Use of a substance related to the SLC38A2-AS1 gene in the preparation of a product for the treatment, screening, and / or diagnosis of acute kidney injury

Abstract

The present invention discloses the application of substances related to the SLC38A2-AS1 gene in the preparation of products for the treatment, screening, and / or diagnosis of acute kidney injury. By comparing the differential expression of LncRNA in the sera of CI-AKI patients and non-CI-AKI patients, the present invention first discovers that SLC38A2-AS1 is highly expressed in the sera of CI-AKI patients (Fc > 1.5, P < 0.05). Further, by plotting the receiver operating characteristic curve to evaluate the predictive efficacy of SLC38A2-AS1 for CI-AKI, the results show that the AUC value reaches 0.8507, indicating that it can serve as a sensitive and accurate novel biomarker for CI-AKI and provide new strategies for the early diagnosis and treatment of acute kidney injury.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of substances related to the SLC38A2-AS1 gene in the preparation of products for the treatment, screening, and / or diagnosis of acute kidney injury. Background Art

[0002] Acute kidney injury (AKI) is a clinical syndrome with a sharp decline in renal function caused by various etiologies. The occurrence of contrast-induced acute kidney injury (CI-AKI) prolongs the hospital stay of patients and increases medical costs, bringing a huge economic burden to families and society. Therefore, how to alleviate CI-AKI and provide new theoretical bases, potential diagnostic markers, and intervention targets for the prevention and treatment of AKI is of great significance for clinical treatment.

[0003] CI-AKI is usually diagnosed based on an increase in serum creatinine value by 26.5 μmol / L or more than 1.5 times the baseline value within 48 - 72 hours or urine volume < 0.5 mL / (kg • h) for more than 6 hours. However, the specificity of serum creatinine in this definition is poor because it fluctuates due to the influence of body fluid transfer and drug effects. In addition, the insensitivity, late onset of serum creatinine, and the lack of accurate novel biomarkers also pose great challenges to the early detection of CI-AKI.

[0004] In related technologies, renal tubular epithelial cells are the key target cells for the occurrence of AKI. The injury of renal tubular epithelial cells is the main pathological basis of AKI, and cell death is the main form of renal tubular epithelial cell injury. The classical cell death methods, including regulated apoptosis and unregulated necrosis, have been confirmed to exist and promote the occurrence and development of AKI. With the progress of scientific research in recent years, various novel programmed cell death methods have been discovered, including pyroptosis, ferroptosis, etc., which have also been proven by scholars to play important roles to varying degrees in the occurrence and development of AKI. However, due to the numerous etiologies of AKI, the signal pathways are intricate, and the mechanisms are different, its molecular regulatory mechanism has not been fully elucidated.

[0005] LncRNAs are a group of nucleotide transcripts with a length exceeding 200 base pairs. With the development of next-generation sequencing technology, more and more new lncRNAs have been discovered. In recent years, scientists have found that many lncRNAs play important roles in the occurrence and development of diseases, including acute kidney injury. Two new lncRNAs (lnc-PRND and lnc-HILPDA) were discovered and identified in mice with acute kidney injury after contrast agent treatment, and it was explored that they could be used as markers for contrast-induced acute kidney injury. However, the interspecies conservation of lncRNAs is poor, and the use of murine lncRNAs for human diagnosis has certain limitations.

[0006] Based on this, there is an urgent need to seek a serological early diagnostic marker that can reflect different biological processes during acute kidney injury, and to provide new ideas for the clinical diagnosis and treatment targets of CI-AKI by exploring its specific pathogenesis in CI-AKI. Summary of the Invention

[0007] The present invention aims to solve at least one of the technical problems existing in the prior art. For this purpose, the present invention provides the use of a substance for detecting the SLC38A2-AS1 (Solute Carrier Family 38 Member 2 - antisense RNA 1) gene in the preparation of a product for screening, diagnosing, and / or evaluating the prognosis of acute kidney injury.

[0008] The present invention also provides the use of a substance that specifically reduces the expression level of the SLC38A2-AS1 gene in the preparation of a product for treating and / or preventing acute kidney injury.

[0009] The present invention also provides an acute kidney injury diagnostic kit.

[0010] The present invention also provides a system for diagnosing and / or evaluating the prognosis of acute kidney injury.

[0011] The present invention also provides a drug for treating acute kidney injury.

[0012] In the first aspect of the present invention, there is provided the use of a substance for detecting the SLC38A2-AS1 gene in the preparation of a product for screening, diagnosing, and / or evaluating the prognosis of acute kidney injury.

[0013] The application according to the embodiments of the present invention has at least the following beneficial effects:

[0014] The present invention uses a human lncRNA chip detection technology to detect the differential expression of lncRNAs in the sera of CI-AKI patients and non-CI-AKI patients. For the first time, it is found that compared with the sera of non-CI-AKI patients (normal group), the long non-coding RNA SLC38A2-AS1 is highly expressed in CI-AKI (Fc>1.5, P<0.05). To explore its diagnostic value, the present invention uses qPCR and FISH technologies to detect the expression levels of the SLC38A2-AS1 gene in the sera of CI-AKI patients, renal tissues with acute tubular injury, and CI-AKI in vitro cell models, and draws a receiver operating characteristic curve to evaluate the predictive efficacy of SLC38A2-AS1 for CI-AKI. The results show that SLC38A2-AS1 is up-regulated in the sera of patients with acute kidney injury caused by iodinated contrast agents, renal tissues with acute tubular injury, and renal tubular epithelial cells treated with iodinated contrast agents. The area under the curve of the receiver operating characteristic curve (ROC) of SLC38A2-AS1 is 0.8507, indicating high predictive efficacy, and the Youden index of SLC38A2-AS1 is 0.5417 (sensitivity is 75%, specificity is 79.17%), indicating that the screened SLC38A2-AS1 can be used as a sensitive and accurate novel biomarker for CI-AKI.

[0015] In some embodiments of the present invention, the substances for detecting the SLC38A2-AS1 gene include probes having sequences complementary to the SLC38A2-AS1 gene, and / or primers for detecting the SLC38A2-AS1 gene.

[0016] In some embodiments of the present invention, the probe includes a probe having a nucleotide sequence shown in any one of SEQ ID NO.3 to SEQ ID NO.5.

[0017] In some embodiments of the present invention, the primers for detecting the SLC38A2-AS1 gene include reverse transcription primers and / or quantitative PCR primers.

[0018] In some embodiments of the present invention, the quantitative PCR primer includes a forward primer having a nucleotide sequence shown in SEQ ID NO.6, and / or a reverse primer having a nucleotide sequence shown in SEQ ID NO.7.

[0019] In some embodiments of the present invention, the SLC38A2-AS1 gene is a long non-coding RNA, and the cDNA sequence of the SLC38A2-AS1 gene is shown in SEQ ID NO.1.

