An Indel molecular marker related to salt tolerance of Sesbania spinosa and its application

Abstract

The present invention belongs to the field of molecular marker technology, and specifically relates to an InDel molecular marker related to salt tolerance of Sesbania argentea and its application. The technical problem to be solved by the present invention is to provide a new option for screening Sesbania argentea germplasm resources. The technical solution provided by the present invention is to develop an InDel molecular marker related to salt tolerance of Sesbania argentea, the nucleotide sequence of which is shown as SEQ ID NO.3. The InDel molecular marker provided by the present invention is significantly correlated with the survival rate trait of Sesbania argentea plants under salt stress conditions, and can be used to identify the salt tolerance of Sesbania argentea materials. The molecular marker has a 100% consistency rate with the field identification results. Therefore, the marker operation is simple, the amplification results are highly accurate, and the required reagent cost is low. The development of the marker is of great significance for understanding the genetic control mechanism of salt tolerance in Sesbania argentea, and provides scientific theoretical support for the in-depth study of Sesbania argentea genetic improvement and germplasm resources.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers and relates to InDel molecular markers related to salt tolerance of Sesbania spinosa and applications thereof. Background Art

[0002] Sesbania, widely distributed in tropical and subtropical regions, has outstanding characteristics such as salt-alkali resistance and waterlogging resistance. Sesbania is mainly used as green manure, soil improvement plant or forage crop. Planting it as a green manure has a good nitrogen fixation effect and helps to improve the soil. As a diploid plant, Sesbania spinosa has advantages over the tetraploid plant Sesbania spinosa such as a small genome and a simple genetic background, which can more efficiently complete the functional screening and verification of excellent genes. Crop salt tolerance is an important field in agricultural research, especially in the face of global climate change and soil salinization. The cultivation and application of salt-tolerant crops are of great significance to the sustainable development of agriculture. Sesbania spinosa and Sesbania sesbania are both plants of the genus Sesbania and are closely related. Discovering the salt-tolerant genes of Sesbania spinosa and analyzing the salt-tolerant mechanism of Sesbania spinosa are of great significance to improving the salt tolerance of Sesbania spinosa and other leguminous crops.

[0003] Molecular marker-assisted breeding is an important technology in crop breeding, combining molecular biology and traditional breeding methods. Molecular markers can provide genetic information related to target traits (such as disease resistance, stress tolerance, and quality traits), enabling early screening of breeding materials, shortening the breeding cycle, and thus improving breeding efficiency and accuracy. Molecular markers have been widely used in genetic diversity research, germplasm identification, genetic map construction, and gene mapping. InDel markers, which are insertions / deletions of bases, have the advantages of being widely distributed within the genome and easy to detect, and are therefore widely used in many important crops. However, there are no reports on the use of InDel markers in salt tolerance in Sesbania truncatula. Summary of the Invention

[0004] In order to solve the deficiencies of the prior art, the present invention provides the following technical solutions:

[0005] In a first aspect, the present invention provides an InDel molecular marker related to salt tolerance of Sesbania spinosa, the nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO. 3.

[0006] In a second aspect, the present invention provides a primer pair for amplifying the above-mentioned InDel molecular marker, wherein the nucleotide sequences of the primers are shown as SEQ ID NO. 1 and SEQ ID NO. 2.

[0007] The third aspect of the present invention provides the use of the above-mentioned InDel molecular marker primer pair in identifying the salt tolerance of Sesbania spinosa.

[0008] A fourth aspect of the present invention provides the use of the above-mentioned InDel molecular marker in identifying the salt tolerance of Sesbania spinosa.

[0009] A fifth aspect of the present invention provides a method for identifying salt tolerance of Sesbania spinosa, comprising the following steps:

[0010] a. Extracting genomic DNA from Sesbania spinosa materials;

[0011] b. Using the DNA obtained in step a as a template, PCR amplification was performed using the above primer pairs to obtain an amplified product, and the amplified fragment was analyzed by 1% agarose gel electrophoresis;

[0012] c. If a band appears at the 121 bp position of the amplified product in step b on the electrophoresis graph, the tested Sesbania arvensis material is salt-tolerant.

