Molecular marker and its application in detecting honeybee wing vein angle a4 trait

Abstract

The present application relates to the technical field of bee breeding, and particularly relates to a molecular marker and application thereof in detection of wing vein angle A4 trait of bees. The molecular marker comprises a nucleotide sequence as shown in SEQ ID NO. 1, and the 179th position of the sequence has polymorphism, which is C / T. The present application screens and obtains a molecular marker related to the wing vein angle A4 trait of bees. The wing vein angle A4 trait of bees can be identified by virtue of the polymorphism of the molecular marker. The molecular marker provided by the present application can be used for breeding bees with high flight capacity and honey collecting capacity, and is beneficial to breeding high-quality bee species.

Description

Technical Field

[0001] This invention relates to the field of bee breeding technology, and in particular to a molecular marker and its application in detecting the A4 trait of bee wing vein angle. Background Technology

[0002] Chinese honeybee ( Apis cerana The Chinese honeybee (Apis cerana), or honeybee for short, is a honeybee resource of significant ecological and economic value. It possesses advantages such as strong adaptability, high swarming tendency, strong disease resistance, cold and heat tolerance, and excellent comb-building ability. The honey-gathering efficiency of the Chinese honeybee is influenced by various factors, including the bee's mouthpart structure, foraging techniques, nectar viscosity and corolla depth, as well as the bee's flight time and distance. Improving the bee's flight efficiency can shorten the time it takes to reach its destination and increase its foraging efficiency.

[0003] The flight efficiency of bees is influenced by a variety of factors. Besides climatic factors (such as temperature), nectar flow intensity, and colony strength, the physiological structure of the bees themselves is also a key factor. The A4 wing vein angle is a specific wing vein structure on the bee's wings, a characteristic feature of the insect's wings. On an insect's wing, wing veins support the wing surface, and the size of the A4 wing vein angle is closely related to its flight efficiency. A smaller A4 wing vein angle may lead to reduced flight efficiency, therefore, research on the A4 wing vein angle is of significant value in bee breeding. Summary of the Invention

[0004] To address the problems existing in the prior art, the present invention provides a molecular marker and its application in detecting the A4 trait of bee wing vein angle.

[0005] In a first aspect, the present invention provides a molecular marker comprising a nucleotide sequence as shown in SEQ ID NO.1, wherein position 179 of the sequence is polymorphic, and the polymorphism is C / T.

[0006] The nucleotide sequence shown in SEQ ID NO.1 is as follows:

[0007] TTTCCCACCTCCCAATTTTCGATATTGCAATTTGCAAATTGCCGATTAATTAAGCCGATTAATTTTGGCTCGTTTAAATTGCACTTTATCGGTTAGCGTTAATTATCGACTAAAGTGGCATTAGAACGAAATACGTTTCGAGAAACGTA CATTAATTAATATTATCCTTTAAAGATACCATTAGGAATAATATATATCGAATTATCTCGTTTTATTAGAATACTTGTGGATTTTTTTCGAATCTCGCACATTAGTCTAAAGATAGAAGGAACCGCGTATCTCATCACCGGAAGAAGCAT

[0008] Secondly, the present invention provides a KASP primer set, the KASP primer set being used to amplify the aforementioned molecular marker; the KASP primer set comprising:

[0009] F1: CGTACATTAATTAATATTATCCTTTAAAGATAC,

[0010] F2: CGTACATTAATTAATATTATCCTTTAAAGATAT,

[0011] R:AAAACGAGATAATTCGATATATATTATTCCT.

[0012] The sequences of the primers above are from 5' to 3'.

[0013] Furthermore, F1 and F2 each carry different fluorescent markers, which include one or more of the following: FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC, or Texas Red.

[0014] For example, connect GAAGGTGACCAAGTTCATGCT (FAM) at 5' of F1, and connect GAAGGTCGGAGTCAACGGATT (HEX) at 5' of F2.

[0015] Thirdly, the present invention provides a kit comprising the aforementioned molecular markers or the aforementioned KASP primer combination.

