A molecular marker related to cucurbit powdery mildew resistance, a kasp primer combination and application thereof

Abstract

The application discloses a kind of cucurbita pepo powdery mildew resistance related molecular markers and its KASP primer combination and application, belong to plant resistance breeding technical field.The mutation site of the cucurbita pepo powdery mildew resistance related molecular marker is located on the 11th chromosome of cucurbita pepo chromosome, and the mutation of nucleotide G→C at the 24091441th position;The application of the described cucurbita pepo powdery mildew resistance related molecular marker in cucurbita pepo powdery mildew resistance material screening or cucurbita pepo powdery mildew resistance breeding;The KASP primer combination for detecting the cucurbita pepo powdery mildew resistance related molecular marker is disclosed in the application, and the sequence is as follows: the upstream primer combined with the disease resistance site is as shown in SEQ ID NO.1;The upstream primer combined with the susceptible site is as shown in SEQ ID NO.2;The downstream primer is as shown in SEQ ID NO.3;The cucurbita pepo powdery mildew resistance related molecular marker and its KASP primer combination of the application can significantly distinguish cucurbita pepo powdery mildew disease resistance material and cucurbita pepo powdery mildew susceptible material, and can be applied in cucurbita pepo powdery mildew resistance material screening or cucurbita pepo powdery mildew resistance breeding.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant resistance breeding, and particularly relates to a molecular marker related to resistance to powdery mildew of cucurbit, and a KASP primer combination and application thereof. BACKGROUND

[0002] Cucurbit [Lagenaria siceraria (Molina) Standl.] (2n = 2x = 22) is also known as night flowering, calabash, calabash, ground pumpkin, and was first originated in Africa. It is an annual vine herb of Cucurbitaceae. It is widely cultivated all over the world and is used as a grafting stock of melon, vegetables, daily necessities and handicrafts, and has rich germplasm and genetic resources. Powdery mildew is mainly caused by Podosphaera xanthii (Sphaerotheca fuliginea), and is one of the important diseases of Cucurbitaceae melon crops. It has a wide distribution and is easy to spread. It has an impact on the whole growth period of Cucurbitaceae from seedling stage to fruit maturation. It can cause disease on hypocotyl, stem, leaf and fruit, and seriously affects the development of melon industry. At present, the main methods to solve the problem are to plant disease-resistant varieties, control environmental temperature and humidity, apply fungicides and rotate planting, but the prevention and control effect is very small, and it is easy to cause environmental pollution and food safety problems of pesticide residues.

[0003] However, the current breeding of powdery mildew-resistant varieties of cucurbit mainly relies on conventional breeding techniques. The resistance grade is identified by field natural occurrence and laboratory inoculation treatment, and then the disease-resistant materials are screened to breed related varieties. The cycle is long, the cost is high, and the precision is not high. The molecular marker-assisted breeding technology which can significantly improve the breeding efficiency and precision has not been applied. Therefore, it is of great significance to develop related molecular markers to improve the resistance level of cucurbit powdery mildew. SUMMARY

[0004] The present application aims to provide a Cucurbita pepo powdery mildew resistance related molecular marker, a KASP primer combination and application thereof, and aims to solve the problems of long Cucurbita pepo powdery mildew resistance identification period, low resistance variety breeding efficiency, high cost, low accuracy and the like. The present application overcomes the defects of low Cucurbita pepo powdery mildew resistance variety breeding efficiency, high cost and insufficient related genes in the prior breeding, and identifies the genotype and phenotype, so as to mine a CTP synthase gene mutation site located on chromosome 11 by taking the genome Bottle gourd (USVL1VR-Ls) published in the article 'Wu S et al. The bottle gourd genome provides insights into Cucurbitaceae evolution and facilitates mapping of a Papaya ringspot virus resistance locus. The Plant Journal, 2017, 92 (5): 963-975' as a reference genome. The CTP synthase is a key enzyme in pyrimidine nucleotide metabolism, directly participates in the immune regulation mechanism, and may be related to Cucurbita pepo powdery mildew resistance. Therefore, a Cucurbita pepo powdery mildew resistance related molecular marker is developed according to the mutation site.

[0005] The object of the present application is achieved by the following technical solutions:

[0006] A Cucurbita pepo powdery mildew resistance related molecular marker, wherein the mutation site of the molecular marker is located on chromosome 11 of a Cucurbita pepo genome, and the mutation of the 24091441th nucleotide G->C. When the 24091441th nucleotide is G, it is a G genotype, and the phenotype corresponding to the G genotype is susceptible to powdery mildew; when the 24091441th nucleotide is C, it is a C genotype, and the phenotype corresponding to the C genotype is resistant to powdery mildew.

