Specific primer of molecular marker of fecundity-related gene TGF-beta1 of muxuquwu sheep and application of specific primer

Abstract

The invention belongs to the field of molecular biology, and particularly relates to a specific primer of a molecular marker of a muxusewu sheep fecundity related gene TGF-beta1 and application of the specific primer. The invention relates to a specific primer of a molecular marker of a fecundity-related gene TGF-beta1 of a muxu sheep. The sequences of the primer are as shown in SEQ ID NO.1 and SEQ ID NO.2. The invention further discloses a kit for detecting the fecundity-related gene TGF-beta1 of the muxu sheep. Specific primers are designed, whether C-T mutation exists at the 312bp position of a TGF-beta 1 gene coding area in a genome of the wuzhu sheep or not is detected, the genotype of an individual wuzhu sheep at the site is determined, and detection on the TGF-beta 1 gene c.312Cgt; carrying out single nucleotide polymorphism detection on the TGF-beta 1 gene c.312Cgt, so as to compare the TGF-beta 1 gene c.312Cgt; the invention relates to the polymorphism of T in the variety of Wuzhu muuseu sheep. According to the invention, a TGF-beta 1 gene c.312Cgt is utilized; the T polymorphism assists the breeding of the Wuzhu museep sheep, increases the lambing number of the Wuzhu museep sheep, and can be used as an effective method for assisting in improving the polyembryonic character of the Wuzhu museep sheep.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to specific primers for molecular markers of a gene TGF-β1 related to fertility of Ujumchin sheep and applications thereof. Background Art

[0002] Wuzhumuqin sheep are produced in Wuzhumuqin grassland in the eastern part of Xilin Gol League, Inner Mongolia, and are mainly distributed in East Wuzhumuqin Banner, West Wuzhumuqin Banner and other areas. They are suitable for year-round grazing and have the characteristics of fast fattening, strong fat accumulation ability, high meat production rate, early sexual maturity, etc. They are suitable for grazing and fattening or planned fat lamb production during the peak growth period of forage. At the same time, Wuzhumuqin sheep are also good recipient sheep for purebred breeding embryo transplantation. The offspring lambs have strong physique, strong disease resistance and good adaptability. Wuzhumuqin sheep have formed an excellent population after long-term local selection and breeding.

[0003] TGF-β1 (transforming growth factor beta1) belongs to the transforming growth factor β (TGF-β) superfamily. The TGF-β1 signaling pathway is involved in the attachment of the trophoblast to the endometrium as a molecular mechanism and plays an important role in maintaining successful pregnancy. The sheep TGF-β1 gene is located on chromosome 14 and contains 7 exons. The coding region is 1194 bp long and encodes 397 amino acids. TGF-β1 is widely involved in the regulation of important physiological processes such as embryonic development, stem cell renewal and differentiation, germ cell and somatic cell proliferation and apoptosis, tissue fibrosis, immune response and various pathologies. It is worth noting that TGF-β1 plays an important role in the reproductive physiology of female animals. It is highly expressed in a variety of ovarian cell types and can serve as an important intrafollicular regulatory factor to regulate cell proliferation and differentiation, hormone secretion, follicular angiogenesis and granulosa cell luteinization in a paracrine or autocrine manner. In addition, TGF-β1 is involved in the regulation of maintaining the primordial follicle pool and normal ovarian function. The physiological function of TGF-β1 in the ovary depends on the classical downstream signal transduction factor SMAD, and also involves other non-classical pathways, such as p38, ERK1 / 2 and S6K1 / rpS6 signaling pathways. Summary of the invention

[0004] The purpose of the present invention is to provide a specific primer for the molecular marker of the Ujumchin sheep fertility-related gene TGF-β1.

[0005] Another object of the present invention is to provide applications of the above-mentioned specific primers.

[0006] The present invention adopts DNA sequencing technology to detect whether there is a C→T mutation at 312bp in the TGF-β1 gene coding region in the Ujumchin sheep genome, and determines the genotype of the Ujumchin sheep individual at the site, performs single nucleotide polymorphism detection on the TGF-β1 gene c.312C>T, compares the polymorphism of the TGF-β1 gene c.312C>T in the Ujumchin sheep breed, and determines that c.312C>T is a molecular marker related to the multi-birth trait of the Ujumchin sheep.