[0013] Furthermore, the reaction system of the PCR amplification is: 20 μL, including 1.0 μL genomic DNA, 10.0 μL 2×PCR Mix, 0.4 μL each of upstream and downstream primers, and 8.2 μL ddH2O.

[0014] Furthermore, the PCR amplification program is as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 50°C for 15 s, and extension at 72°C for 15 s, 35 cycles; and extension at 72°C for 5 min.

[0015] Beneficial effects of the present invention:

[0016] The InDel molecular marker provided by the present invention is significantly correlated with the survival rate trait of Sesbania spinulosa plants under salt stress conditions and can be used to identify the salt tolerance of Sesbania spinulosa materials, with a 100% concordance rate between the molecular marker and field identification results. This marker is simple to operate, produces highly accurate amplification results, and requires low reagent costs. The development of this marker is of great significance for understanding the genetic control mechanisms of salt tolerance in Sesbania spinulosa and provides scientific theoretical support for in-depth research on Sesbania spinulosa genetic improvement and germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 To analyze the genetic relationship of 16 Sesbania spinulosa accessions, including 7 salt-tolerant and 9 salt-intolerant Sesbania spinulosa accessions;

[0018] Figure 2 Survival data of 16 Sesbania spinosa accessions under salt stress, including 7 salt-tolerant Sesbania spinosa accessions and 9 salt-intolerant Sesbania spinosa accessions;

[0019] Figure 3The figure shows the detection results of 16 Sesbania spinosa germplasms using the InDel molecular marker provided by the present invention; wherein, M is Marker (DL2000), numbers 1-7 are salt-tolerant Sesbania spinosa, and numbers 8-16 are salt-intolerant Sesbania spinosa. DETAILED DESCRIPTION

[0020] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.

[0021] In the present invention, the spinosa sesbania materials can be separated into salt-tolerant materials and salt-intolerant materials ( Figure 2 ) for clustering distinction ( Figure 1 The InDel molecular marker of the present invention is designed based on a structural variation site between the genomes of material YS06002 and material YS06044. This variation site is stable and effective in multiple sesbania argentea germplasms and has significant selectivity for distinguishing salt-tolerant sesbania argentea within a population. The present invention provides an important reference for sesbania argentea breeding and molecular marker-assisted breeding, and has broad application prospects in the molecular breeding of new sesbania argentea varieties and new strains.

[0022] Example 1: Development and screening of salt-tolerant InDel molecular markers

[0023] 1. Use the genome comparison of salt-tolerant material YS06002 and salt-intolerant material YS06044 to screen InDel site information and design primers: use Primer 5 and BLAST to design InDel marker primers.

[0024] 2. Based on the InDel sites identified by genomic data, we screened for sites with insertions or deletions greater than or equal to 300 and less than 450 bases, a sequencing depth greater than 10, and that could be identified in both genomes. We randomly selected 53 InDel sites evenly distributed on the six chromosomes of Sesbania spinosa that could be designed into primers.

[0025] 3. Extract the reference genome base sequence of 150 bp upstream and downstream of the mutation site in salt-tolerant Sesbania spinosa YS06002 to design primers. The primer design standard is as follows: annealing temperature is 50-56℃, primer length is (20±5) bp, and PCR product size is 100-600 bp.

[0026] 4. InDel marker screening: The CTAB method was used to extract genomic DNA from 16 Sesbania serrata germplasm materials from multiple regions (Table 1). PCR amplification and 1% agarose gel electrophoresis analysis were performed using the DNA of the 16 Sesbania serrata germplasm materials as templates to screen for InDel markers with obvious polymorphism. Salt-tolerant and salt-intolerant materials were selected, and ultimately an InDel marker with clear and stable bands, good reproducibility, and high polymorphism was obtained.