[0007] The Cucurbita pepo genome is the genome Bottle gourd (USVL1VR-Ls).

[0008] The genome Bottle gourd (USVL1VR-Ls) is the genome Bottle gourd (USVL1VR-Ls) published in the article 'Wu S et al. The bottle gourd genome provides insights into Cucurbitaceae evolution and facilitates mapping of a Papaya ringspot virus resistance locus. The Plant Journal, 2017, 92 (5): 963-975'.

[0009] The application provides a molecular marker related to Cucurbita pepo powdery mildew resistance.

[0010] Preferably, the Cucurbita pepo comprises at least one of Cucurbita pepo powdery mildew resistant or Cucurbita pepo powdery mildew susceptible.

[0011] A KASP primer combination for detecting the molecular marker related to Cucurbita pepo powdery mildew resistance is designed according to the molecular marker related to Cucurbita pepo powdery mildew resistance, and the sequence of the KASP primer combination is as follows:

[0012] The upstream primer for binding to a disease resistance site is shown as SEQ ID NO. 1:

[0013] 5'-GAAGGTCGGAGTCAACGGATTAATACTCACCCAATTGTATTTGTAATTC-3';

[0014] The upstream primer for binding to a disease resistance site is shown as SEQ ID NO. 2:

[0015] 5'-GAAGGTGACCAAGTTCATGCTAATACTCACCCAATTGTATTTGTAATTG-3';

[0016] The downstream primer is shown as SEQ ID NO. 3:

[0017] 5'-GAGGAAGAAGAACTCACTTCAACA-3'.

[0018] A kit for detecting Cucurbita pepo powdery mildew resistance comprises the KASP primer combination for detecting the molecular marker related to Cucurbita pepo powdery mildew resistance.

[0019] The KASP primer combination for detecting the molecular marker related to Cucurbita pepo powdery mildew resistance is applied to screening of Cucurbita pepo powdery mildew resistance materials or Cucurbita pepo powdery mildew resistance breeding.

[0020] A method for screening of Cucurbita pepo powdery mildew resistance materials comprises the following steps by using the KASP primer combination for detecting the molecular marker related to Cucurbita pepo powdery mildew resistance.

[0021] (1) extracting genomic DNA of a Cucurbita pepo material to be screened;

[0022] (2) amplifying and detecting the genomic DNA of the Cucurbita pepo by using the KASP primer combination for detecting the molecular marker related to Cucurbita pepo powdery mildew resistance through a fluorescence quantitative PCR instrument;

[0023] (3) judging the resistance to white powdery disease of the screening cucurbit by the amplification detection result, wherein if the detection result of the mutation site of the molecular marker is C, the screening cucurbit material is a cucurbit homozygous disease-resistant material; if the detection result of the mutation site of the molecular marker is G, the screening cucurbit material is a cucurbit homozygous disease-susceptible material; and if the detection result of the mutation site of the molecular marker is G and C, the screening cucurbit material is a cucurbit heterozygous disease-susceptible material.

[0024] Preferably, in step (3), the resistance to white powdery disease of the screening cucurbit is judged by the amplification detection result, specifically as follows:

[0025] If the color of the fluorescence signal of the PCR amplification result is consistent with the color of the fluorescence linker of the disease-resistant site combined upstream primer (SEQ ID NO. 2), the screening cucurbit material is a cucurbit homozygous disease-resistant material; if the color of the fluorescence signal of the PCR amplification result is consistent with the color of the fluorescence linker of the disease-susceptible site combined upstream primer (SEQ ID NO. 3), the screening cucurbit material is a cucurbit homozygous disease-susceptible material; otherwise, the screening cucurbit material is a cucurbit heterozygous disease-susceptible material.

[0026] Preferably, the detection part of the screening cucurbit material in step (1) includes leaves, roots, stems and the like.

[0027] Compared with the prior art, the technical scheme of the present application has the following beneficial effects:

[0028] 1. The KASP primer combination for detecting the resistance-related molecular marker of white powdery disease of cucurbit in the present application is obtained by inoculating the two parents (resistant to white powdery disease and susceptible to white powdery disease) and their reciprocal F1 with white powdery spores at the seedling stage, identifying, finding that the resistance of cucurbit to white powdery disease is recessive inheritance, then resequencing the two parents, screening the difference sites, inoculating the F2 population at the seedling stage, constructing the disease-resistant and disease-susceptible mixed pool according to the resistance to white powdery disease, detecting the mixed pool by using the difference sites between the parents, positioning the resistance by using the SNP Gprime method, screening the resistance-related mutation sites by combining bioinformatics analysis, and obtaining the KASP primer designed by the resistance-related sites of white powdery disease of cucurbit through natural population verification.

