A method and application for detecting TA repetitive sequence polymorphism in the UGT1A1 gene based on nucleic acid mass spectrometry.
By using single-base extension technology and nucleic acid mass spectrometry platform, a genotyping method for the UGT1A1 gene promoter region (TA)n repeats was designed, which solves the problems of poor genotyping effect and high cost in the existing technology for UGT1A1 gene polymorphism detection, and realizes efficient and low-cost polymorphic site detection.
Patent Information
- Application Number
- CN202510150212.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-11
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2045-02-11
AI Technical Summary
Existing technologies are difficult to efficiently and cost-effectively detect TA repetitive sequence polymorphisms in the UGT1A1 gene, especially the UGT1A1*28 and UGT1A1*6 polymorphisms. Conventional methods suffer from poor genotyping performance, low throughput, and high cost.
A method for genotyping the (TA)n repeat of the UGT1A1 gene promoter region was designed using single-base extension technology and a nucleic acid mass spectrometry platform. By adjusting the base type in the extension reaction and introducing locked nucleic acid (LNA), primer dimer formation was avoided, enabling accurate differentiation of (TA)5, (TA)6, and (TA)7. This method was then combined with nucleic acid mass spectrometry for multiplex detection.
Accurate typing of the UGT1A1 gene promoter region (TA)n repeat sequence was achieved, enabling the detection of 12 polymorphic sites in one well, reducing costs, increasing detection throughput, and providing simple operation with high sensitivity and specificity, thus overcoming the shortcomings of existing technologies.
Smart Images

Figure CN119876399B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and in particular relates to a method and application for detecting TA repetitive sequence polymorphisms in the UGT1A1 gene based on nucleic acid mass spectrometry. Background Technology
[0002] Irinotecan (CPT-11) is an important anticancer drug commonly used to treat metastatic colorectal cancer and other solid tumors. Irinotecan belongs to the class of topoisomerase inhibitors. In the body, it is hydrolyzed into its active metabolite SN-38. SN-38 inhibits the activity of topoisomerase I by binding to it, thereby interfering with DNA replication and repair in cancer cells. This prevents cancer cells from dividing and proliferating normally, ultimately leading to cancer cell death. SN-38 is subsequently inactivated by glucuronidation (SN-38G) mediated by UGT1A1, thus protecting healthy cells from the toxic effects of irinotecan. The most common adverse reactions to irinotecan are delayed diarrhea and neutropenia, which can be fatal in severe cases.
[0003] UGT1A1 is a key enzyme in the conversion of the active product irinotecan SN-38 to the inactive product SN-38G. Therefore, UGT1A1 gene polymorphisms are closely related to the adverse reactions of irinotecan. The most common polymorphic sites are UG T1A1*28 and UGT1A1*6, which have been extensively studied and can be used to predict the toxic side effects caused by irinotecan. Studies have also shown that other polymorphic sites of UGT1A1, such as UGT1A1*27, UGT1A1*60, and UGT1A1*93, are also significant in predicting the toxic side effects of irinotecan. As early as 2005, the US FDA required the inclusion of a warning in the irinotecan drug package insert, recommending that patients undergo UGT1A1*28 testing before using the drug and carefully consider the dosage based on the mutation type. In addition, some reports indicate that the genetic polymorphism of transporters involved in the uptake and efflux of irinotecan and its metabolites is also one of the reasons for individual differences in irinotecan toxicity. These transporters include OATP1B1 (SLCO1B1) and ABC transporters, including ABCC2, ABCB1, and ABCG2. Therefore, in addition to detecting UGT1A1 mutation types, polymorphic sites of other related genes also need to be detected to better guide irinotecan use.