[0020] In some embodiments of the present invention, the acute kidney injury includes nephrotoxic acute kidney injury, acute kidney injury caused by ischemia-reperfusion, or acute kidney injury caused by sepsis.

[0021] In some embodiments of the present invention, the nephrotoxic acute kidney injury includes acute kidney injury caused by iodinated contrast agents, acute kidney injury caused by cisplatin, or acute kidney injury caused by heavy metals.

[0022] In some preferred embodiments of the present invention, the acute kidney injury is acute kidney injury caused by iodinated contrast agents.

[0023] In some embodiments of the present invention, the product includes at least one of a reagent, a kit, a test strip, a system, and a chip.

[0024] In some embodiments of the present invention, the test samples for the products for screening, diagnosing, and / or prognostic evaluating acute kidney injury are urine samples, blood samples, or kidney tissue samples.

[0025] A second aspect of the present invention provides the use of a substance that specifically reduces the expression level of the SLC38A2-AS1 gene in the preparation of a product for treating and / or preventing acute kidney injury.

[0026] The application according to the embodiments of the present invention has at least the following beneficial effects:

[0027] By exploring the role of SLC38A2-AS1 in the pathogenesis of CI-AKI, the present invention found that knocking down the expression level of the SLC38A2-AS1 gene can alleviate the loss of cell viability of human renal tubular epithelial cells (HK-2) treated with iodinated contrast agents. More specifically, knocking down SLC38A2-AS1 reduces the degree of apoptosis and ferroptosis of HK-2 caused by iodinated contrast agents, indicating that knocking down SLC38A2-AS1 has a protective effect on acute kidney injury caused by iodinated contrast agents, providing a theoretical basis for studying therapeutic targets for acute kidney injury.

[0028] In some embodiments of the present invention, the substance that specifically reduces the expression level of the SLC38A2-AS1 gene includes at least one of the following:

[0029] A) siRNA, dsRNA, miRNA, ribozyme, shRNA, or antisense oligonucleotide (ASO) targeting the SLC38A2-AS1 gene;

[0030] B) a nucleic acid molecule encoding the siRNA, dsRNA, miRNA, ribozyme, shRNA, or antisense oligonucleotide targeting the SLC38A2-AS1 gene described in A);

[0031] C) An expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in B).

[0032] In some embodiments of the present invention, the siRNA targeting the SLC38A2-AS1 gene comprises a nucleotide sequence shown in any one of SEQ ID NO.8 to SEQ ID NO.10.

[0033] In some embodiments of the present invention, the antisense oligonucleotide (ASO) targeting the SLC38A2-AS1 gene comprises a nucleotide sequence shown in any one of SEQ ID NO.11 to SEQ ID NO.13.

[0034] In some embodiments of the present invention, the substance that specifically reduces the expression level of the SLC38A2-AS1 gene further comprises a small molecule compound that specifically targets the SLC38A2-AS1 gene.

[0035] In some embodiments of the present invention, the acute kidney injury includes nephrotoxic acute kidney injury, acute kidney injury caused by ischemia-reperfusion, or acute kidney injury caused by sepsis.

[0036] In some embodiments of the present invention, the nephrotoxic acute kidney injury includes acute kidney injury caused by iodinated contrast agents, acute kidney injury caused by cisplatin, or acute kidney injury caused by heavy metals.

[0037] In some preferred embodiments of the present invention, the acute kidney injury includes acute kidney injury caused by iodinated contrast agents.

[0038] In a third aspect of the present invention, there is provided an acute kidney injury diagnostic kit, comprising a probe, primer or gene chip for specifically detecting the SLC38A2-AS1 gene.

[0039] The diagnostic kit according to the embodiments of the present invention has at least the following beneficial effects: The acute kidney injury diagnostic kit of the present invention can achieve early diagnosis by rapidly detecting a specific biomarker (the SLC38A2-AS1 gene), thereby shortening the diagnostic cycle. In addition, the acute kidney injury diagnostic kit of the present invention has good detection accuracy, high sensitivity, and low cost, and is suitable for popularization.

[0040] In some embodiments of the present invention, the probe for specifically detecting the SLC38A2-AS1 gene comprises an SLC38A2-AS1 fluorescence in situ hybridization (FISH) probe.

[0041] Preferably, the SLC38A2-AS1 fluorescence in situ hybridization probe comprises a probe having a nucleotide sequence shown in any one of SEQ ID NO.3 to SEQ ID NO.5.

[0042] In some embodiments of the present invention, the primer for specifically detecting the SLC38A2-AS1 gene comprises a forward primer having a nucleotide sequence shown in SEQ ID NO.6, and / or a reverse primer having a nucleotide sequence shown in SEQ ID NO.7.

[0043] In some embodiments of the present invention, the diagnostic kit further comprises at least one of reverse transcriptase, standard, DNA polymerase, fluorescent dye, dNTP, buffer, negative control solution.

[0044] In some embodiments of the present invention, the standard is a recombinant plasmid carrying the SLC38A2-AS1 gene. The negative control solution is a blank control solution without any standard.

[0045] In some embodiments of the present invention, the acute kidney injury includes nephrotoxic acute kidney injury, acute kidney injury caused by ischemia-reperfusion, or acute kidney injury caused by sepsis.

[0046] In some embodiments of the present invention, the nephrotoxic acute kidney injury includes acute kidney injury caused by iodinated contrast agents, acute kidney injury caused by cisplatin, or acute kidney injury caused by heavy metals.

[0047] In some preferred embodiments of the present invention, the acute kidney injury includes acute kidney injury caused by iodinated contrast agents.

[0048] In a fourth aspect of the present invention, there is provided a system for diagnosing and / or prognosticating acute kidney injury, comprising:

[0049] A data acquisition module for acquiring the expression level of the SLC38A2-AS1 gene of a patient;

[0050] A data analysis module for inputting the expression level of the SLC38A2-AS1 gene into a risk scoring model to evaluate the diagnosis and / or prognosis of acute kidney injury of the patient.

[0051] In some embodiments of the present invention, the acute kidney injury includes nephrotoxic acute kidney injury, acute kidney injury caused by ischemia-reperfusion, or acute kidney injury caused by sepsis.

[0052] In some embodiments of the present invention, the nephrotoxic acute kidney injury includes acute kidney injury caused by iodinated contrast agents, acute kidney injury caused by cisplatin, or acute kidney injury caused by heavy metals.

[0053] In some preferred embodiments of the present invention, the acute kidney injury includes acute kidney injury caused by iodinated contrast agents.

[0054] In a fifth aspect of the present invention, there is provided a drug for treating acute kidney injury, and the active substance of the drug includes a substance that specifically reduces the expression level of the SLC38A2-AS1 gene.