[0029] 2. The mutation site in the present application is not found to have the same disclosed white powdery disease resistance site of cucurbit.

[0030] 3. The KASP primer developed in the present application is used for screening and breeding of white powdery disease-resistant materials of cucurbit, and has the characteristics of high efficiency, high accuracy and no pollution. DETAILED DESCRIPTION

[0031] With reference to the embodiments of the present application, the technical solutions in the embodiments of the present application will be clearly and completely described. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all the other embodiments obtained by a person of ordinary skill in the art without creative work are within the protection scope of the present application. In addition, the technical solutions in each embodiment can be combined with each other, but it must be based on that a person of ordinary skill in the art can realize. When the combination of technical solutions appears contradictory or unachievable, it should be considered that the combination of technical solutions does not exist, and is also not within the protection scope of the present application.

[0032] At present, there are problems such as long cycle, low efficiency of breeding of resistant varieties, high cost and low accuracy in resistance identification of cucurbita pepo powdery mildew. In order to solve the above technical problems, the present application provides a cucurbita pepo powdery mildew resistance related molecular marker, a KASP primer combination and application thereof.

[0033] Embodiment 1

[0034] Test materials: one anti-powdery mildew cucurbita pepo material Z063, one susceptible material Z0612 and its as parent positive and negative cross F1, F2 population obtained by self-crossing of F1. Two parent materials are recorded in the article "Xing Nailing, Fu Yujing, Wang Ying'er, et al. Cucurbita pepo stock resources light tolerance identification at seedling stage [J]. Jiangxi Journal of Agricultural Sciences, 2019, 31 (5): 11-16", the public can obtain the cucurbita pepo material from the applicant within twenty years from the filing date, only for repeating the related experiments of the present application.

[0035] Test procedure: Z063, Z0612, F1, and F2 were soaked, germinated, and sowed in plug trays, and then the resistance to powdery mildew at the seedling stage was identified at the 1-leaf 1-heart stage. The identification method was as follows: (1) Collect powdery mildew spores on the leaves of plants with powdery mildew for 7 days, add 4℃ sterile water, and stir at high speed (12000r / min) for 3-5min, and then measure the bacterial content of the suspension by microscope and blood cell counting plate; (2) Dilute the water to prepare 100 spore / mL spore suspension, and the preparation of the bacterial solution and the completion of the inoculation should be completed within 2h (the disease is most likely to occur within 0.5h); (3) At the 1-leaf stage (the plants were sowed in advance to reach the 1-leaf stage), the spore suspension was evenly brushed (brushing leaf inoculation method) onto the leaves of the plants, and then the plants were placed in a biological artificial climate box for 24h of darkness and humidity (covered with a plastic bag for humidity), and then the plants were managed normally under light and darkness alternation; (4) The daytime temperature was controlled at about 25℃, and the relative humidity was 70%-80%; the nighttime temperature was controlled at about 16℃, and the relative humidity was 85%-95%; and the disease incidence was investigated after 15d of inoculation. It was found that the resistance to powdery mildew of bottle gourd was recessive inheritance. The DNA of the leaves of single plants of the parents, F1, and F2 was extracted. The parents were resequenced to detect the difference sites between the parents. According to the resistance to powdery mildew, the F2 population was constructed into an extreme mixed pool. The genome Bottle gourd (USVL1VR-Ls) published in the article 'Wu S et al. The bottle gourd genome provides insights into Cucurbitaceae evolution and facilitates mapping of a Papaya ringspot virus resistance locus. The Plant Journal, 2017, 92(5): 963-975' was used as the reference genome, and BSA sequencing was used to detect a mutation located in the CTP synthase gene on chromosome 11 by Gprime method. According to the mutation, a molecular marker related to the resistance to powdery mildew of bottle gourd was obtained, and the sequence fragment at the site of the molecular marker is shown in SEQ ID NO. 4 (>chr11 chr11:24088019..24093723(-strand)class=mRNA length=5705), wherein n is G / C, when n is G, the G genotype corresponds to the phenotype of susceptible to powdery mildew; and when n is C, the C genotype corresponds to the phenotype of resistant to powdery mildew. Therefore, it is preliminarily determined that the gene is a gene related to the resistance to powdery mildew of bottle gourd. According to the mutation site sequence of the molecular marker related to the resistance to powdery mildew of bottle gourd, a KASP molecular marker was designed, and the sequence is as follows:

