, the catalytic reaction, its catalytic temperature and pH value are determined by measuring the enzyme activity at different temperatures and pH values.

[0027] Specifically, the catalytic reaction has the following catalytic conditions: temperature 30-40°C, pH=5.5-7.0, and rotation speed 100-300 rpm; preferably, the catalytic conditions are: temperature 30°C, pH=5.5, and rotation speed 150 rpm.

[0028] Wherein, the adding of cyanamide during the fermentation is to add cyanamide at 45-50h and 55-65h of the fermentation; preferably, cyanamide is added at 48h and 60h of the fermentation.

[0029] Specifically, the concentration of the cyanamide is 20-40 mM, and the total amount added is 2-6 mL; preferably, the concentration of the cyanamide is 30 mM, and the total amount added is 2 mL.

[0030] Beneficial effects:

[0031] (1) The present invention is based on immobilization technology and realizes continuous catalytic production of β-cyclodextrin without sterilization by optimizing catalytic conditions and adding cyanamide during the bacterial growth stage, thereby effectively solving the problems of microbial contamination, decreased enzyme activity and difficulty in continuous production in the prior art, and significantly improving the production efficiency and quality of β-cyclodextrin.

[0032] (2) The present invention effectively improves the enzymatic activity and stability of β-CGTase by optimizing the catalytic conditions of the surface displayed strain.

[0033] (3) The present invention continuously catalyzes the production of β-cyclodextrin under non-sterile conditions, thereby reducing production costs and improving production efficiency.

[0034] (4) The technical solution of the present invention is simple and easy to implement, suitable for industrial large-scale production of β-cyclodextrin, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] The present invention will be further described in detail below with reference to the accompanying drawings, and the above and / or other advantages of the present invention will become more clear.

[0036] Figure 1 This is the colony PCR verification result of strain 168Δ9*cah.

[0037] Figure 2 This is the colony PCR verification result of strain 168Δ9*cah*bslA-cgt.

[0038] Figure 3 Results of determination of the optimal culture time for surface display strains.

[0039] Figure 4 The results of the determination of the optimal catalytic conditions of β-CGTase. Among them, A: represents the effect of catalytic temperature on enzyme activity; B: represents the effect of catalytic temperature on enzyme activity stability; C: represents the effect of pH value on enzyme activity; D: represents the effect of pH value on enzyme activity stability.

[0040] Figure 5 Single batch immobilization culture and catalytic results.

[0041] Figure 6 These are the results of multiple batches of immobilized continuous catalysis under sterile conditions.

[0042] Figure 7 These are the results of multiple batches of immobilized continuous catalysis under non-sterile conditions. DETAILED DESCRIPTION

[0043] The present invention will be further described in detail below in conjunction with specific implementations, and the above and / or other advantages of the present invention will become more clear.

[0044] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0045] In the following examples, the Bacillus subtilis 168Δ9, the detailed construction process of this strain has been disclosed in patent CN118291353A.

[0046] In the following embodiments, the defective MOPS-2 culture medium has a formula of: 20-40 mM CN2H2, 1-2 mM KH2PO4, 0.4-0.6 mM MgCl2, 0.1-0.5 mM K2SO4, 0.01-0.03 mM FeSO4, 4×10-4-6×10-4 mM CaCl2, 40-60 mM NaCl, 60-90 mM MOPS, 3-6 mM Tricine, 0.4-0.6 mL / L trace element solution, 40-60 mg / L tryptophan, 5-15 g / L glucose, pH 6.0-7.5;

[0047] Wherein, the trace element liquid is: 3×10-4 ~6×10 -4 M H3BO3, 2×10 -5 ~4×10 -5 M CoCl2, 1×10 -5 ~2×10 -5 M CuSO4, 6×10 -5 ~10×10 -5 M MnCl2 and 1×10 -5 ~2×10 -5 M ZnSO4.

[0048] In the following examples, the enzymatic reaction solution has a specific formula of: adding 10 g potato starch to 1 L 25 mmol / L Na2HPO4-KH2PO4 buffer, and gelatinizing it in a boiling water bath for 10 min. It needs to be prepared and used immediately.