[0016] Fourthly, the present invention provides the application of the molecular marker, the KASP primer combination, or the kit in detecting the A4 trait of wing vein angle in bees.

[0017] The present invention further provides the use of the molecular marker, or the KASP primer combination, or the kit in any of the following:

[0018] i) Breeding genetically modified honeybees with high flight efficiency;

[0019] ii) Improvement of flight efficiency of honeybee germplasm resources;

[0020] iii) Molecular marker-assisted breeding of bees.

[0021] Furthermore, the bee is an Oriental honeybee, preferably a Chinese honeybee.

[0022] Fifthly, the present invention provides a method for detecting the flight efficiency of bees, comprising: detecting the polymorphism of the molecular markers of the bees to be tested, and determining the wing vein angle A4 trait of the bees to be tested based on the detection results.

[0023] Further, the process includes: extracting genomic DNA from the bees to be tested, performing PCR amplification using the aforementioned KASP primer combination, and determining the flight efficiency of the bees to be tested based on the amplification results.

[0024] Further, based on a total system volume of 25 μL, the amplified system comprises:

[0025] Template DNA 1-2 μL, upstream primer 1-2 μL, downstream primer 1-2 μL, Dntp mix 1-2 μL, 10×Taq Buffer 2-4 μL, Taq enzyme 0.2-0.4 μL, the remainder is water.

[0026] The amplification procedure includes:

[0027] Pre-denaturation at 95℃ for 5-10 minutes;

[0028] The process involves denaturation at 92-96℃ for 30-60 seconds, annealing at 62-65℃ for 30-60 seconds, and extension at 70-74℃ for 30-60 seconds, repeated 10-15 times, with the annealing temperature decreasing by 0.4-0.6℃ each time.

[0029] Denaturation at 93~96℃ for 30~60s, annealing at 56~60℃ for 30~60s, extension at 70~74℃ for 30~60s, cycle 25~35 times;

[0030] Repair and extend the treatment at 70~74℃ for 10~15 minutes.

[0031] Furthermore, the nucleotide polymorphism at position 179 of the amplified product was detected using gene sequencing. The results showed that bees with the TT genotype had a smaller wing vein angle A4 trait compared to bees with the CT genotype.

[0032] The present invention has the following beneficial effects:

[0033] This invention utilizes association analysis of physiological traits and genomic data from multiple bees to screen for several SNP loci associated with physiological traits. One SNP locus, associated with the A4 wing vein angle trait in bees, was used as a molecular marker to develop corresponding detection primers. Polymorphism detection of this SNP locus can reflect the A4 wing vein angle trait in bees, and can therefore be applied to the selection of bees with a larger A4 wing vein angle, thereby improving bee flight efficiency, which is of significant importance. Attached Figure Description

[0034] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0035] Figure 1 This is the statistical and genotyping result of the wing vein angle A4 trait of 107 Chinese honeybee samples provided in Embodiment 2 of the present invention.

[0036] Figure 2 This is the amplification result of the primer pair provided in Example 3 of the present invention. Detailed Implementation

[0037] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0038] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0039] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.

[0040] Example 1

[0041] This invention identifies a SNP locus associated with the wing vein angle A4 trait through bee trait and genome association analysis, specifically including the following process:

[0042] 1. This invention uses samples from 110 colonies of Chinese honeybees to measure the wing vein angle A4. After dissection, genomic DNA was extracted from the thoracic tissue of worker bees, and library construction was performed using the Trussq Nano DNA HT kit (Illumina, USA). The DNA was randomly fragmented into 350bp fragments, and after end repair, addition of polyA tails, addition of sequencing adapters, amplification, and purification, a DNA library was obtained. The insert size of the library was quality checked using an Agilent 2100, and the effective concentration of the library was accurately quantified using qPCR. Once the quality met the standards, the DNA library construction was complete.