[0036] The upstream primer binding to the resistant site is shown in SEQ ID NO. 1: 5'- GAAGGTCGGAGTCAACGGATTAATACTCACCCAATTGTATTTGTAATTC-3'

[0037] The upstream primer binding to the susceptible site is shown in SEQ ID NO. 2: 5'- GAAGGTGACCAAGTTCATGCTAATACTCACCCAATTGTATTTGTAATTG-3'

[0038] The downstream primer is shown in SEQ ID NO. 3:

[0039] 5'-GAGGAAGAAGAACTCACTTCAACA-3'

[0040] Example 2

[0041] Experimental materials: 27 gourd germplasm resources materials, recorded in "Xing NL, Fu YJ, Wang YR, et al. Gourd stock germplasm resources seedling stage light tolerance identification [J]. Jiangxi Journal of Agricultural Sciences, 2019, 31(5): 11-16", the public can obtain the gourd material from the applicant for twenty years from the filing date, only for repeating the invention related experiment.

[0042] Sow the 27 materials, grow to 1 leaf 1 heart period, and perform powdery mildew inoculation. The identification method is (1) collect powdery mildew spores on the leaves of 5 days after disease onset, add 4℃ sterile water, high-speed stirring (12000r / min) for 3-5min, and measure the bacterial content of the suspension by microscope and blood cell counting plate; (2) dilute water to prepare 150 spores / mL spore suspension, and complete inoculation within 2h from the preparation of the bacterial solution; (3) at 1 true leaf stage (sow the plants in advance to 1 true leaf stage), pour the spore suspension into a spray bottle, and evenly spray it on the plant leaves, place the inoculated plants in an artificial climate box for 24h of darkness and humidity (cover with a plastic bag), and then perform normal light and dark alternation management; (4) control the daytime temperature at about 25℃, and the relative humidity at 70%-85%; control the nighttime temperature at about 16℃, and the relative humidity at 80%-95%, and investigate the disease incidence after 15d of inoculation. Extract genomic DNA from the leaves, measure the concentration using NanoDrop 2000, and dilute each DNA stock solution to 20ng / ul. Use the molecular markers described in Example 1 to amplify and detect the extracted genomic DNA.

[0043] Prepare the PCR reaction system as follows: 2xTaq DNA Polymerase Mix 2μL, SNP Primer Mix (4x) 1μL, and DNA sample 2μL.

[0044] PCR steps are as shown in Table 1.

[0045] Table 1 PCR steps

[0046]

[0047] SNP site detection uses fluorophores FAM and VIC to distinguish two isogenic sites. Passive reference dye ROX is used to correct the signal difference between wells and wells due to reaction volume error. The relevant excitation and emission wavelengths are shown in Table 2. The reading software is LGC's oemga device.

[0048] Table 2 Relevant excitation and emission wavelengths

[0049]

[0050] The genotype reading software (Kluster Caller) of LGC_OMEGA is used to analyze the data of PCR amplification. The relative fluorescence value corresponding to VIC and FAM of each PCR reaction well is obtained. According to the relative fluorescence value, the samples are clustered and clustered, and the genotype is further determined according to the sample cluster and fluorescence type. The genotype and phenotype results of the measured samples are shown in Table 3.

[0051] Table 3 Genotype and phenotype of samples

[0052]

[0053] The results of genotype and phenotype are generally consistent. The genotype of 3 anti-white powdery materials is C / C; 12 of 16 susceptible materials are G / G, and 4 are G / C; among 8 moderately resistant white powdery materials, 3 are C / C, 3 are G / C, and 2 are G / G. It shows that although there are other white powdery disease resistance related genes in Lagenaria besides the related genes of this marker, the use of this marker can significantly distinguish extreme resistant and susceptible materials, and can be used for the creation of white powdery disease resistant Lagenaria germplasm resources and variety breeding.

[0054] Example 3

[0055] Experimental materials: 1 Lagenaria germplasm resource material TB10, recorded in the article "Xing NL, Fu YJ, Wang YR, et al. Identification of Lagenaria rootstock germplasm resources under low light conditions at seedling stage [J]. Jiangxi Journal of Agricultural Sciences, 2019, 31(5): 11-16", 1 susceptible Lagenaria germplasm resource material HX, which can be obtained from the applicant for twenty years from the filing date, only for repeated experiments related to the invention.