[0027] 5. The nucleotide sequence of the InDel molecular marker SEQ ID NO. 3 is shown below:

[0028] TCTTTTATGTTCAAGTATCATGTTATACGTTGCATTTTCAAGAGTGTTGTCAAAGAGATGTTTAAAATTTTTTATGTGAAAAAAGCAGAAAATTGATTATTTTTTTTATTCTGCTTCTTGAA.

[0029] After screening, the primer pairs that can distinguish salt-tolerant and salt-intolerant Sesbania sesbania are as follows:

[0030] SEQ ID NO.1: 5'-TCTTTTATGTTCAAGTATC-3';

[0031] SEQ ID NO.2: 5'-TTCAAGAAGCAGAATAAA-3'.

[0032] Table 1 Information on the provenance of 16 Sesbania spinulosa germplasms

[0033]

[0034] Example 2: Verification of InDel molecular markers related to salt tolerance in Sesbania spinosa

[0035] Experimental materials: 16 Sesbania spinosa accessions from various regions (Table 1).

[0036] Genomic DNA was extracted from 16 accessions of Sesbania spinosa. PCR amplification was then performed using the Sesbania spinosa genomic DNA as a template with InDel-labeled primers (SEQ ID No. 1 and SEQ ID No. 2). The total volume of the InDel-labeled PCR reaction system was 20 μL, consisting of 1.0 μL genomic DNA (100 ng / μL), 10.0 μL 2× PCR Mix, 0.4 μL each of the upstream and downstream primers (10 μmol / L), and 8.2 μL ddH2O. The PCR amplification program was as follows: initial denaturation at 95°C for 5 min; 35 cycles of denaturation at 95°C for 15 s, annealing at 50°C for 15 s, and extension at 72°C for 15 s; and extension at 72°C for 5 min.

[0037] The PCR amplification products were then detected by 1% agarose gel electrophoresis (1× TAE buffer) and stained with nucleic acid dyes and photographed.

[0038] The genotypes of the 16 Sesbania varieties and germplasms were identified. Figure 3 As shown, when the above primer pair was used for amplification, the one with a band at the 121 bp position in the electrophoresis graph was the salt-tolerant Sesbania truncatum; while the one with a band at the 500 bp position in the electrophoresis graph was the salt-intolerant Sesbania truncatum.

[0039] The results showed that the InDel molecular marker developed in this application can be used to distinguish salt-tolerant from salt-intolerant materials based on the band size of the amplified fragment. Therefore, this invention can be applied to the screening of salt-tolerant materials in Sesbania spinulosa, thereby improving the accuracy and efficiency of germplasm testing and laying a foundation for subsequent Sesbania spinulosa breeding.

[0040] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or substitute equivalents for some of the technical features. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. The use of a primer pair in identifying salt tolerance of Sesbania spinosa, characterized in that: The primer pair includes primers having nucleotide sequences as shown in SEQ ID NO. 1 and SEQ ID NO.

2.

2. A method for identifying salt tolerance of Sesbania spinosa, characterized in that: The following steps are involved: a. Extracting genomic DNA from Sesbania spinosa materials; b. Using the DNA obtained in step a as a template, PCR amplification was performed using the primer pair described in claim 1 to obtain an amplified product, and the amplified fragment was analyzed by 1% agarose gel electrophoresis; c. If a band appears at the 121 bp position of the amplified product in step b on the electrophoresis graph, the tested Sesbania arvensis material is salt-tolerant.

3. The method according to claim 2, characterized in that The PCR amplification reaction system is as follows: 20 μL, including 1.0 μL genomic DNA, 10.0 μL 2×PCR Mix, 0.4 μL each of upstream and downstream primers, and 8.2 μL ddH2O.

4. The method according to claim 2, characterized in that The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 50°C for 15 s, and extension at 72°C for 15 s, 35 cycles; and extension at 72°C for 5 min.

Images