[0055] In some embodiments of the present invention, the substance that specifically reduces the expression level of the SLC38A2-AS1 gene includes at least one of the following:

[0056] A) siRNA, dsRNA, miRNA, ribozyme, shRNA or antisense oligonucleotide (ASO) targeting the SLC38A2-AS1 gene;

[0057] B) a nucleic acid molecule encoding the siRNA, dsRNA, miRNA, ribozyme, shRNA or antisense oligonucleotide targeting the SLC38A2-AS1 gene described in A);

[0058] C) an expression cassette, vector or transgenic cell line containing the nucleic acid molecule described in B).

[0059] In some embodiments of the present invention, the substance that specifically reduces the expression level of the SLC38A2-AS1 gene further includes a small molecule compound that specifically targets the SLC38A2-AS1 gene.

[0060] In some embodiments of the present invention, the acute kidney injury includes nephrotoxic acute kidney injury, acute kidney injury caused by ischemia-reperfusion, or acute kidney injury caused by sepsis.

[0061] In some embodiments of the present invention, the nephrotoxic acute kidney injury includes acute kidney injury caused by iodinated contrast agents, acute kidney injury caused by cisplatin, or acute kidney injury caused by heavy metals.

[0062] In some preferred embodiments of the present invention, the acute kidney injury includes acute kidney injury caused by iodinated contrast agents.

[0063] Other features and advantages of the present invention will be described in the subsequent specification. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] The present invention will be further described below in conjunction with the drawings and examples, where:

[0065] Figure 1 is the serum human-derived differential LncRNA map of patients with acute kidney injury caused by iodinated contrast agents of the present invention;

[0066] Figure 2The expression level of SLC38A2-AS1 of the present invention in 24 patients. Note: "**" indicates P <0.01;

[0067] Figure 3 The expression level of TCONS_00013515 of the present invention in 24 patients. Note: "ns" indicates no significant statistical difference;

[0068] Figure 4 The ROC curve of SLC38A2-AS1 of the present invention as a serological diagnostic marker for CI-AKI;

[0069] Figure 5 The expression of SLC38A2-AS1 in the renal tissue of acute tubular injury and the in vitro cell model of CI-AKI of the present invention. Among them, A is the expression of SLC38A2-AS1 in the renal tissue of acute tubular injury after FISH staining, B is the expression of SLC38A2-AS1 in the in vitro cell model of CI-AKI after FISH staining, and C is the qPCR statistical result of SLC38A2-AS1 in the in vitro model of CI-AKI. Note: "**" indicates P <0.01;

[0070] Figure 6 The results of the effect of knocking down SLC38A2-AS1 on the activity and lipid peroxidation level of HK-2 cells treated with iodinated contrast agent. Among them, A is the expression level of SLC38A2-AS1 before and after knockdown, B is the statistical result of HK-2 cell activity, and C is the statistical result of HK-2 lipid peroxidation level. Note: "*" indicates P <0.05, "**" indicates P <0.01, "***" indicates P <0.001, "****" indicates P <0.0001;

[0071] Figure 7 The results of the effect of knocking down SLC38A2-AS1 on the ferroptosis markers of HK-2 cells treated with iodinated contrast agent. Among them, A is the Western Blot result, B is the statistical result of NCOA4 expression level, C is the statistical result of GPX4 expression level, and D is the statistical result of FTH1 expression level. Note: "*" indicates P <0.05, "**" indicates P <0.01, "***" indicates P <0.001, "****" indicates P <0.0001;

[0072] Figure 8Results of the effect of knocking down SLC38A2-AS1 on the level of reactive oxygen species in HK-2 cells treated with iodinated contrast agent;

[0073] Figure 9 Results of Western Blot detection of the effect of knocking down SLC38A2-AS1 on apoptosis markers in HK-2 cells treated with iodinated contrast agent;

[0074] Figure 10 Results of the effect of overexpressing SLC38A2-AS1 on the viability, lipid peroxidation level, ferroptosis markers, and reactive oxygen species level in HK-2 cells treated with iodinated contrast agent. Among them, A is the expression level of SLC38A2-AS1 before and after overexpression, B is the statistical result of HK-2 cell viability, C is the statistical result of HK-2 lipid peroxidation level, D is the Western Blot result, E is the statistical result of GPX4 expression level, F is the statistical result of FTH1 expression level, G is the detection result of HK-2 cell ROS level. Note: "*" indicates P <0.05, "**" indicates P <0.01, "***" indicates P <0.001, "****" indicates P <0.0001;

[0075] Figure 11 Expression of SLC38A2 in HK-2 treated with iodinated contrast agent. Among them, A is the Western Blot result of SLC38A2, B is the statistical result of SLC38A2 expression level, C is the immunofluorescence detection map of SLC38A2 in cells;

[0076] Figure 12 Detection results of the expression of SLC38A2 after knocking down or overexpressing SLC38A2-AS1. Among them, A is the Western Blot result of SLC38A2 after knocking down SLC38A2-AS1, B is the statistical result of SLC38A2 expression level after knocking down SLC38A2-AS1, C is the Western Blot result of SLC38A2 after overexpressing SLC38A2-AS1, D is the statistical result of SLC38A2 expression level after overexpressing SLC38A2-AS1. Note: "*" indicates P <0.05, "****" indicates P <0.0001;

[0077] Figure 13Results of the effects of knocking down SLC38A2 on the viability, ferroptosis markers, and reactive oxygen species levels of iodine contrast agent-treated HK-2 cells. Among them, A shows the detection results of SLC38A2 protein expression after knockdown using siRNA, B shows the statistical results of the expression level of SLC38A2 after knockdown, C shows the statistical results of HK-2 cell viability, D shows the Western Blot results, E shows the statistical results of the expression level of SLC38A2, F shows the statistical results of the expression level of GPX4, G shows the detection results of the ROS level in HK-2 cells. Note: "*" indicates P <0.05, "**" indicates P <0.01, "***" indicates P <0.001, "****" indicates P <0.0001. Detailed implementation manners

[0078] The following will clearly and completely describe the concept and technical effects of the present invention in combination with the embodiments to fully understand the purpose, features, and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative efforts belong to the scope of protection of the present invention.

[0079] For those not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. For reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0080] In the description of the present invention, SLC38A2 (Solute Carrier Family 38 Member 2) is a gene that can encode a protein, and SLC38A2-AS1 (also called ENST00000550319) is a long non-coding RNA located on the antisense strand of this coding gene. Its naming is based on this coding gene SLC38A2 (according to the naming rules of LncRNA), and they are two different genes.

[0081] Example 1: Screening of diagnostic biomarkers for iodine contrast agent-induced acute kidney injury

[0082] This example provides a diagnostic biomarker SLC38A2-AS1 for iodine contrast agent-induced acute kidney injury, and its screening process is as follows:

[0083] 1. Collection of blood samples from CI-AKI patients

[0084] (1) Identification of the CI-AKI population:

[0085] Within 48 to 72 hours after the patient is injected with iodine contrast agent, if the serum creatinine increases by greater than or equal to 26.5 μmol / L or the serum creatinine increases to 1.5 times or more of the baseline value within 7 days, it indicates that iodine contrast agent-induced acute kidney injury has occurred.