[0049] Example 1: Construction of surface display strain 168Δ9*cah*bslA-cgt

[0050] 1. Construction of strain 168Δ9*cah

[0051] The cyanamide hydratase (CAH) from Aspergillus niger CBS513.88, which can decompose cyanamide, was selected. After the cah gene sequence of cyanamide hydratase was optimized by Bacillus subtilis codon, the plasmid pMA5 was used as an expression vector to construct a separate expression plasmid pMA5-cah, in which the cah gene was expressed by the promoter HapII. The pMA5-cah plasmid was synthesized by Nanjing Qingke Biotechnology Co., Ltd.

[0052] The plasmid pMA5-cah was transformed into competent cells of Bacillus subtilis 168Δ9, and single colonies grown on the resistant plate were picked and verified by colony PCR (verification primers: CAH-F / CAH-R) and then analyzed by agarose gel electrophoresis. The results are as follows: Figure 1 As shown, lane 1 is the DNA Marker of DL2000, and lanes 2 to 7 are the colony PCR results of strain 168Δ9*cah. The bands are bright and single, and the size is correct, indicating that strain 168Δ9*cah was successfully constructed.

[0053] Wherein, after the cah gene sequence of the cyanamide hydratase is codon-optimized by Bacillus subtilis, its nucleotide sequence is shown as SEQ ID NO.1.

[0054] 2. Construction of strain 168Δ9*cah*bslA-cgt

[0055] The vector pBE2R linearized by BamH I and Hind III endonucleases was used as a template to construct the plasmid pBE2R-bslA-cgt, wherein, in order to remove steric hindrance, a linker peptide was inserted between the cgt gene sequence of β-cyclodextrin glucosyltransferase and the anchor protein bslA gene sequence, and a His tag was added before the final stop codon to facilitate the subsequent detection of the expression of the cgt gene. The nucleotide sequence of the linker peptide is as follows: AAAGAATCTGGCTCTGTTTCTTCTGAACAACTTGCTCAATTCCGTTCTCTTGAT, the nucleotide sequence of the His tag is as follows: CATCATCACCATCACCAC, the nucleotide sequence of the cgt gene is shown in SEQ ID NO.2, and the nucleotide sequence of the anchor protein bslA gene is shown in SEQ ID NO.3. Specifically, the above-mentioned plasmid pBE2R-bslA-cgt was synthesized by Nanjing Qingke Biotechnology Co., Ltd.

[0056] The synthesized plasmid pBE2R-bslA-cgt was heat-shock transformed into competent cells of Bacillus subtilis 168Δ9*cah, thereby surface displaying the transformation of the plasmid and obtaining a Bacillus subtilis strain displaying β-cyclodextrin glucosyltransferase on its surface, named 168Δ9*cah*bslA-cgt.

[0057] Figure 2 These are the results of colony PCR verification of strain 168Δ9*cah*bslA-cgt (verification primers: pBE2R-YZ-F / pBE2R-YZ-R). Lane 1 is the DNA Marker of DL5000, and lanes 2 to 9 are the results of colony PCR of the surface display strain. The bands in lanes 2 and 4 to 9 are bright and of the correct size, indicating that the surface display strain 168Δ9*cah*bslA-cgt was successfully constructed.

[0058] The PCR described in Example 1 has a reaction system of 200 μL: 10×PCR buffer 100 μL, dNTPs 40 μL, sterile water 40 μL, upstream primer 6 μL, downstream primer 6 μL, genomic template 4 μL, KOD enzyme 4 μL; the reaction conditions are: pre-denaturation at 94°C, 3 min; denaturation at 98°C, 10 s; annealing at 56°C, 30 s; extension at 68°C, 1 min / 1 kb (35 cycles in total); full extension at 68°C, 10 min. The relevant primers involved in Example 1 are shown in Table 1.

[0059] Table 1 Related primers involved in Example 1

[0060] Primer name Primer sequences CAH-F TACTACCTGTCCCTTGCTGA CAH-R TTATTCCCATTCTCTCATAAG pBE2R-YZ-F GCCGTGATTTCGTGTATTATTGGTTTACT pBE2R-YZ-R CTGCTGATTGGTTCGCTGACCATTTC

[0061] Example 2 Determination of the Optimal Cultivation Time of Surface Displayed Strains