[0004] Currently, methods for detecting UGT1A1 and other gene polymorphisms mainly include qPCR, Sanger sequencing, PCR-capillary electrophoresis, and gene chips. Among these polymorphic sites, UGT1A1*28 has 7 TA repeat sequences, while its wild-type (UGT1A1*1) has 6 TA repeat sequences. This special mutation type presents certain challenges for conventional qPCR detection methods. qPCR requires the design of specific probes and primers. Following traditional design approaches, whether the probe or primer is placed on the TA repeat region, due to the large number of TA repeats and the fact that the wild-type and mutant types differ by only one TA repeat, during amplification, primers or probes are prone to mismatches with the TA repeat region or the formation of primer dimers and hairpin structures, resulting in poor genotyping. Furthermore, qPCR has low throughput and cannot detect multiple sites simultaneously in a single well. While Sanger sequencing can distinguish TA repeat sequences well, this method is cumbersome, has low throughput, and is costly. PCR-capillary electrophoresis is also recommended for the detection of UGT1A1*28 polymorphism, but it is difficult to determine the exact mutation site for point mutations, resulting in poor detection performance. It generally needs to be combined with other techniques, such as ASA. Matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF-MS) is often used for SNP detection, featuring high throughput, ease of operation, high sensitivity, and simple result interpretation. Primer design is also relatively simple, requiring no fluorescent probes or dyes. Summary of the Invention
[0005] This invention designs a method for genotyping the (TA)n repeats in the promoter region of the UGT1A1 gene based on single base extension technology and nucleic acid mass spectrometry platform. While avoiding the formation of hairpin structures and dimers between primers, it can accurately distinguish (TA)5, (TA)6 and (TA)7. Furthermore, this design concept is not limited to the detection of this type of polymorphism; it can also be applied to the detection of the same type of repeat polymorphism with slight adjustments.
[0006] Nucleic acid mass spectrometry experiments mainly consist of four parts: enrichment, digestion, extension, and detection. The extension reaction refers to the process where a single-base extension primer (UEP) terminates after binding to the target gene with only one base during annealing. The reaction system typically contains four ddNTPs without 3'-OH: acyATP, acyCTP, acyGTP, and a modified acyTTP. This invention adds only acyCTP and acyGTP to the extension reaction system as termination bases, while ordinary dATP and dTTP are added for A and T bases. Therefore, after the UEP binds to the target gene, if the next base of the template is C or G, the extension terminates after one base. If the next base is A or T, the extension will not terminate after T or A extensions, but will continue until a G or C base is encountered. To detect polymorphisms in the (TA)n repeat region of the UGT1A1 gene promoter region, and to avoid non-specific extension caused by primer dimers, the UEP sequence designed in this invention contains only three TAs from the (TA)n repeat sequence, and introduces a locked nucleic acid to improve sequence specificity. If it is wild-type (TA)6, the UEP will first extend for seven A and T bases during the extension process, and finally terminate at a G base (e.g., ...). Figure 1 If it is mutant (TA)7, then during the extension process, 9 A and T bases are extended first, and finally it terminates at a G base; if it is mutant (TA)5, then during the extension process, 5 A and T bases are extended first, and finally it terminates at a G base. The difference between them is one TA molecular mass, so they can be accurately distinguished.
[0007] Furthermore, in order to ensure complete UEP conversion and reduce intermediate products when using the above detection method, this invention also provides an optimized extended reaction procedure, the specific reaction conditions of which are shown in the table below:
[0008]
[0009] This invention also provides an irinotecan-related gene polymorphism detection kit, which can detect multiple gene mutations at multiple sites in a single well, with high sensitivity and simple operation. The technical solution is as follows:
[0010] After reviewing a large amount of data, 12 genetic polymorphism loci related to irinotecan use were finally identified, including UGT1A1*28 (rs3064744), UGT1A1*6 (rs4148323), UGT1A1*27 (rs35350960), UGT1A1*60 (rs4124874), UGT1A1*93 (rs10929302), and ABCC2.
[0011] 3972C>T(rs3740066), ABCC21249G>A(rs2273697), ABCC2-24C>T(rs717620), ABCB11236C>T(rs1 128503), SLCO1B1388A>G (rs2306283), SLCO1B1521T>C (rs4149056) and ABCG2421C>A (rs2231142).
[0012] Primers and UEPs for amplification at these 12 sites were designed using the novel design approach described above. Considering the large number of primers and the potential for primer dimer formation, the Multiple Primer Analyzer website was used to analyze primer interactions among all designed primers. Primers exhibiting severe primer dimerization or non-specific binding at the 3' end were removed, and new primers were designed. Multiple sets of amplification primers and UEPs can be designed for each mutation site to facilitate subsequent screening and validation.