[0086] (2)Blood sample collection and sample mixing:

[0087] This study selected patients who were hospitalized in the Department of Cardiovascular Medicine, Second Xiangya Hospital of Central South University, had chronic kidney disease, and underwent coronary angiography (CAG) or percutaneous coronary intervention (PCI). Since the increase in serum creatinine lags behind the actual damage to renal function, and previous studies have shown that although creatinine levels in CI-AKI patients increase within 48 hours, the increase level does not reach the diagnostic criteria for CI-AKI. Therefore, in order to find an early diagnostic biomarker, this invention collected the plasma of 12 patients who developed acute kidney injury after CAG / PCI (i.e., CI-AKI patients) 12 - 30 hours after the operation. Subsequently, patients without acute kidney injury (i.e., control group patients) were selected from this department in a 1:1 paired manner, and their plasma 12 - 30 hours after the operation was collected. Due to heterogeneity among different patients, in order to minimize the individual differences between patients, the plasma of 4 patients with similar clinical characteristics was mixed to obtain 3 groups of mixed plasma of CI-AKI patients and 3 groups of mixed plasma of control patients.

[0088] 2. Detection of differential expression profiles of LncRNA in human serum of CI-AKI by chip technology

[0089] Take the above 3 groups of CI-AKI plasma samples and 3 groups of non-CI-AKI control plasma samples for subsequent experiments on differential expression profiles of human serum LncRNA. The analysis of LncRNA expression uses a rapid amperometric labeling kit, monochromatic (Agilent p / n 5190-0442) and Agilent gene expression hybridization kit (Agilent p / n 5188-5242), and subcontracts to Aksomics (formerly Kangcheng Bio, China region) for implementation. The specific steps are as follows:

[0090] (1)RNA extraction and purification:

[0091] Take a part of the plasma sample to extract RNA using Trizol. After liquid phase separation, RNA precipitation, elution, and dissolution, subsequent quality inspection is carried out on the collected RNA solution.

[0092] (2)RNA quality inspection:

[0093] It is divided into two steps. The first step is RNA purification and quantitative analysis, and the second step is the purification of labeled / amplified RNA and cRNA quality control. When ensuring that the RNA purity, quality, and chip labeling efficiency meet the standards, subsequent research is carried out on the plasma RNA to be subjected to chip scanning.

[0094] (3)Construct a library using a chip:

[0095] Use Agilent's gene expression hybridization kit to hybridize the RNA with the chip. After microarray washing and scanning, use Agilent Feature Extraction software to extract data to complete the library construction.

[0096] (4)Analysis of sequencing results:

[0097] Analyze the sequencing results to obtain the differential human LncRNA expression profile. A total of 24,416 LncRNAs were detected in the plasma samples of the CI-AKI group and the control group (Control), and 89 LncRNAs were different (FC>1.5, P <0.05), including 51 up-regulated LncRNAs and 38 down-regulated LncRNAs. The clustering analysis diagram of the above 89 differential LncRNAs is as Figure 1 shown.

[0098] 3. LncRNA screening

[0099] Based on the low content of serum LncRNA and the difficulty in detecting it by qPCR, in order to find detectable LncRNA, for the candidate LncRNA obtained in step 2, it is detected by reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR), and the screening criteria are as follows:

[0100] (1)The molecular weight is between 200-2000 bp;

[0101] (2)The differential fold ranking is 10;

[0102] (3)The CT value of serum qPCR is stably below 35;

[0103] (4)The results obtained by serum qPCR have a smooth melting curve and a correct amplification curve;

[0104] (5)Confirm that the sequence of the product amplified by the primer is correct: Send the DNA stock solution after serum qPCR amplification for Sanger sequencing, compare the sequencing results with the theoretical qPCR product fragment, and confirm that the sequence of the product amplified by the primer is correct.

[0105] The screening results showed that SLC38A2-AS1 and TCONS_00013515 met the above conditions, indicating that SLC38A2-AS1 and TCONS_00013515 could be detected in serum by qPCR method.

[0106] The nucleotide sequence (cDNA) information of SLC38A2-AS1 is shown in SEQ ID NO.1:

[0107] CACGTGACGCCGCCCGGAGGCGCAGCGCGGCTGATTCATCCCAGGCCAGGCGAGTGGAAAAGTACCAGCCGCGCGCGAGGGGCGGGGGCGCGCCGAGGGGCGGAAAAGTACAGACGGCGGAGCCGCGGGGAGAACAAAGATGATGCCACCGCTGTGTTGCGGCCGTCGAGGCCCCCTACTCCGGCAGATTTCAACCTGCTTTCACTCTTCAAAACTAGCCGGAGGTCGGCGAGCAGCTCCTTTTCGGGATGTGCTTTTTGTACGGCCATGGAAACTGGACTAGCGGAAAGGCTACCTTTTGGCCAGCAAGCCAGGCCCCTTAGAAAGAGGCCCCAGTGGGGAGCCCGGCGCTCCTAAGGCCGTTTGGGAGTCCCCAGTTTTCCACTCGCTGACACGTTGCTTCTCTTATCCCACCACCGCCGCCCCGGGCAAAGGCACTGCCTTGTCTGAATGCGGGTCTGAGGCGCTTTCTGCGGAGCCTGGTCCTTTCCCTTCAATGGTGATGTGTGTGGTCTTGCTGAGCCAGGCAACTAGGGGGACCCTTCGCTGTGGAAAAATTGGTGCTGCGGGAAAGGCAAGACTCACTCCCTTGCAGGAAACAAAGACCCCTTAGGAGAGAGAAATGTTCATGGAATGAATGAATAAACAAGTTTGACCTACT (SEQ ID NO.1).

[0108] The nucleotide sequence (cDNA) information of TCONS_00013515 is shown in SEQ ID NO.2:

[0109] CATCCACTCTGGTCTGCATCCTCTTGACCGCGTCTGAGTCTCCTTTGGGGCTGGATGTCTGCTTCAGCATTAGGAAATGGACACATCTATAGAATCTCTCATGGCAACACACCAAGTATTGTAAACTTCGTCCTTTCAACAAGTTATATTACTAAAAATCGACAAACTGAACTCACATGAATGTGTACTTACAGAGTTGTGGCTCCTGATTCTATTTAAGGTATGTTAAAGTAAAAGCAGTTAGAATATGGAATATTTTTTTCCCTTGACTATGCCAAAGAAATATTGGTGAGGAATGTTGTGGCTTATTTTTTGTTCTTTCTACATTTTATTTTGTAAAAATTTAAATATTTAATCATGCTCTTCAGTCCTTTACCCATTTTAAGTCTTTTAGTAAGGTTTTATAACTTTAAACATACAGATACTGCATATTATGTATTAGGTTTATTTTAACATTTAACAGAGATTTGTGACTGACTATTATGAGTATGAATATATAATAAATTATTACAAATTCTAATCAGTTACGCTGATGTGGAATATTTTCAAGTGTTGATCTTGTACCCAGTTATCTTATCCAATAATCTATACTTTCAGTGAGCTCTAATTGATTTCTTGTAAGATAATATTATAAAATGACAAATTTGTAACCCTTCCAAGTCACTGATTTCCAATATTTATATCTCCTTTTATTTTTAATTTTTCTTGTTCTTCAAAACTGTTTAAGACTTGGCGTACATTTTAAATAAATATGGTGATAATGAATGGAG (SEQ ID NO.2).