[0007] The nucleotide sequence of the Ujumchin sheep TGF-β1 gene c.312C>T is the NCBI Reference Sequence NC_056067.1, which is the region from 50043066bp to 50062674bp on chromosome 14 of the sheep.

[0008] According to a specific primer for molecular marker of Ujumqin sheep fertility-related gene TGF-β1 in a specific embodiment of the present invention, the primer sequence is as follows:

[0009] SEQ ID NO.1: 5'-ACCCTCCTACCTTTTCCTCG-3';

[0010] SEQ ID NO. 2: 5'-AAGCGGTCCACTTCACTCAC-3'.

[0011] The specific primers of the molecular marker of the Ujumchin sheep fertility-related gene TGF-β1 of the present invention can be applied to a kit for detecting the multi-birth trait of Ujumchin sheep, or can be applied to assisting Ujumchin sheep breeding.

[0012] Preferably, the present invention provides the use of specific primers for the molecular marker of the Ujumchin sheep fertility-related gene TGF-β1 in assisting in determining the fertility of Mongolian sheep.

[0013] Preferably, the present invention provides a Ujumchin sheep polygyny trait detection kit, which includes the above-mentioned specific primers. More preferably, the kit includes 1 μL of each specific primer, 1 μL of template, 10 μL of premix, and 7 μL of deionized water. The PCR amplification program suitable for the above-mentioned kit is 95°C pre-denaturation for 5 min, 98°C denaturation for 10 s, 58°C annealing for 5 s, 68°C extension for 5 s, 35 cycles, 72°C extension for 3 s, 4°C storage, and then sequencing.

[0014] According to a method for screening high-fertility Ujumchin sheep according to a specific embodiment of the present invention, the method comprises the step of amplifying Ujumchin sheep genomic DNA using the above-mentioned specific primers.

[0015] Specifically, according to a method for screening high-fertility Ujumqin sheep according to a specific embodiment of the present invention, the method comprises the following steps:

[0016] (1) extracting genomic DNA of the Ujumqin sheep to be tested;

[0017] (2) using the genomic DNA of the Ujumchin sheep extracted in step (1) as a template, performing PCR amplification with specific primers to obtain an amplified product;

[0018] (3) Determine the genotype of the 312th nucleotide of the TGF-β1 gene in the genome of the Ujumchin sheep in the amplified product, and select the Ujumchin sheep with the TT genotype at the 312th nucleotide in the coding region of the TGF-β1 gene as the breeding parent.

[0019] The detection method of the c.312C>T SNP of the TGF-β1 gene in the Ujumqin sheep genome is:

[0020] The fragment of nucleotide positions 50043066 bp to 50062674 bp of the Ujumchin sheep TGF-β1 gene GenBank Accession Number NC_056067.1 was amplified by PCR method, and the amplified product was sequenced by DNA sequencing;

[0021] If a single peak appears at the 50061764th base of chromosome 14 and the genotype is C, then the genotype is CC.

[0022] If a overlapping peak appears at the position of the 50061764th base of chromosome 14, the genotype is CT. If a single peak appears at the position of the 50061764th base of chromosome 14 and the genotype is T, the genotype is TT.

[0023] The average number of lambs born of Ujumchin sheep with TT genotype was higher than that with CT genotype, and the average number of lambs born of Ujumchin sheep with CT genotype was higher than that with CC genotype.

[0024] In the present invention, the fertility of Ujumchin sheep is specifically reflected in the number of lambs produced per litter.

[0025] According to the method for screening high-fertility Ujumchin sheep in a specific embodiment of the present invention, during the PCR amplification in step (2), the total volume of the amplification system is 20 μL, including 1 μL each of the upstream and downstream primers, 1 μL of the template, 10 μL of the premix, and 7 μL of deionized water.