[0062] The surface display strain 168Δ9*cah*bslA-cgt was inoculated into a liquid LB medium containing 20 μg / mL Kan resistance, and a sterilized cotton fiber carrier chemically modified with 2.5% glutaraldehyde was added as an immobilization carrier. After culturing at 37°C and 200 rpm for 12 h, the cell culture medium was diluted to OD 600 After the concentration of the culture medium reached 1.0, it was used as the seed solution and inoculated into a 500-mL Erlenmeyer flask containing 100 mL of defective MOPS-2 medium (containing 20 μg / mL Kan resistance) at an inoculum size of 20% v / v. The culture was fermented at 37°C, 180 rpm. The fermentation liquid was centrifuged every 12 hours to determine the residual sugar content, and the immobilized carrier with adsorbed bacteria was taken for β-cyclodextrin glucosyltransferase (β-CGTase) enzyme activity detection to determine the optimal culture time.

[0063] Among them, the determination process of β-cyclodextrin glucosyltransferase activity is as follows:

[0064] The substrate starch and its derivatives are converted into β-cyclodextrin under the action of the cyclization ability of β-CGTase. Cyclodextrin has the characteristic of being able to embed phenolphthalein. The cyclization activity of β-CGTase is detected by colorimetry.

[0065] 1. Determination of enzyme activity standard curve

[0066] Add 60μL, 50μL, 40μL, 30μL, 20μL, 10μL, and 0μL of 1.0mmol / L β-CD standard solution to the centrifuge tubes respectively, and then use sterile water to make up the volume of the solution in each centrifuge tube to 2mL; add 7μL of 0.6mol / L Na2CO3 solution to adjust the pH to 10.0; add 0.2mL of 1.2mmol / L phenolphthalein solution, mix well, and let stand at 25℃ for 15min to develop color; add 150μL of sterile water to a 96-well plate, take 50μL of the reaction solution after color development and add it to the sterile water, set up three parallels for each sample, and use an enzyme reader to detect and record the absorbance value at a wavelength of 550nm.

[0067] 2. Determination of β-CGTase cyclization activity

[0068] (1) Take 1 mL of fermentation broth into a centrifuge tube, centrifuge at 5000 rpm for 10 min, and discard the supernatant;

[0069] (2) resuspending the bacterial sludge with 1 mL of 25 mmol / L Na2HPO4-KH2PO4 buffer (pH = 5.5) to obtain a crude enzyme solution;

[0070] (3) Using Na2HPO4-KH2PO4 buffer containing 1% potato starch as the enzymatic reaction solution, take 2 mL of the enzymatic reaction solution into a 5 mL centrifuge tube and preheat it in a 50°C water bath for 10 min;

[0071] (4) Add 0.1 mL of crude enzyme solution to the enzymatic reaction solution, using Na2HPO4-KH2PO4 buffer containing 1% potato starch as a control, and let the reaction stand for 10 min;

[0072] (5) Add 0.2 mL of 0.6 mol / L HCl solution to terminate the reaction, and then add 0.5 mL of 0.6 mol / L Na2CO3 solution to adjust the pH to 10.0;

[0073] (6) Add 0.2 mL of 1.2 mmol / L phenolphthalein solution, mix well, and let stand at 25 °C for 15 min;

[0074] (7) Add 150 μL of sterile water to a 96-well plate, then add 50 μL of the color-developed reaction solution. Set up three replicates for each sample and use an ELISA reader to detect the absorbance value OD 550 , and record the data.

[0075] One unit of enzyme activity (U) is defined as the amount of enzyme required to generate 1 μmol of β-cyclodextrin within 1 min under the above assay conditions.

[0076] The initial glucose content in the culture medium was taken as 100%, and the highest enzyme activity was taken as 100%. Figure 3 As shown. The surface displayed bacteria hardly grow in 0-36h, so the sugar consumption is very small. After 36h, the glucose content in the culture medium drops rapidly, indicating that the bacteria begin to grow and produce enzymes at this stage. By 72h, all the glucose is consumed; the β-CGTase enzyme activity shows a trend of first increasing and then decreasing with the increase of bacterial culture time, and the activity reaches the highest at 72h. In the later stage, probably due to insufficient nutrients in the culture medium, the bacteria begin to lyse and apoptosis and fall off the carrier, resulting in a gradual decrease in enzyme activity. Example 3 Determination of the optimal catalytic conditions of β-CGTase

[0077] 1. Effect of catalytic temperature on enzyme activity

[0078] After the surface display strain 168Δ9*cah*bslA-cgt was immobilized and fermented in the defective MOPS-2 medium for 72 hours, the immobilized carrier adsorbed with the bacteria was taken out, and different temperatures were set as variables when the crude enzyme solution reacted with the substrate. The temperature settings were 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, and 75°C, respectively, and the reaction time was 10 minutes. The surface display strain immobilization fermentation process and enzyme activity operation steps are the same as in Example 2.