[0110] 4. Expression of SLC38A2-AS1 in the serum of CI-AKI patients

[0111] The above detection results indicate that TCONS_00013515 and SLC38A2-AS1 are abnormally up-regulated in CI-AKI and can be detected by qPCR method. In order to explore whether TCONS_00013515 and SLC38A2-AS1 can be used as early markers for iodine contrast agent-induced acute kidney injury, the present invention uses qPCR method to verify in the above 12 CI-AKI patients and 12 non-CI-AKI patients respectively. Specifically, taking SLC38A2-AS1 as an example, the verification method is described as follows:

[0112] (1)Construct a standard for SLC38A2-AS1 qPCR absolute quantification method:

[0113] After sequencing the above qPCR amplification products to confirm the correct sequence, the corresponding sequence of the product is added to the Puc57 vector plasmid (Shanghai Sangon), and a recombinant plasmid containing the SLC38A2-AS1 fragment is obtained as a standard. The constructed standard is stored in a -80° refrigerator.

[0114] Use the BioG serum / plasma free RNA extraction kit (51027) to extract plasma RNA, and use nanodrop 2000 to detect the purity and concentration of the extracted RNA according to the kit instructions.

[0115] After removing gDNA from the extracted RNA using the Aikerui reverse transcription kit (AG11728), all RNA is reverse transcribed into DNA.

[0116] (2)Gradient dilution of the standard:

[0117] Taking the recombinant plasmid containing the SLC38A2-AS1 fragment as the standard, first use Nanodrop2000 to detect the concentration of the standard. The concentration of the standard stock solution is determined to be 5 ng / μL, and the standard is continuously diluted 10-fold to obtain 6 samples with a ten-fold difference in concentration. The copy number corresponding to each concentration of the standard is calculated using the following formula:

[0118] 。

[0119] (3)qPCR reaction:

[0120] For the above-mentioned 6 dilution gradients of the standard and the DNA after serum reverse transcription, use the Aikerui amplification reagent (AG11701) for sample mixing. After sample mixing, use the LightCycler 96 Real-Time PCR System for PCR detection. The specific sample addition system and reaction conditions are shown in Tables 1 and 2 below.

[0121] Table 1: qPCR Reaction Conditions

[0122]

[0123] Table 2: qPCR Reaction System

[0124]

[0125] Taking the CT value of the standard product as the ordinate (Y) and the logarithm of the copy number as the abscissa (X), draw a standard curve on graph paper. The standard curve formula obtained in this experiment is: y = -3.3655x + 37.155, R2 = 0.996. According to the CT value of the sample, the logarithm of the corresponding copy number is found from the standard curve.

[0126] Note: Y is the CT value, and x is the logarithm of the sample copy number. Thus, the specific copy numbers of SLC38A2-AS1 in the sera of each acute kidney injury patient caused by iodinated contrast agent and the control group sera are obtained.

[0127] (4) Statistical test:

[0128] Using Prism software, the paired t-test was selected as the statistical method for statistical analysis.

[0129] The analysis results are as Figure 2 and Figure 3 shown, where Figure 2 is the detection result of SLC38A2-AS1, Figure 3 is the detection result of TCONS_00013515, indicating that compared with the control group, SLC38A2-AS1 was significantly increased in the contrast agent group (n = 12, p < 0.001), and there was no significant difference in TCONS_00013515 in the contrast agent group. Therefore, the SLC38A2-AS1 gene was used as the preferred biomarker.

[0130] Example 2: Receiver Operating Characteristic Curve Validation

[0131] Additionally, 24 cases of CI-AKI and 24 cases of non-CI-AKI were collected as subjects (the samples were all from the Second Xiangya Hospital of Central South University), and then the receiver operating characteristic curve (ROC curve) analysis based on the SLC38A2-AS1 gene was performed using GraphPad Prism 10 software. The receiver operating characteristic curve was drawn and the area under the curve (AUC) was calculated. At the same time, the Youden index (sensitivity + specificity - 1) was used to determine the optimal cut-off point, and the sensitivity and specificity of this experiment were determined according to the point corresponding to the Youden index.

[0132] The results are as Figure 4 shown. The AUC of SLC38A2-AS1 is 0.8507. When the cut-off value of SLC38A2-AS1 is selected as 443 copies, it is the best critical point. At this time, the Youden index is 0.5417 (sensitivity is 75%, specificity is 79.17%). When the expression level of SLC38A2-AS1 in patients exceeds 443 copies, it is diagnosed as CI-AKI. Therefore, SLC38A2-AS1 can be used as a new and effective biomarker for detecting CI-AKI in CAG / PCI patients.

[0133] Example 3: A diagnostic kit for acute kidney injury caused by iodinated contrast agents

[0134] In this example, a diagnostic kit for acute kidney injury caused by iodinated contrast agents was prepared. The production of this CI-AKI diagnostic kit is mainly based on RT-qPCR.

[0135] The CI-AKI diagnostic kit in this example includes: a recombinant plasmid with the target sequence of SLC38A2-AS1, as well as reverse transcriptase, standard products, DNA polymerase, SYBR Green I fluorescent dye, primers, dNTPs, buffer solution, negative control solution, and other salt ions, etc.

[0136] Among them, the primer-related information is shown in Table 3:

[0137] Table 3: Sequence information of the CI-AKI diagnostic kit

[0138]

[0139] The negative control solution is a blank control solution without any standard products (such as normal saline). This CI-AKI diagnostic kit can be used to detect the expression level of SLC38A2-AS1 in plasma, so as to diagnose CI-AKI disease more quickly, simply and accurately.

[0140] Example 4: Changes of SLC38A2-AS1 in the renal tissues of patients with acute tubular injury

[0141] Based on the fact that in clinical practice, kidney sections of CI-AKI patients cannot be obtained, and acute tubular injury is a common pathological manifestation of AKI including CI-AKI, in this example, the above CI-AKI diagnostic kit and FISH staining method were used to explore the expression of SLC38A2-AS1 in patients with acute tubular injury. The specific method is as follows:

[0142] Embedding the renal tissue wax blocks of patients with acute tubular necrosis, and cutting wax blocks with a thickness of 4 μm for subsequent renal tissue FISH experiments. This experiment uses the paraffin section RNA FISH kit (F11301) of GenePharma Co., Ltd., specifically including:

[0143] ① Deparaffinization: Preheat the paraffin sections in an oven at 60 ºC for 30 min; Immerse the sections in xylene I and II for 10 min each; Incubate in gradient alcohol (100%, 95%, 90%, 80%, 70%) at room temperature for 1 min each; Wash the sections twice with PBS, 2 min each time.