[0026] According to the method for screening high-fertility Ujumchin sheep in a specific embodiment of the present invention, the PCR amplification program in step (2) is 95°C pre-denaturation for 5 minutes, 98°C denaturation for 10 seconds, 58°C annealing for 5 seconds, 68°C extension for 5 seconds, 35 cycles, 72°C extension for 3 seconds, 4°C storage, and then sequencing.

[0027] Beneficial effects of the present invention:

[0028] The present invention found that the molecular marker related to the polygynous trait of Ujumchin sheep existed in the region from 50043066bp to 50062674bp of the sheep chromosome 14 whose nucleotide sequence NCBI Reference Sequence is NC_056067.1 of TGF-β1 gene c.312C>T.

[0029] The present invention designs specific primers and adopts DNA sequencing technology to detect whether there is a C→T mutation at 312bp in the TGF-β1 gene coding region in the Ujumchin sheep genome, determines the genotype of the Ujumchin sheep individual at the site, realizes the single nucleotide polymorphism detection of the TGF-β1 gene c.312C>T, and compares the polymorphism of the TGF-β1 gene c.312C>T in the Ujumchin sheep breed.

[0030] The statistical results show that the specific primers of the present invention can detect the molecular marker, and thus can be used to assist in the breeding of Ujumchin sheep, screen for Ujumchin sheep with high fertility, and increase the number of lambs born by Ujumchin sheep. The method of the present invention can be used as an effective method to assist in improving or screening the multi-birth trait of Ujumchin sheep. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0032] Figure 1 This is a diagram of the PCR product of NC_056067.1:c.312C>T of TGF-β1 of the present invention.

[0033] Figure 2 This is a diagram showing the sequencing results of NC_056067.1:c.312C>T of TGF-β1 of the present invention. DETAILED DESCRIPTION

[0034] To make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described in detail below. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other implementation methods obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0035] Example 1 Establishment of a method for detecting molecular markers of the fecundity trait of Ujumqin sheep

[0036] 1) Formwork material preparation

[0037] Blood samples were collected from Ujumchin sheep and the number of lambs and parity were recorded. The Ujumchin sheep were from East Ujumchin Banner, Xilin Gol League, Inner Mongolia. The blood samples were stored in anticoagulant tubes for later use.

[0038] 2) PCR product sequencing

[0039] Twelve Wujumchin sheep (6 ewes that gave birth to twin lambs consecutively and 6 ewes that gave birth to single lambs consecutively) were randomly selected for PCR product sequencing, and a SNP site located in the coding region of the TGF-β1 gene was found, namely NC_056067.1:c.312C>T.

[0040] 3) Primer design

[0041] According to the sheep gene sequence reported by GeneBank (GeneBank accession number: NC_056067.1), the present invention designed upstream and downstream primers F and R by itself, and finally obtained the primer sequence as follows through comparison and screening:

[0042] F:5'-ACCCTCCTACCTTTTCCTCG-3';

[0043] R:5'-AAGCGGTCCACTTCACTCAC-3'.

[0044] The genome extracted from the experimental materials of Ujumchin sheep was used as a template and amplified using the above primers.

[0045] The amplification system of the upstream and downstream primers was consistent, and the total volume of the amplification system was 20 μL, including 1 μL of each upstream and downstream primers, 1 μL of template, 10 μL of premix, and 7 μL of deionized water.

[0046] The amplified products were sequenced after 35 cycles of pre-denaturation at 5°C for 5 min, denaturation at 98°C for 10 s, annealing at 58°C for 5 s, extension at 68°C for 5 s, and extension at 72°C for 3 s. The products were stored at 4°C.

[0047] The PCR amplification result of TGF-β1 NC_056067.1:c.312C>T is shown in Figure 1 .