[0079] The relative enzyme activity was used to characterize the effect of temperature on β-CGTase activity, with the highest relative enzyme activity value being 100%. Figure 4 As shown in A. As can be seen from the figure, the activity of β-CGTase increases first and then decreases with the increase of temperature. The enzyme activity is the highest at 50°C, and the enzyme activity is maintained at more than 80% at 45-60°C. The enzyme activity drops sharply at a temperature higher than 65°C.

[0080] 2. Effect of catalytic temperature on enzyme activity stability

[0081] The crude enzyme solution of the surface-displayed strain was placed in a water bath at different temperatures for insulation, and the temperature settings were 30°C, 40°C, 50°C, 60°C, and 70°C, respectively. After insulation for 0 h, 4 h, 8 h, 12 h, 16 h, and 24 h, a portion of the crude enzyme solution was taken to react with the substrate. The reaction temperature was 50°C and the reaction time was 10 min. The β-CGTase activity was detected, and the enzyme activity operation steps were the same as in Example 2.

[0082] The highest enzyme activity is 100%. Figure 4 As shown in B. As can be seen from the figure, under the same storage time, as the temperature rises, the enzyme activity of β-CGTase continues to decrease; after being stored at 30℃ and 40℃ for 24h, the enzyme activity of β-CGTase is above 80%, indicating that the enzyme stored at this temperature has good stability; but when the storage temperature is higher than 50℃, the enzyme activity drops below 35% after 24h, indicating that the enzyme has poor tolerance to high temperature. Figure 4 From the analysis of A in the figure, it can be seen that 30℃ is more suitable for continuous catalysis.

[0083] 3. Effect of pH on enzyme activity

[0084] After the surface display strain 168Δ9*cah*bslA-cgt was fermented in the defective MOPS-2 medium for 72 hours, the immobilized carrier adsorbed with the bacteria was taken out, and different pH values ​​were set as variables during the reaction of the crude enzyme solution with the substrate. The pH values ​​were set to 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, and 8.0, respectively. The reaction time was 10 minutes, and the reaction temperature was 50° C. The surface display strain immobilization fermentation process and enzyme activity operation steps were the same as in Example 2.

[0085] The relative enzyme activity was used to characterize the effect of pH on β-CGTase activity, with the highest relative enzyme activity value being 100%. Figure 4As shown in C. As can be seen from the figure, the activity of β-CGTase first increases and then decreases with the increase of pH. The enzyme activity is highest at pH 5.5, and the enzyme activity can be maintained above 80% between pH 5.5 and 7.0; but when the pH value is less than 5.0 or the pH value is greater than 7.0, the enzyme activity drops below 60%.

[0086] 4. Effect of pH on enzyme activity stability

[0087] The crude enzyme solution of the surface-displayed strain was placed in a water bath at different temperatures for insulation, and the pH values ​​were set to 4.5, 5.5, 6.5, and 7.5, respectively. After insulation for 0 h, 4 h, 8 h, 12 h, 16 h, and 24 h, a portion of the crude enzyme solution was taken to react with the substrate. The reaction temperature was 50 ° C. and the reaction time was 10 min. The β-CGTase activity was detected. The enzyme activity operation steps were the same as in Example 2.

[0088] The highest enzyme activity is 100%. Figure 4 As shown in D. As can be seen from the figure, under the same storage time, the residual enzyme activity is the highest when the pH is 5.5, indicating that the β-CGTase enzyme activity is stable when stored at this pH value, but when the pH is 4.5, 6.5, and 7.5, the residual enzyme activity is less than 80% after 2 hours of storage, indicating that the enzyme has poor tolerance to excessive acid or alkaline environments. Figure 4 According to the C analysis in the experiment, the continuous catalytic reaction was more suitable to be carried out at a pH of 5.5.