[0144] ② Protease treatment: Preheat the protease K dilution solution to 37 ºC; Add 100 μL of the protease K dilution solution to each section and incubate at 37 ºC for 20 min; Add 100 μL of 2×Buffer C solution to each section and wash the sections 3 times at room temperature, 1 min each time; Dehydrate with gradient alcohol 70%, 80%, 90%, 100%, 2 min each time, and air dry.

[0145] ③ Denaturation: Preheat the denaturing solution at 78 ºC; Add 100 μL of the preheated denaturing solution to each section and incubate at 78 ºC for 8 min; Dehydrate with gradient alcohol 70%, 80%, 90%, 100%, 2 min each time, and air dry.

[0146] ④ Hybridization: Incubate Buffer E in a water bath at 73 ºC for 30 min until it becomes clear and transparent; Prepare the probe (i.e., the SLC38A2-AS1 FISH staining probe, and the sequence information is shown in Table 3) mixture: Taking 100 μL of the probe mixture with a concentration of 8 μM as an example, add 8 μL of the probe to 92 μL of Buffer E, with a total system of 100 μL, and denature at 73 ºC for 5 min; Prepare a wet box, place the sections horizontally, add 10 μL of the denatured probe mixture to each section, cover with a coverslip, and seal with mounting glue; Place in an in situ hybridization instrument and incubate at 37 ºC for 12 - 16 h.

[0147] ⑤ Post-hybridization washing: Preheat the post-hybridization washing solution at 43 ºC; Gently remove the coverslip, aspirate the probe mixture, add 100 μL of the preheated post-hybridization washing solution to each section and wash the sections for 15 min; Add 100 μL of 2×Buffer C (preheated to 37 ºC) to each section and wash 2 times, 10 min each time; Wash the sections once with PBS, 10 min.

[0148] ⑥Nuclear staining: Add 100 μL of diluted DAPI working solution to each section, incubate in the dark at room temperature for 20 min; aspirate the DAPI working solution, wash the sections twice with PBS for 2 min each time; add glycerol or anti-quenching agent dropwise, cover with a coverslip, seal with mounting medium, and observe under a fluorescence microscope.

[0149] The results of fluorescence staining are as Figure 5 shown in A of

[0150] Example 5: Changes of SLC38A2-AS1 in an in vitro CI-AKI cell model

[0151] In this example, the above CI-AKI diagnostic kit was used in combination with the cell FISH staining method to detect the changes of SLC38A2-AS1 in an in vitro CI-AKI cell model. The preparation method of the in vitro CI-AKI cell model includes: inoculating adherent cells into a 48-well plate (with a special coverslip for 48-well plates already placed inside) at a density of 1×10 4 cells / well, and culturing overnight in an incubator at 37°C and 5% CO2. After 12 h, the iohexol group was treated with 200 mg I / mL iohexol to treat HK-2 cells for 6 hours, and the control group was treated with an equal dose of culture medium.

[0152] The specific implementation steps of cell FISH staining are as follows:

[0153] (1) Fixation with paraformaldehyde: Aspirate the culture medium, wash twice with PBS for 5 min each time. Aspirate the PBS, add 100 μL of 4% paraformaldehyde to each well, and fix at room temperature for 15 min.

[0154] (2) Treatment with Buffer A: Aspirate the 4% paraformaldehyde, add 100 μL of 0.1% Buffer A (prepared freshly) to each well, and treat the cells at room temperature for 15 min. Aspirate the 0.1% Buffer A, wash twice with PBS for 5 min each time.

[0155] (3) Treatment with Buffer C: Aspirate the PBS, add 100 μL of 2×Buffer C to each well, and place in an incubator at 37°C for 30 min.

[0156] (4) Preparation of probe mixture: Buffer E was pre-incubated in a 73°C water bath for 30 min until it became clear and transparent. Prepare a probe mixture with a concentration of 8 μM and a volume of 100 μL, and denature at 73°C for 5 min.

[0157] (5) Hybridization: Discard 2×Buffer C, add 100 μL of the denatured probe mixture to each well, place it in a 37ºC incubator overnight for hybridization under light-proof conditions.

[0158] (6) Washing: The next day after hybridization, take out the samples from the 37ºC incubator, discard the probe mixture, add 100 μL of pre-warmed 0.1% Buffer F at 42ºC to each well and wash for 5 min. Discard 0.1% Buffer F, add 100 μL of pre-warmed 2×Buffer C at 42ºC to each well and wash for 5 min. Discard 2×Buffer C, add 100 μL of pre-warmed 1×Buffer C at 42ºC to each well and wash for 5 min, then discard the washing solution.

[0159] (7) DAPI staining: Add 100 μL of the diluted DAPI working solution to each well, stain for 20 min under light-proof conditions. Discard the DAPI working solution, wash twice with PBS, 5 min each time.

[0160] (8) Mounting: Drop glycerol or anti-quenching agent on a clean glass slide, cover the cell culture insert with the cell side facing down on the glass slide, and observe under a fluorescence microscope.

[0161] The detection results are shown in B and C of Figure 5 , showing that in vitro, SLC38A2-AS1 FISH fluorescence staining found that the expression in HK-2 cells after iodine contrast agent intervention was significantly increased ( Figure 5 shown in B of Figure 5 ). Further qPCR detection was performed on it, and the detection results ( shown in C of

[0162] ) were consistent with the FISH staining results.

[0163] Example 6: Expression inhibitor of SLC38A2-AS1 molecule

[0164] This example provides an expression inhibitor of SLC38A2-AS1 molecule, which is a reagent Smart silencer designed specifically for knocking down SLC38A2-AS1, consisting of 3 siRNAs and 3 ASOs, synthesized by Ribobio. The specific target sequences of ASO and siRNA are shown in Table 4 below.

[0165] Table 4: Sequence information of the expression inhibitor of SLC38A2-AS1 molecule

[0166]

[0167] Example 7: Application of the expression inhibitor of SLC38A2-AS1 molecule in the preparation of products for treating CI-AKI

[0168] This example provides the application of the above-mentioned expression inhibitor of SLC38A2-AS1 molecule in the preparation of products for treating acute kidney injury caused by iodinated contrast agents, and verifies that knocking down SLC38A2-AS1 can relieve the decrease in the activity of HK-2 cells treated with iodinated contrast agents, and at the same time reduce apoptosis and ferroptosis of HK-2 cells treated with iodinated contrast agents. The specific experimental process is as follows:

[0169] 1. Cell culture and transfection:

[0170] (1) Cell seeding and reagent treatment:

[0171] Seeding cells in a 6-well plate: Take a dish of cells, after digestion and centrifugation, resuspend them in 1 mL of medium, fully pipette them evenly, and then add an additional 2 mL of medium for dilution. Take 2 mL of the diluted cell suspension and evenly seed it in the 6-well plate, and place it in the incubator for culture.