[0013] Using DNA extracted from whole blood samples as templates, the designed amplification primers and UEP (Underlying Elevation Precipitator) were screened and validated. The quality of the amplification primers was validated using capillary electrophoresis to detect the presence of the target amplification fragment, the presence of obvious non-specific products, and the primer amplification efficiency. UEP was detected using nucleic acid mass spectrometry to detect the generation of the target extension product, the extension conversion efficiency, and the presence of non-specific extension products. Based on all the above tests, the final primer sequences are as follows:
[0014]
[0015]
[0016]
[0017] In the primer set, SEQ ID NO.1 to 24 are the amplification primer sequences for each mutation site, and SEQ ID NO.25 to 36 are the UEP sequences for each site. In the UGT1A1*28_U2_LNA (SEQ ID NO.25) primer, "C+" indicates that the C base is modified with LNA.
[0018] The irinotecan-related gene polymorphism detection kit provided by this invention contains all of the above primers.
[0019] In addition to the primer set described above, the kit also includes reagents required for the three rounds of reactions, including a premixed solution for the enrichment reaction, namely PCR buffer, dNTPs, MgCl2 and Taq DNA polymerase; a digestion buffer and SAP enzyme for the digestion reaction; an extension buffer, UEP enzyme, acyCTP, acyGTP, dATP and dTTP for the extension reaction; and nuclease-free water required for the three rounds of reactions.
[0020] This invention also provides an experimental method for detecting irinotecan-related gene polymorphism sites based on nucleic acid mass spectrometry, specifically including the following steps:
[0021] (1) Using the DNA of the sample to be tested as a template, the first round of enrichment reaction amplification was carried out, which included all the above amplification primers, namely SEQ ID NO.1~24;
[0022] (2) The enriched product was digested with SAP enzyme to remove excess dNTPs;
[0023] (3) Perform a single-base extension reaction on the digestion product, which contains all of the above-mentioned UEPs, namely SEQ ID NO.25~36;
[0024] (4) Resin purification and extension products to remove salt ions;
[0025] (5) Time-of-flight mass spectrometry detection and analysis.
[0026] Compared with the prior art, the present invention has the following beneficial effects:
[0027] (1) A method for genotyping the UGT1A1 gene promoter region (TA)n repeats based on single-base extension technology and a nucleic acid mass spectrometry platform was designed. For this special mutation type, primers designed according to traditional nucleic acid mass spectrometry primer design ideas are very prone to non-specific extension in experiments. This invention cleverly adjusts the base type and composition in the extension reaction to achieve accurate genotyping of the UGT1A1 gene promoter region (TA)n repeat sequences. Furthermore, this design idea is not limited to the detection of this type of polymorphism; it is also applicable to the detection of the same type of repeat polymorphism by slightly adjusting the bases in the extension reaction.
[0028] (2) In addition to the two common polymorphic sites of irinotecan-related genes, UGT1A1*28 and UGT1A1*6, this invention also provides detection of other polymorphic sites of UGT1A1 and polymorphic sites of genes ABCC2, ABCB1, ABCG2 and SLCO1B1, providing more references for irinotecan medication guidance.
[0029] (3) This invention utilizes a nucleic acid mass spectrometry platform to perform multiplex detection of irinotecan-related gene polymorphisms, enabling the detection of 12 polymorphic sites in a single well. This method is cost-effective and requires minimal sample volume. Furthermore, nucleic acid mass spectrometry offers advantages such as ease of operation, high sensitivity, high specificity, and high accuracy, while also overcoming the limitations of insufficient throughput in qPCR and high costs associated with sequencing technology. Attached Figure Description
[0030] Figure 1 This is a schematic diagram of the method for genotyping the UGT1A1 gene promoter region (TA)n repeats according to the present invention.
[0031] Figure 2 This is the mass spectrum of the extension primer UGT1A1*28_U3 used in Example 1 with nuclease-free water as the sample.
[0032] Figure 3 This is the mass spectrometry peak diagram of the extension primer UGT1A1*28_U4 used as a sample in Example 1 with human genomic DNA as the sample.
[0033] Figure 4 This is the mass spectrometry peak diagram of the extension primer UGT1A1*28_U2 used as a sample in Example 1 with human genomic DNA as the sample.