[0043] 2. Genome Sequencing, Alignment, and SNP Identification: After successful library construction, genome sequencing was performed on the Illumina Hiseq PE150 platform (Illumina, USA). Low-quality reads were removed during sequencing to ensure result quality (quality control standards: reads containing more than 10% unknown nucleotides, reads containing adapter sequences, and reads with low-quality (phred quality < 5) bases exceeding 50% of their length were removed). Finally, each bee sample generated over 4.5G of high-quality, clean reads with paired ends, with Q20 and Q30 values ​​exceeding 90% and 85%, respectively.

[0044] 3. The high-quality paired-end clean reads obtained were aligned to the reference genome using BWA 0.7.8 software. Apis cerana (Genbank accession number: PRJNA738447). The alignment results were deduplicated using SAMTOOLS 1.15 software, and the average alignment rate of the population samples was guaranteed to be above 95%, with an average sequencing depth of over 20X for the genome.

[0045] 4. SNPs were detected using a Bayesian model in SAMTOOLS 1.15 software. High-quality SNPs were selected based on quality control criteria (deleting SNPs with a sequencing error rate >1% (Q20 quality control), deleting SNPs with a gap of <5 bases between adjacent SNP sites, and deleting SNPs with a coverage depth exceeding 1 / 3 to 5 times the average depth). The detected SNPs were annotated using ANNOVAR 20130520 software, identifying exon regions, intron regions, alternative splicing sites, upstream and downstream gene regions, and intergenic regions, and distinguishing between synonymous and non-synonymous SNPs.

[0046] 5. Genome-wide association studies (GWAS): Genome-wide association studies (GWAS) were conducted using mrMLM 1.3 software to clarify the association between the wing vein angle A4 trait and SNP loci. The quality control standard for SNPs was based on MAF > 5%, and a multi-locus randomized mixed linear model was selected.

[0047] Table 1. Association between the A4 phenotype of bee wing vein angle and SNPs

[0048]

[0049] Through the above method, this invention screened and obtained several SNP loci related to the physical and chemical traits of bees (wing vein angle A4). Experimental verification showed that one of them was closely related to the wing vein angle A4 trait of bees. This SNP locus (Chr6_12953016) is located at position 12953016 on chromosome 6 of bees and has a polymorphism of C / T.

[0050] Example 2

[0051] This invention uses 107 samples of Chinese honeybees for verification work to verify the association between SNP sites and the A4 trait of honeybee wing vein angle in Example 1. Specifically, sequencing was performed on these 107 Chinese honeybees, and the A4 wing vein angle of the 107 honeybees was measured using a microscopic measurement system to obtain the A4 wing vein angle data and SNP data of the 107 honeybees.

[0052] This invention groups the wing vein angle A4 data of different genotype groups according to the gene type of SNP loci, and uses SPSS 16.0 software to perform a significant difference analysis on the wing vein angle A4 of different genotype groups in order to compare the differences of different genotypes in wing vein angle A4.

[0053] Analysis results showed that 18 honeybees exhibited the C / C genotype, 57 exhibited the C / T genotype, and 32 exhibited the T / T genotype. This was achieved through LSD data analysis (…). Figure 1 The C / T genotype and the T / T genotype showed significant differences. P <0.05), as shown in the figure, the wing vein angle A4 of the C / T genotype honeybee is significantly larger than that of the T / T genotype honeybee. Furthermore, Table 2 also shows that genotype 1 (C / T) exhibits a larger wing vein angle A4 trait compared to genotype 2 (T / T), and this difference is significant. P <0.05.

[0054] Table 2. Comparison of wing vein angle (A4) among individuals with different genotypes at the Chr6_12953016 locus in Apis cerana.

[0055]

[0056] * express P <0.05, the difference is significant.

[0057] Example 3

[0058] This invention further uses three samples of honeybees to amplify the SNP locus (Chr6_12953016) involved in Example 1, specifically including:

[0059] 1. Primer pairs are as follows:

[0060] Upstream primer: 5'-TTTCCCACCTCCCAATTTTC-3',

[0061] Downstream primer: 5'-ATGCTTCTTCCGGTGATGAG-3'.