[0172] Seeding cells in a 96-well plate: Take the remaining 1 mL of the cell suspension mentioned above, count the cells in this 1 mL of cell suspension using a counting plate and a microscope, and at the same time calculate the number of cells required for the 96-well plate and the total volume of the liquid. Seed the cells in the 96-well plate at a density of 5000 cells / 100 μL per well.

[0173] (2) Transfection:

[0174] When the cell density reaches 40%-50% of the above volume, use 100 μM Smart silencer in combination with Ribobio transfection reagent for transfection. After 24 hours, change the medium. At the 48th hour of transfection, add 200 mg I / mL iohexol to treat HK-2 cells for 6 hours. Control group: Treat with the same dose of culture medium.

[0175] 2. Cell viability detection:

[0176] Perform a CCK8 experiment (cell viability detection) on a 96-well plate: Add CCK8 reagent to the medium without serum and antibiotics (the amount of reagent added is: add 10 μL of CC8 reagent to every 100 μL of medium). After the stimulation is completed, add the above-prepared medium containing CCK8 reagent to the 96-well plate, and add 100 μL of volume to each well.

[0177] 3. WB experiment:

[0178] After the above six-well plates were stimulated, they were washed 3 times with PBS, and RIPA lysis buffer containing protease inhibitor was added. After lysing on ice for half an hour, a cell scraper was used to collect the cells. The collected cells were sonicated, and after centrifuging to extract the supernatant, the protein concentration of the supernatant was measured. After the measurement was completed, Loading buffer was added. Electrophoresis, membrane transfer, blocking, incubation with primary antibody, incubation with secondary antibody, and exposure were performed on the prepared protein. Gray value analysis was performed on the exposed bands.

[0179] 4. MDA experiment:

[0180] The determination of lipid peroxidation was carried out according to the instructions of the malondialdehyde (MDA) assay kit (S0131, Beyotime).

[0181] 5. DHE experiment:

[0182] The determination of reactive oxygen species (ROS) was carried out according to the instructions of DHE staining (USEVERBRIGHT, Cat#: D1008).

[0183] Based on the above methods, the knockdown efficiency of SLC38A2-AS1 smart silencer was first detected. The qPCR results showed that SLC38A2-AS1 was successfully knocked down (as shown in A of Figure 6 ). The CCK8 results showed that knocking down SL38A2-AS1 could alleviate the decrease in the activity of HK-2 cells induced by iodinated contrast agent (as shown in B of Figure 6 ). In addition, the MDA results showed that knocking down SLC38A2-AS1 alleviated the level of lipid peroxidation in HK-2 cells treated with iodinated contrast agent (as shown in C of Figure 6 ); the WB results showed that knocking down SLC38A2-AS1 would alleviate the decrease of ferroptosis markers GPX4, FTH1, and NCOA4 (as shown in A - D of Figure 7 ), indicating that knocking down SLC38A2-AS1 would also alleviate ferroptosis induced by iodinated contrast agent; DHE staining showed that knocking down SLC38A2-AS1 would reduce the production of ROS in HK-2 cells treated with iodinated contrast agent (as shown in Figure 8 ).

[0184] In addition, the WB results showed that knocking down SLC38A2-AS1 decreased the level of the apoptosis marker Cleaved caspase-3 and increased the Bcl-2 / BAX ratio in HK-2 cells treated with iodinated contrast agent, alleviating apoptosis induced by iodinated contrast agent (as shown in Figure 9 ).

[0185] In summary, knocking down SLC38A2-AS1 alleviated the decrease in the viability of HK-2 cells induced by iodinated contrast agents, and reduced the occurrence of apoptosis and ferroptosis.

[0186] Example 8: Overexpression of SLC38A2-AS1 exacerbates ferroptosis in HK-2 cells treated with iodinated contrast agents

[0187] The above examples have demonstrated that knocking down SLC38A2-AS1 can alleviate ferroptosis in HK-2 cells treated with iodinated contrast agents. To verify whether overexpression of SLC38A2-AS1 has the opposite effect to knocking down SLC38A2-AS1, an overexpression plasmid of SLC38A2-AS1 was used in this example, and cell viability experiments, MDA experiments, WB experiments and ROS experiments were carried out. The nucleotide sequence information of the SLC38A2-AS1 overexpression plasmid is as follows:

[0188] GATTCATCCCAGGCCAGGCGAGTGGAAAAGTACCAGCCGCGCGCGAGGGGCGGGGGCGCGCCGAGGGGCGGAAAAGTACAGACGGCGGAGCCGCGGGGAGAACAAAGATGATGCCACCGCTGTGTTGCGGCCGTCGAGGCCCCCTACTCCGGCAGATTTCAACCTGCTTTCACTCTTCAAAACTAGCCGGAGGTCGGCGAGCAGCTCCTTTTCGGGATGTGCTTTTTGTACGGCCATGGAAACTGGACTAGCGGAAAGGCTACCTTTTGGCCAGCAAGCCAGGCCCCTTAGAAAGAGGCCCCAGTGGGGAGCCCGGCGCTCCTAAGGCCGTTTGGGAGTCCCCAGTTTTCCACTCGCTGACACGTTGCTTCTCTTATCCCACCACCGCCGCCCCGGGCAAAGGCACTGCCTTGTCTGAATGCGGGTCTGAGGCGCTTTCTGCGGAGCCTGGTCCTTTCCCTTCAATGGTGATGTGTGTGGTCTTGCTGAGCCAGGCAACTAGGGGGACCCTTCGCTGTGGAAAAATTGGTGCTGCGGGAAAGGCAAGACTCACTCCCTTGCAGGAAACAAAGACCCCTTAGGAGAGAGAAATGTTCATGGAATGAATGAATAAACAAGTTTGACCTA (SEQ ID NO.14).

[0189] The methods of cell viability assay, MDA assay, WB assay and ROS assay refer to those described in the above embodiments. There are differences in the cell transfection process. When the cell density reaches about 70%, transfection is prepared as follows: Prepare two 1.5 ml ep tubes, labeled as tube A and tube B. Add 250 μL of Opti-MEM to each tube. Add 2.5 μg of plasmid to tube A and 5 μL of lip3000 to tube B. After standing for 5 min, mix the liquids in tubes A and B and then stand for 10 min to obtain the plasmid and lip3000 transfection mixture. Remove the medium in the culture dish, rinse it once with PBS, add 1.5 mL of serum-free and antibiotic-free medium, and add the above 500 μL of transfection mixture to the culture dish for transfection.