[0089] Example 4 Single batch immobilized culture and catalysis

[0090] The surface display strain 168Δ9*cah*bslA-cgt was inoculated into LB medium containing 20 μg / mL Kan resistance and cultured at 37°C, 200 rpm, and the culture was diluted to OD 600After the pH value is 1.0, it is used as a seed solution, and inoculated into a 500mL Erlenmeyer flask containing 100mL defective MOPS-2 culture medium (containing 20μg / mL Kan resistance) at an inoculum volume of 20% v / v, and the treated cotton fiber carrier is added, and fermented at 37°C, 180rpm for 72h; then the culture medium is poured out and the culture medium in the cotton fiber carrier is squeezed out with sterile tweezers, 100mL of enzymatic reaction solution is added, and the catalytic reaction is carried out at 30°C, 150rpm, pH 5.5, and 2mL of catalytic reaction solution is taken out every 6h to detect the enzyme activity of β-CGTase and the conversion rate of the product (β-cyclodextrin), and the enzyme activity operation steps are the same as those in Example 2. The product conversion rate is detected by high performance liquid chromatography, and the HPLC chromatographic conditions are: Agilent ZORBAX NH2 chromatographic column, differential refractive index detector (RID-10A), the mobile phase is an acetonitrile solution with a volume fraction of 65%, the column temperature is 40°C, the flow rate is 0.5mL / min, and the injection volume is 10μL.

[0091] The conversion rate of β-cyclodextrin is calculated as follows:

[0092] β-cyclodextrin conversion rate % = mass of generated β-cyclodextrin / mass of initial starch × 100%.

[0093] The results are as follows Figure 5 As shown in the figure, as the catalytic time increases, the activity of β-CGTase continues to decrease, and after 30 hours it drops to below 70%, while the product conversion rate shows an upward trend, reaching 67.6% after 30 hours. However, after 12 hours, the rate of increase in product conversion rate becomes slow, which is speculated to be caused by the continuous decrease in β-CGTase activity and the continuous reduction in substrate starch. Considering the production time and production cost, the enzymatic reaction liquid can be replaced after 12 hours of catalytic reaction in the subsequent immobilized continuous catalytic reaction.

[0094] Example 5 Feasibility Analysis of Non-sterile Immobilized Continuous Catalytic Preparation of β-Cyclodextrin

[0095] In order to explore whether the surface displayed strain 168Δ9*cah*bslA-cgt can be immobilized and continuously catalyzed to prepare β-cyclodextrin under non-sterile conditions, the glucose consumption in the growth stage of the strain, the changes in enzyme activity and product conversion rate in the catalytic stage, and the batches in which the reaction can be carried out continuously were used as controls when multiple batches of immobilized catalytic preparation of β-cyclodextrin were carried out under sterile conditions. The production performance of the strain under non-sterile conditions for immobilized continuous catalysis was analyzed to determine its feasibility.

[0096] 1. Multiple batches of immobilized continuous catalysis under sterilization conditions

[0097] The steps and conditions for the fermentation and catalytic reaction of the surface display strain 168Δ9*cah*bslA-cgt refer to Example 4. In the catalytic stage, after the reaction is carried out for 12 hours, a new enzymatic reaction liquid is replaced for reaction until the relative enzyme activity drops below 70%, and all the catalytic reaction liquid is discharged to end the first batch of catalytic reaction. Repeatedly add an equal amount of fresh defective MOPS-2 culture medium to the triangular flask for fermentation, so that the bacteria recover, grow again, and re-produce enzymes, and then repeat the catalytic process, and repeat the cycle. During this period, all experimental operations must be carried out in a clean bench that has been sterilized by ultraviolet light, and all reagents and culture media used have been sterilized at high temperature.