[0062] 2. The PCR system is as follows:

[0063] Table 3 PCR System

[0064]

[0065] Table 4 PCR Procedure

[0066]

[0067] 3. Test Results

[0068] The results are as follows Figure 2 As shown in the results, the electrophoretic bands of the amplified DNA fragments are clear and bright, without any impurities, indicating that the primers, amplification system, and program are highly specific.

[0069] Based on this amplified product, the polymorphism of its nucleotide sequence at position 179 can be detected by gene sequencing. If the detection result is C / T, it indicates that it possesses the A4 trait of a large wing vein angle. Based on this method, the present invention can be used for the breeding of bees with the A4 trait of a large wing vein angle. For example, during breeding, genotyping can be performed to retain bee colonies with a C / T result at the Chr6_12953016 locus.

[0070] 4. The present invention further provides a KASP primer combination for detecting this SNP site, including...

[0071] F1: GAAGGTGACCAAGTTCATGCTcgtacattaattaatattatcctttaaagataC,

[0072] F2:GAAGGTCGGAGTCAACGGATTcgtacattaattaatattatcctttaaagataT,

[0073] R:aaaacgagataattcgatatatattattcct.

[0074] F1 carries FAM and F2 carries HEX. In practice, this KASP primer combination can be used to detect the sample to be tested. At the same time, it can be detected by existing fluorescence equipment. The genotype of the sample to be tested can be determined by the detection results of the FAM and HEX fluorescence channels: T / T (HEX fluorescence signal exceeds the threshold), C / T (both FAM and HEX fluorescence signals exceed the threshold), or C / C (FAM fluorescence signal exceeds the threshold).

[0075] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of molecular marker detection reagents in detecting the A4 trait of wing vein angle in Chinese honeybee; The molecular marker is a nucleotide sequence as shown in SEQ ID NO.1, with a polymorphism at position 179, which is C / T.

2. Application of KASP primer combinations or kits in detecting the A4 wing vein angle trait in Chinese honeybees; The KASP primer combination is used to amplify the molecular markers described in the application of claim 1; The KASP primer combination includes: F1: CGTACATTAATTAATATTATCCTTTAAAGATAC, F2: CGTACATTAATTAATATTATCCTTTAAAGATAT, R:AAAACGAGATAATTCGATATATATTATTCCT; The kit includes the KASP primer combination.

3. A method for detecting the A4 trait of wing vein angle in honeybees, characterized in that, include: The polymorphism of the molecular markers mentioned in the application as described in claim 1 is detected in the test bee, and the wing vein angle A4 trait of the test bee is determined based on the detection results; The test results showed that bees with the TT genotype had a smaller wing vein angle (A4) compared to bees with the CT genotype.

4. The method according to claim 3, characterized in that, include: Genomic DNA was extracted from the bees to be tested, and PCR amplification was performed using the KASP primer combination described in claim 2. The wing vein angle A4 trait of the bees to be tested was determined based on the amplification results.

5. The method according to claim 4, characterized in that, Based on a total volume of 25 μL, the amplified system comprises: Template DNA 1-2 μL, upstream primer 1-2 μL, downstream primer 1-2 μL, Dntp mix 1-2 μL, 10×Taq Buffer 2-4 μL, Taq enzyme 0.2-0.4 μL, the remainder is water; The amplification procedure includes: Pre-denaturation at 95℃ for 5-10 minutes; The process involves denaturation at 92-96℃ for 30-60 seconds, annealing at 62-65℃ for 30-60 seconds, and extension at 70-74℃ for 30-60 seconds, repeated 10-15 times, with the annealing temperature decreasing by 0.4-0.6℃ each time. Denaturation at 93~96℃ for 30~60s, annealing at 56~60℃ for 30~60s, extension at 70~74℃ for 30~60s, cycle 25~35 times; Repair and extend the treatment at 70~74℃ for 10~15 minutes.

6. The method according to claim 4 or 5, characterized in that, The nucleotide polymorphism at position 179 of the amplified product was detected using gene sequencing.

Images