[0048] The nucleotide sequence of the PCR product is shown in SEQ ID NO.3:

[0049] ACCCTCCTACCTTTTCCTCGGGAGACCCCCACCCACCCCAGCCCCTGTAGGGGCGGGGCCTCCCTCTTCCCACCCCAGTCCAGCTCGCGCTCTCGGCTGTGCCTGGGGGCGCCGCCTCCCCCATGCCGCCCTCGGGGCTGCGGCTGCTGCCGCTGCTGCTGCCGCTGCTGTGGCTACTAATGCTGACGCCTGGCCGGCCGGTCGCCGGACTGTCCACCTGCAAGACCATCGACATGGAGCTGGTGAAGCGGAAGCGCATCGAGGCCATCCGCGGCCAGATTTTGTCCAAACTTCGGCTCGCCAGTCCCCCGAGCCAGGGGGACGTGCCACCCGGCCCGCTGCCCGAGGCCATACTGGCCCTTTACAACAGTACCCGCGACCGGGTGGCCGGGGAAAGTGCCGAAACGGAGCCTGAGCCAGAGGCGGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAATACGGCAACAGTGAGCTCGCAGGGGCAGGGGACCCTGGAGGGGAGCCCCCAGGGGGCGCCGGAGTGCAGGGGTCACGGGGAGGAAACTGCTGGTAGAGGAAACTGGCTGGAGGAAGAGAACC CCCGGGGGCGCCGGGAACGTGTGTGGGGGGAGGGGTCCCAAAGAGCATAGAGCTGAGCTCCCTAACCCCCAAGGTATCTATCTGGTCTTGAATAAGAGATAGTGAGTGAAGTGGACCGCTT

[0050] The sequencing result is shown in Figure 2If a single peak appears at the 50061764th base position of chromosome 14 and the genotype is C, then the genotype is CC. If an overlapping peak appears at the 50061764th base position of chromosome 14, then the genotype is CT. If a single peak appears at the 50061764th base position of chromosome 14 and the genotype is T, then the genotype is TT.

[0051] Example 2 Statistical analysis of TGF-β1 genotype and its relationship with the fecundity of Ujumqin sheep population

[0052] The Ujumchin sheep were subjected to gene detection according to the primers designed in Example 1, and the genotype frequency and allele frequency of the Ujumchin sheep were calculated. Please refer to Table 1 for the statistical results.

[0053] Table 1 Statistical results of genotype frequency and allele frequency of Ujumqin sheep

[0054]

[0055] Note: The numbers in brackets are sample numbers.

[0056] The results are shown in Table 1. The genotype frequencies of CC, CT and TT of Ujumchin sheep were 0.481, 0.277 and 0.242, respectively. The frequencies of C and T alleles were 0.619 and 0.381, respectively. C allele was the dominant allele.

[0057] The TGF-β1 genotype and its association with the fecundity of Ujumqin sheep were analyzed. The specific experiment is as follows:

[0058] (1) Individual genotype analysis was performed on some loci in the selected test sample population to calculate the allele frequency and genotype frequency. 2 test.

[0059] (2) The gene frequency and genotype frequency of the locus were calculated based on the test results, and the distribution of the genotype of the locus was subjected to the chi-square fitness test of Hardy-Weinberg equilibrium. SPSS19.0 software was used to analyze the association between the fecundity trait and the genotype of the Ujumchin sheep population. The statistical model included genotype as a fixed effect and ram as a random effect, and a mixed linear model (MLM) was constructed as follows:

[0060] Y=μ+G+R+e

[0061] Among them: Y is the recorded value of lambing number; μ is the population average; G is the genotype effect, R is the ram effect; e is the random residual effect.

[0062] The mean values ​​and standard errors of the number of lambs born by different genotypes in Ujumchin sheep are shown in Table 2.

[0063] Table 2 Statistical results of the mean and standard error of the number of lambs born by Ujumqin sheep with different genotypes

[0064]

[0065] Note: a, c: p<0.01.

[0066] The results are shown in Table 2. The TT genotype has a higher number of lambs than the CC genotype by 0.31, which indicates that the mutation of the C allele to the T allele has a certain effect on the lambing traits of Ujumchin sheep, and the difference in the number of lambs between different genotypes at this site is significant (p<0.01). The results show that the genetic diversity of this site can be used to screen for breeding sheep that improve the fecundity of Ujumchin sheep.