[0190] The verification results are as Figure 10 shown, Figure 10 A in [reference] shows that the overexpression efficiency of the SLC38A2-AS1 plasmid is high, indicating that the plasmid construction is successful. The verification results show that overexpression of SLC38A2-AS1 will further decrease the cell viability of HK-2 cells treated with iodinated contrast agent ( Figure 10 as shown in B in [reference]), and increase the production of lipid peroxidation product malondialdehyde (MDA) ( Figure 10 as shown in C in [reference]), and further decrease the levels of ferroptosis markers GPX4 and FTH1 ( Figure 10 as shown in D-F in [reference]), and further increase the intracellular reactive oxygen species (ROS) level ( Figure 10 as shown in G in [reference]).

[0191] The above results show that overexpression of SLC38A2-AS1 will further decrease the cell viability of HK-2 cells treated with iodinated contrast agent, and at the same time exacerbate the ferroptosis of HK-2 treated with iodinated contrast agent.

[0192] Example 9: Application of SLC38A2-AS1 in regulating the expression of its neighboring gene SLC38A2

[0193] Based on relevant research reports, LncRNA can regulate its neighboring genes to play corresponding functions. The neighboring gene of SLC38A2-AS1 is SLC38A2, which is a solute amino acid transporter receptor and can play a protective role in the ferroptosis of collecting duct cells in the renal medulla under hypertonic conditions. Therefore, the present invention speculates that SLC38A2-AS1 may regulate ferroptosis through SLC38A2. Based on this, the following research was carried out:

[0194] First, the expression level of SLC38A2 was detected by WB and cell immunofluorescence detection (as Figure 11As shown in A - C in [reference], it was found that the expression of SLC38A2 was up - regulated in HK - 2 cells treated with iodine contrast agent. Then, in this example, referring to the above - mentioned example, SLC38A2 - AS1 was knocked down or over - expressed using the SLC38A2 - AS1 smart silencer and the plasmid of SLC38A2 - AS1. The WB results showed that knocking down SLC38A2 - AS1 up - regulated the expression of SLC38A2 (as shown in A and B in [reference]), and over - expressing SLC38A2 - AS1 down - regulated the expression of SLC38A2 (as shown in C and D in [reference]). Figure 12 As shown in A and B in [reference], Figure 12 as shown in C and D in [reference].

[0195] In summary, the expression of SLC38A2 was up - regulated in HK - 2 cells treated with iodine contrast agent and was negatively regulated by SLC38A2 - AS1.

[0196] Example 10: Knocking down SLC38A2 exacerbates iodine contrast agent - induced ferroptosis in HK - 2 cells

[0197] To explore the role of SLC38A2 in iodine contrast agent - induced ferroptosis in HK - 2 cells, a knockdown experiment was performed using siRNA of SLC38A2 in this example. The siRNA sequence information is as follows:

[0198] SLC38A2 - Homo - siRNA1: GUGGUCAUUUGCAAGAAAUTTAUUUCUUGCAAAUGACCACTT (SEQ.IDNO.15);

[0199] SLC38A2 - Homo - siRNA2: GUACCUGCUUUGUCACAUATTUAUGUGACAAAGCAGGUACTT (SEQ.ID NO.16);

[0200] SLC38A2 - Homo - siRNA3: GUGUCUAUCUUGGCAUUUATTUAAAUGCCAAGAUAGACACTT (SEQ.IDNO.17);

[0201] SLC38A2 - Homo - siRNA4: GGCUAAUACUGGAAUUGCUTTAGCAAUUCCAGUAUUAGCCTT (SEQ.IDNO.18).

[0202] Note: "TT" in the above siRNA is a hanging structure, which is a specific structure to increase the stability of siRNA.

[0203] WB, CCK8 and DHE staining experiments were performed on HK-2 cells after knocking down SLC38A2. The WB results showed that all 4 siRNAs of SLC38A2 successfully knocked down the protein expression of SLC38A2 (as shown in A and B of Figure 13 ), and SLC38A2 siRNA 4 was used for the following experiments. The CCK8 results showed that knocking down SLC38A2 exacerbated the decrease in the viability of HK-2 cells induced by iodinated contrast agent (as shown in C of Figure 13 ), and the WB results showed that knocking down SLC38A2 further decreased GPX4 in HK-2 cells treated with iodinated contrast agent (as shown in D-F of Figure 13 ). The DHE staining results showed that knocking down SLC38A2 increased the production of reactive oxygen species in HK-2 cells treated with iodinated contrast agent (as shown in G of Figure 13 ).

[0204] The above results showed that SLC38A2 is a protective factor, and knocking down SLC38A2 exacerbated iodinated contrast agent-induced ferroptosis in HK-2 cells.

[0205] In summary, the present invention provides the application of SLC38A2-AS1 as a diagnostic biomarker for contrast-induced acute kidney injury. The present invention demonstrates through experiments that SLC38A2-AS1 is upregulated in the serum of patients with contrast-induced acute kidney injury, the renal tissue with acute tubular injury, and the renal tubular epithelial cells treated with iodinated contrast agent, and has excellent early diagnostic performance. At the same time, knocking down SLC38A2-AS1 alleviated the decrease in the viability of human renal tubular epithelial cells (HK-2) induced by iodinated contrast agent. More specifically, knocking down SLC38A2-AS1 reduced the degree of apoptosis and ferroptosis caused by iodinated contrast agent in HK-2 cells, indicating that knocking down SLC38A2-AS1 has a protective effect on contrast-induced acute kidney injury and can provide new ideas for the diagnosis and treatment of CI-AKI.

[0206] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made without departing from the spirit of the present invention within the knowledge of those of ordinary skill in the art. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of a substance for detecting the SLC38A2-AS1 gene in the preparation of a product for screening and / or diagnosing acute kidney injury, wherein the SLC38A2-AS1 gene is a long non-coding RNA, and the cDNA sequence of the SLC38A2-AS1 gene is as shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that The substance for detecting the SLC38A2-AS1 gene includes a probe having a sequence complementary to the SLC38A2-AS1 gene, and / or primers for detecting the SLC38A2-AS1 gene.

3. The application according to claim 1, wherein The acute kidney injury includes nephrotoxic acute kidney injury, acute kidney injury caused by ischemia-reperfusion, or acute kidney injury caused by sepsis.

4. The application according to any one of claims 1 to 3, characterized in that, The product includes at least one of a reagent, a kit, a test strip, and a chip.

5. Use of a substance that specifically reduces the expression level of the SLC38A2-AS1 gene in the preparation of a product for treating and / or preventing acute kidney injury, characterized in that, The SLC38A2-AS1 gene is a long non-coding RNA, and the cDNA sequence of the SLC38A2-AS1 gene is as shown in SEQ ID NO.1; The substance that specifically reduces the expression level of the SLC38A2-AS1 gene is a nucleotide sequence as shown in SEQ ID NO.8 to SEQ ID NO.13.

Images