[0034] Figure 5 This is a mass spectrometry peak diagram of the wild-type UGT1A1*1 / *1 sample in Example 2.
[0035] Figure 6 This is a mass spectrometry peak diagram of the homozygous mutant UGT1A1*28 / *28 sample in Example 2.
[0036] Figure 7 This is a mass spectrometry peak diagram of the heterozygous mutant UGT1A1*1 / *28 sample in Example 2. Detailed Implementation
[0037] Example 1
[0038] 1. Primer design
[0039] To detect the polymorphism of the promoter region (TA)n of the UGT1A1 gene, corresponding enrichment and extension primers were designed. The feasibility of the scheme was preliminarily investigated and suitable single-base extension primers were screened.
[0040] Primer name Primer sequence SEQ ID NO. UGT1A1*28_F1 acgttggatgAACATTAACTTGGTGTATCGATTGGT 1 UGT1A1*28_R1 acgttggatgAGCAGGCCCAGGACAAGT 2 UGT1A1*28_U1 CCTCTCCTACTTATATA 37 UGT1A1*28_U2 CCTCTCCTACTTATATATA 38 UGT1A1*28_U3 CCTCTCCTACTTATATATATA 39 UGT1A1*28_U4 CCTCTCCTACTTATTTATATA 40
[0041] 2. Preparation of reaction solution
[0042] Prepare enrichment, digestion, and extension reaction solutions according to the following formula table. Prepare the corresponding extension reaction solutions according to the four UEPs. U1, U2, U3, and U4 are prepared as reaction system 1, reaction system 2, reaction system 3, and reaction system 4, respectively. The PCR buffer (pH 7.5) contains 100 mM (NH4)2SO4, 500 mM KCl, and 200 mM HEPES, with a pH of 7.5. The digestion buffer contains 200 mM Tris-HCl and 100 mM MgCl2, with a pH of 8.0. The extension buffer contains 200 mM Tris-HCl, 100 mM (NH4)2SO4, 100 mM KCl, 20 mM MgSO4, and 1% Triton-X, with a pH of 8.8.
[0043] Table 1. Formulation of enrichment reaction solution
[0044]
[0045] Table 2 Digestion reaction solution formulation
[0046]
[0047] Table 3 Formulation of Extended Reaction Solution
[0048]
[0049] 3. Enrichment and Amplification
[0050] Prepare the enrichment reaction system according to the ratio of "3 μL enrichment reaction solution + 0.2 μL Taq enzyme". After mixing and centrifuging, dispense 3.2 μL per person into eight-tube strips. Add 2 μL of human genomic DNA (10 ng / μL) to reaction wells 1, 3, 5 and 7, and add 2 μL of nuclease-free water to reaction wells 2, 4, 6 and 8. Carefully cap the tubes, centrifuge quickly and then perform PCR amplification. The PCR amplification program is shown in Table 4.
[0051] Table 4. Enrichment Reaction PCR Amplification Procedure
[0052]
[0053] 4. Digestion reaction
[0054] Prepare the digestion reaction system according to the ratio of "1.7 μL digestion reaction solution + 0.3 μL SAP enzyme". After mixing and centrifuging, add 2 μL to each well of the eight-tube strip after the above reaction is completed. Carefully cap the tubes, centrifuge quickly, and then perform the digestion reaction according to the PCR procedure in Table 5.
[0055] Table 5. Digestion Reaction PCR Amplification Program
[0056]
[0057] 5. Extension reaction
[0058] Four different extension reaction systems were prepared according to the ratio of "3 μL extension reaction solution + 0.04 μL L EP enzyme". After mixing and centrifugation, extension reaction system 1 was added to wells 1 and 2 of the eight-tube strip after the above reaction was completed, with a volume of 3 μL per well. Extension reaction system 2 was added to wells 3 and 4, extension reaction system 3 to wells 5 and 6, and extension reaction system 4 to wells 7 and 8. The tubes were carefully capped, and after rapid centrifugation, the extension reaction was carried out according to the PCR procedure in Table 6.