[0098] By measuring the glucose consumption during the growth of the surface-displayed strain 168Δ9*cah*bslA-cgt and the enzyme activity and product conversion rate of β-CGTase in the catalytic stage, the results of multiple batches of immobilized catalytic preparation of β-cyclodextrin under sterile conditions were obtained, as shown in Table 2 and Figure 6 As shown. The surface display strain 168Δ9*cah*bslA-cgt grew slowly in the early stage, and the bacteria began to grow rapidly after 36 hours. At 72 hours, all the glucose in the culture medium was consumed. The growth condition of the bacteria during recovery was similar to that of the first batch, indicating that the surface display strain grew more stably in the defective MOPS-2 culture medium and was not prone to mutation. In the multi-batch immobilization continuous catalysis process, the maximum enzyme activity achieved in the first batch of catalytic reactions was 100%, and the catalytic reaction was terminated when the enzyme activity was lower than 70%, and the same amount of fresh culture medium was added to resuscitate the bacteria. It was found that the enzyme activity of each batch of catalytic reactions was the highest at the beginning, and the enzyme activity continued to decrease as the catalytic reaction proceeded. The enzyme activity of the first and second batches dropped below 70% after 6 reactions. The third batch only carried out the 5th reaction, and the enzyme activity dropped to 69.3%. The fourth batch dropped to 64.7% when the 4th catalytic reaction was carried out. In each batch, the product conversion rate continued to decrease as the reaction progressed. At the end of the first batch, the lowest conversion rate was only 42.5%. However, after the bacteria recovered, the conversion rate returned to a higher level. The product conversion rate of the first reaction of the second batch was 67.2%, 1.5% higher than the highest value of the first batch, indicating that the strain properties were stable after recovery. When it came to the fourth reaction of the fourth batch, the conversion rate dropped to 37.4%. At this time, the strain performance declined, and the enzyme activity and conversion rate were at a low level, which was not suitable for continuing the reaction.

[0099] Table 2 Results of multiple batches of immobilized continuous catalysis under sterilization conditions

[0100]

[0101] 2. Multiple batches of immobilized continuous catalysis under non-sterile conditions

[0102] The steps and conditions for the cultivation and catalytic reaction of the surface display strain 168Δ9*cah*bslA-cgt refer to Example 4. In the catalytic stage, after the reaction is carried out for 12 hours, a new enzymatic reaction liquid is replaced for reaction until the relative enzyme activity drops below 70%, and all the catalytic reaction liquid is taken out to end the first batch of catalytic reaction. Repeatedly add an equal amount of fresh defective MOPS-2 culture medium to the triangular flask for fermentation, so that the bacteria recover, grow again, and re-produce enzymes, and then repeat the catalytic process, and repeat the cycle. However, during the bacterial growth stage of fermentation at 37°C and 180rpm for 72 hours, 1mL of 30mM cyanamide is added to the culture medium at 48h and 60h. During this period, the reagents and culture medium used in the experiment do not need to be sterilized at high temperature, and Kan resistance is not added, and the operation can be carried out in the external environment.

[0103] The results are shown in Table 3 and Figure 7 As shown. Since cyanamide was added to the culture medium during the bacterial culture process, the sugar consumption rate of the bacteria decreased after 48 hours, indicating that the growth of the bacteria was delayed after the addition of cyanamide, but the glucose in the culture medium was also completely consumed at 72 hours, and the growth trend of each batch of bacteria was basically the same. The highest enzyme activity during the first batch of catalysis under sterile conditions was still 100%, and the catalytic reaction was terminated when the enzyme activity was lower than 70%. It was found that the relative enzyme activity of the first two batches dropped below 70% after 6 reactions, the third batch had 5 reactions, and the fourth batch had only 4 reactions, and the relative enzyme activity dropped to 64.6%; with the increase of batches, the relative enzyme activity of the first reaction of each batch continued to decrease, the first batch was 102.4%, and the fourth batch dropped to 85.0%. The change in product conversion rate is proportional to the relative enzyme activity. The product conversion rate of the first reaction of the first batch was 66.53%, the conversion rate of the sixth reaction dropped to 40.3%, and when it came to the fourth reaction of the fourth batch, the product conversion rate was 34.9%.

[0104] Table 3 Results of multiple batches of immobilized continuous catalysis under non-sterile conditions

[0105]

[0106] In summary, the immobilized continuous catalytic reaction under sterilization and non-sterile conditions was carried out in four batches with a total of 21 reactions, and the entire cycle was 23 days. Compared with the results of multiple batches of immobilized continuous catalysis under sterilization conditions, the growth of the surface-displayed strain 168Δ9*cah*bslA-cgt under non-sterile conditions was delayed after the addition of cyanamide, but the overall growth was basically consistent with that under sterilization conditions, and glucose was completely consumed within 72 hours; the enzyme activity and product conversion rate under sterilization and non-sterile conditions gradually decreased with the progress of the reaction, but the enzyme activity increased in the second batch during sterilization, reaching 107.5%, and the highest enzyme activity in the first batch during non-sterile catalysis was 102.4%, and the highest cyclodextrin conversion rate of the two was only 0.64% different. Since non-sterilization can greatly reduce production costs and simplify experimental operations in continuous reactions, it is feasible to use the surface-displayed strain 168Δ9*cah*bslA-cgt with anti-fouling properties to produce cyclodextrin under non-sterile conditions.