[0067] Example 3 Method for improving the fertility of Ujumchin sheep

[0068] The method for improving the fertility of Ujumqin sheep of the present embodiment comprises the following steps:

[0069] (1) extracting genomic DNA of the Ujumqin sheep to be tested;

[0070] (2) PCR amplification using specific primers;

[0071] The genome extracted from the experimental material of Ujumchin sheep was used as a template, and the primers described in Example 1 were used for amplification. The total volume of the amplification system was 20 μL, including 1 μL of upstream and downstream primers, 1 μL of template, 10 μL of premix, and 7 μL of deionized water;

[0072] The amplified products were subjected to 5°C pre-denaturation for 5 min, 98°C denaturation for 10 s, 58°C annealing for 5 s, 68°C extension for 5 s, 35 cycles, 72°C extension for 3 s, and storage at 4°C for sequencing;

[0073] (3) Determine the genotype of the 312th nucleotide of the TGF-β1 gene in the genome of Ujumqin sheep,

[0074] If a single peak appears at the position of the 50061764th base of chromosome 14 and the genotype is C, the genotype is CC. If a double peak appears at the position of the 50061764th base of chromosome 14, the genotype is CT. If a single peak appears at the position of the 50061764th base of chromosome 14 and the genotype is T, the genotype is TT.

[0075] The Ujumchin sheep with TT genotype at position 312 in the coding region of the TGF-β1 gene were selected as breeding parents.

[0076] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. Specific primers for molecular markers of the Ujumqin sheep fertility-related gene TGF-β1, characterized in that: The specific primer sequences are as follows: SEQ ID NO.1: 5'-ACCCTCCTACCTTTTCCTCG-3'; SEQ ID NO. 2: 5'-AAGCGGTCCACTTCACTCAC-3'.

2. Use of the specific primers for the molecular marker of the Ujumqin sheep fertility-related gene TGF-β1 as described in claim 1.

3. Use of the specific primers for the molecular marker of the Ujumchin sheep fertility-related gene TGF-β1 as described in claim 1 in assisting Ujumchin sheep breeding.

4. A method for selecting high-fertility Ujumqin sheep, characterized in that: The method comprises the step of amplifying the genomic DNA of Ujumchin sheep using the specific primers described in claim 1.

5. The method for screening high-fertility Ujumqin sheep according to claim 4, characterized in that: The method comprises the following steps: (1) extracting genomic DNA of the Ujumqin sheep to be tested; (2) using the genomic DNA of the Ujumchin sheep extracted in step (1) as a template, performing PCR amplification with specific primers to obtain an amplified product; (3) Determine the genotype of the 312th nucleotide of the TGF-β1 gene in the genome of the Ujumchin sheep in the amplified product, and select the Ujumchin sheep with the CC genotype at the 312th nucleotide in the coding region of the TGF-β1 gene as the breeding parent.

6. The method for screening high-fertility Ujumchin sheep according to claim 5, characterized in that: During the PCR amplification in step (2), the total volume of the amplification system is 20 μL, including 1 μL of each specific primer, 1 μL of template, 10 μL of premix, and 7 μL of deionized water.

7. The method for screening high-fertility Ujumchin sheep according to claim 5, characterized in that: The amplification program of step (2) is: pre-denaturation at 95°C for 5 min, denaturation at 98°C for 10 s, annealing at 58°C for 5 s, extension at 68°C for 5 s, 35 cycles, and extension at 72°C for 10 min.

8. A kit for detecting the fetal trait of Ujumqin sheep, characterized in that: The kit includes specific primers for molecular markers of the Ujumqin sheep fertility-related gene TGF-β1, and the sequences of the specific primers are as follows: SEQ ID NO.1: 5'-ACCCTCCTACCTTTTCCTCG-3'; SEQ ID NO. 2: 5'-AAGCGGTCCACTTCACTCAC-3'.

9. The Ujumqin sheep multiple birth trait detection kit according to claim 8, characterized in that: The kit includes 1 μL of each specific primer, 1 μL of template, 10 μL of premix, and 7 μL of deionized water.

Images