[0059] Table 6. Extension Reaction PCR Amplification Procedure
[0060]
[0061] 6. On-machine testing
[0062] After the reaction is complete, remove the eight-tube strip and add 40 μL of nuclease-free water to each well sequentially, then transfer the solution to a 96-well plate, taking care to avoid generating air bubbles. Transfer the 96-well plate to the DR MassARRAY fully automated system for analysis. After the run is complete, check the generated mass spectrometry peaks.
[0063] 7. Results Analysis
[0064] Upon reviewing the test results for nuclease-free water, non-specific extension products were found in extension reaction system 3. Figure 2 This indicates that primer dimers were generated during the reaction of extension primer UGT1A1*28_U3, resulting in both A and AG product peaks, making it unsuitable. Upon reviewing the human genomic DNA detection results, it was found that extension reaction system 4 did not produce any corresponding extension product peaks. Figure 3 This indicates that while the extension primer UGT1A1*28_U4 does not produce primer dimers when an artificially mutated base is introduced, it cannot properly extend the target base and is therefore unsuitable. Neither UGT1A1*28_U1 nor UGT1A1*28_U2 produces primer dimers and both have extension products, but incomplete extension results in a large number of intermediate products. Figure 4 Considering that UGT1A1*28_U1 produces more intermediate products than UGT1A1*28_U2 during extension, UGT1A1*28_U2 was ultimately selected as the extension primer for subsequent system optimization to improve the extension efficiency of the target product.
[0065] Example 2
[0066] 1. Optimize the approach
[0067] To improve the extension efficiency of the extension primer UGT1A1*28_U2 during the extension reaction and avoid incomplete intermediate extension products, this invention adds LNA modification to the extension primer UGT1A1*28_U2 (primer sequences are shown in the table below) to accommodate higher annealing temperatures. Furthermore, high-fidelity Taq enzyme is used in the enrichment reaction to improve amplification accuracy. Simultaneously, the PCR amplification program for the extension reaction is adjusted, including gradually increasing the annealing temperature and extending the annealing reaction time, to achieve complete extension.
[0068]
[0069]
[0070] 2. Sample processing
[0071] In this embodiment, three human genomic DNA samples were collected and confirmed by sequencing to be UGT1A1 gene *1 / *1, *1 / *28, and *28 / *28 genotypes. Each sample was diluted to 10 ng / μL according to the sample concentration for detection in this embodiment.
[0072] 3. Amplification reaction
[0073] The enrichment reaction solution was prepared according to the formulation table in Table 7; the digestion reaction solution and extension reaction solution were prepared according to the formulation table in Example 1, wherein the extension primer was replaced with UGT1A1*28_U2_LNA (SEQ ID NO.25).
[0074] Table 7. Enrichment reaction solution formulation (optimized)
[0075]
[0076] Take 3 μL of enrichment reaction solution and add 2 μL of the above sample to each sample. Follow the amplification program set in Table 4 of Example 1 to perform enrichment amplification.
[0077] Prepare digestion reaction systems according to the ratio of "1.7 μL digestion reaction solution + 0.3 μL SAP enzyme", take 2 μL of each system and add it to the enriched amplification product. Set the amplification program according to Table 5 in Example 1 and carry out the digestion reaction.
[0078] Prepare the extension reaction system according to the ratio of "3 μL extension reaction solution + 0.04 μL UEP enzyme", and add 3 μL of each solution to the digestion product. Set the amplification program according to Table 8 to carry out the single-base extension reaction.
[0079] Table 8. PCR amplification program for extension reaction (optimized)
[0080]
[0081]
[0082] 4. On-machine testing and analysis
[0083] The mass spectrometry results were analyzed according to the method described in Example 1. After the operation, the generated mass spectrometry peaks were examined. The results showed that, after optimization and adjustment, the extension primer UGT1A1*28_U2_LNA was completely converted into the corresponding extension product, with no incomplete intermediate products present. Different types of extension products were analyzed, and the mass spectrometry results were interpreted using a conversion efficiency threshold of 0.1. The wild-type *1 / *1 sample extension product contained only the UGT1A1*1 product peak. Figure 5 The homozygous mutant *28 / *28 sample mainly showed the UGT1A1*28 product peak as the extended product, with a very small amount of the UGT1A1*1 product peak present. This peak was excluded because its conversion rate was less than 0.1%. Figure 6 The heterozygous mutant *1 / *28 samples simultaneously contained peaks of both UGT1A1*1 and UGT1A1*28 extension products. Figure 7 The above results demonstrate that, after optimization of primers, enrichment, and extension conditions, the design method of this invention can accurately detect polymorphisms in the UGT1A1 gene promoter region (TA)n repeat sequence.