[0107] In summary, the present invention constructs a production system for preparing β-cyclodextrin by non-sterilized immobilized continuous catalysis. When the immobilized continuous catalysis is performed, compared with the sterilization, the growth trend of the strain is basically the same when not sterilized, and the maximum relative enzyme activity and yield only differ by 5.1% and 0.64%, respectively. Non-sterilization saves time and cost, and has great application prospects in industrial production.

[0108] The present invention provides a method and idea for the method of producing β-cyclodextrin by immobilized continuous catalysis. There are many methods and approaches to realize the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be realized by existing technologies.

Claims

1. A method for producing β-cyclodextrin by immobilized continuous catalysis, characterized in that: These include: Step (1): in a fermentation tank, inoculating a seed liquid of a strain displaying β-cyclodextrin glucosyltransferase on its surface into a fermentation medium containing an immobilized carrier for fermentation, discharging the fermentation liquid after the fermentation is completed, adding an enzymatic reaction liquid for catalytic reaction, and discharging the catalytic reaction liquid when the relative enzyme activity drops below 70%, thereby terminating the first reaction batch; Step (2): continue to add the fermentation medium in the fermentation tank in an amount equal to that in step (1) to carry out fermentation, and after the fermentation is completed, discharge the fermentation liquid, add the enzymatic reaction liquid to carry out catalytic reaction, and when the relative enzyme activity drops below 70%, discharge the catalytic reaction liquid, and end the second reaction batch; Step (3): repeating step (2), and when the number of catalytic reactions in the reaction batch is ≤ 4 times and the conversion rate of β-cyclodextrin is lower than 35%, the reaction is terminated; Wherein, in step (1), when the seed liquid of the strain displaying β-cyclodextrin glucosyltransferase on the surface is inoculated into a fermentation medium containing an immobilized carrier for fermentation, cyanamide is added during the fermentation period; Wherein, steps (1), (2) and (3) are carried out under non-sterile conditions.

2. The method according to claim 1, characterized in that The immobilization carrier is cotton fiber.

3. The method according to claim 1, characterized in that The fermentation medium has a formula of: 20-40 mM CN2H2, 1-2 mM KH2PO4, 0.4-0.6 mM MgCl2, 0.1-0.5 mM K2SO4, 0.01-0.03 mM FeSO4, 4×10 -4 ~6×10 -4 mM CaCl2, 40-60mM NaCl, 60-90mM MOPS, 3-6mM Tricine, 0.4-0.6mL / L trace element solution, 40-60mg / L tryptophan, 5-15g / L glucose, pH 6.0-7.

5.

4. The method according to claim 3, characterized in that The trace element liquid is: 3×10 -4 ~6×10 - 4 MH3BO3, 2×10 -5 ~4×10 -5 M CoCl2, 1×10 -5 ~2×10 -5 M CuSO4, 6×10 -5 ~10×10 -5 M MnCl2 and 1×10 -5 ~2×10 -5 M ZnSO4.

5. The method according to claim 1, characterized in that The fermentation conditions are as follows: 25-40° C., 100-300 rpm, and culturing for 2-6 days.

6. The method according to claim 1, characterized in that The enzymatic reaction solution has a formula of: adding 10-20g potato starch into 1L 20-40mmol / L Na2HPO4-KH2PO4 buffer.

7. The method according to claim 1, characterized in that When the catalytic reaction is carried out, the enzymatic reaction solution is replaced every 12 to 30 hours.

8. The method according to claim 1, characterized in that The conditions of the catalytic reaction are: temperature 30-40° C., pH=5.5-7.0, and rotation speed 100-300 rpm.

9. The method according to claim 1, characterized in that: The adding of cyanamide during the fermentation means adding cyanamide at 45-50h and 55-65h of the fermentation.

10. The method according to claim 1, characterized in that The concentration of the cyanamide is 20-40 mM, and the total amount added is 2-6 mL.

Images