[0084] Example 3
[0085] A kit for detecting irinotecan-related gene polymorphisms is provided. The method used is based on the detection method for the UGT1A1 gene promoter region (TA)n repeat sequence polymorphism described in Example 2 of this invention. The primers contain SEQ ID NO. 1 to 36, and a total of 12 irinotecan-related gene polymorphism sites, including the UGT1A1*28 polymorphism site, are detected. The performance of the kit is examined below in conjunction with examples.
[0086] 1. Sample processing
[0087] Twenty whole blood samples were collected, and sequencing identified 12 mutation sites, including UGT1A1*28 (rs3064744), UGT1A1*6 (rs4148323), UGT1A1*27 (rs35350960), UGT1A1*60 (rs4124874), UGT1A1*93 (rs10929302), ABCC23972C>T (rs3740066), ABCC21249G>A (rs2273697), ABCC2-24C>T (rs717620), ABCB11236C>T (rs1128503), and SLCO1B1. 388A>G (rs2306283), SLCO1B1521T>C (rs4149056), and ABCG2421C>A (rs2231142). Each sample was diluted to 10 ng / μL according to its concentration for detection in this embodiment.
[0088] 2. Preparation of reaction solution
[0089] Prepare the enrichment reaction solution, digestion reaction solution (same as Table 2), and extension reaction solution according to the following formula table.
[0090] Table 9. Formulation of enrichment reaction solution
[0091]
[0092]
[0093] Table 10 Formulation of Extended Reaction Solution
[0094]
[0095]
[0096] 3. Amplification reaction
[0097] Take 3 μL of enrichment reaction solution and add it to 2 μL of the above sample. Set the amplification program according to Table 4 in Example 1 to perform enrichment amplification.
[0098] Prepare digestion reaction systems according to the ratio of "1.7 μL digestion reaction solution + 0.3 μL SAP enzyme", take 2 μL of each system and add it to the enriched amplification product. Set the amplification program according to Table 5 in Example 1 and carry out the digestion reaction.
[0099] The extension reaction system was prepared according to the ratio of "3 μL of extension reaction solution + 0.04 μL of UEP enzyme", and 3 μL of each solution was added to the digestion product. The amplification program was set according to Table 8 in Example 2 to carry out the single-base extension reaction.
[0100] 4. On-machine testing and result analysis
[0101] The instrument was tested according to the method in Example 1. After the test was completed, the generated mass spectrometry peaks were viewed and the conversion rate of the extension product was calculated. If a single base extension primer had a product peak and the conversion rate was greater than 0.2, it was interpreted as positive for the corresponding type. Otherwise, it was interpreted as negative for the corresponding type. Table 11 shows the test results.
[0102] Table 11 Nucleic acid mass spectrometry detection results of 20 samples
[0103]
[0104] All 20 whole blood samples were validated by NGS sequencing. The sequencing results were consistent with the nucleic acid mass spectrometry detection results of the kit of the present invention, indicating that the irinotecan drug-related gene polymorphism detection kit of the present invention has high accuracy.
[0105] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A primer set for detecting irinotecan-related gene polymorphism sites, characterized in that, The primer sets are shown in SEQ ID NO. 1-24, 26-36 and 38, where SEQ ID NO. 1-24 are the amplification primer sequences for each mutation site, the remaining primers are single-base extension primers, and the C base at position 10 of the primer shown in SEQ ID NO. 38 is modified with LNA.
2. A reagent, characterized in that, The reagent includes the primer set as described in claim 1.
3. A reagent kit, characterized in that, The kit contains the primer set as described in claim 1.
Citation Information
Patent Citations
htSNPs for determining the genotype of the UGT1A gene and their application in multiple genotyping
CN102277437A
Primer system for detecting polymorphism of UGT1A1*6 gene through single base extension method, method and application
CN107868824A