[0056] KASP molecular markers designed by the application are used to identify TB10 and HX, and it is found that the sites are C / C and G / C respectively, combined with conventional breeding, the F2 population of TB10 and HX is identified by seedling inoculation, the single plant with the strongest disease resistance in the TB10 population is screened out, and after systematic breeding combined with other traits, the homozygous inbred line 'TB-33-12-6-4-7-5-3' is obtained as a female parent. HX is a seedling disease-resistant material, and among the disease-resistant single plants in the HX population, a single plant with genotype T / T is screened out, combined with other traits, the homozygous inbred line 'HX-25-17-11-5-6-4-2' is obtained as a male parent. Together with other parents, the combination is screened out after demonstration, and named 'Green warrior'. The variety has been popularized and applied in many provinces in China.

[0057] Compared with the prior art, the technical scheme of the application has the following beneficial effects:

[0058] 1. The KASP primer combination for detecting the molecular marker related to the resistance of cucurbit powdery mildew in the application is obtained by seedling inoculation and identification of powdery spores on two parents (resistant to powdery mildew and susceptible to powdery mildew) and their reciprocal F1, finding that the resistance of cucurbit powdery mildew is recessive inheritance, then resequencing the two parents to screen the difference sites. After F2 population seedling inoculation, according to the resistance of powdery mildew, a mixed pool of resistant and susceptible plants is constructed, the difference sites between the parents are used to detect the mixed pool, the SNPGprime method is used for disease resistance positioning, combined with bioinformatics analysis, the disease resistance related mutation sites are screened out, and the KASP primer designed by the cucurbit powdery mildew resistance related site is obtained through natural population verification.

[0059] 2. The mutation site in the application is searched, and no same cucurbit powdery mildew resistance site is found to be disclosed.

[0060] 3. The KASP primer developed in the application is used for screening and breeding of cucurbit powdery mildew resistance materials, and has the characteristics of high efficiency, high accuracy and no pollution.

[0061] The above only describes the preferred embodiments of the application and is not intended to limit the application, and any modifications, equivalent replacements and improvements made within the spirit and principles of the application shall be included in the protection scope of the application.

Claims

1. Use of a KASP primer combination for detecting a Cucurbita pepo powdery mildew resistance associated molecular marker in screening of Cucurbita pepo powdery mildew resistance materials or breeding of Cucurbita pepo powdery mildew resistance, characterized in that: The primer combination sequence of the KASP is as follows: The upstream primer combined with the disease-resistant site is shown as SEQ ID NO. 2: 5'-GAAGGTCGGAGTCAACGGATTAATACTCACCCAATTGTATTTGTAATTC-3'; The upstream primer combined with the disease-susceptible site is shown as SEQ ID NO. 3: 5'-GAAGGTGACCAAGTTCATGCTAATACTCACCCAATTGTATTTGTAATTG-3'; The downstream primer is shown as SEQ ID NO. 4: 5'-GAGGAAGAAGAACTCACTTCAACA-3'; If the detection results of the mutation sites of the molecular marker are all C, the screening material of the bottle gourd is a homozygous disease-resistant material of the bottle gourd; if the detection results of the mutation sites of the molecular marker are all G, the screening material of the bottle gourd is a homozygous disease-susceptible material of the bottle gourd; and if the detection results of the mutation sites of the molecular marker are G and C, the screening material of the bottle gourd is a heterozygous disease-susceptible material of the bottle gourd.

2. A method for screening for Cucurbita pepo powdery mildew resistance material, characterized by: The method comprises the following steps: (1) extracting the genomic DNA of the screening material of the bottle gourd; (2) using the KASP primer combination for detecting the molecular marker related to the resistance of the bottle gourd to powdery mildew in claim 1 to amplify and detect the genomic DNA of the bottle gourd by a fluorescence quantitative PCR instrument; (3) judging the resistance of the screening bottle gourd to powdery mildew by the amplification and detection results, wherein if the detection results of the mutation sites of the molecular marker are all C, the screening material of the bottle gourd is a homozygous disease-resistant material of the bottle gourd; if the detection results of the mutation sites of the molecular marker are all G, the screening material of the bottle gourd is a homozygous disease-susceptible material of the bottle gourd; and if the detection results of the mutation sites of the molecular marker are G and C, the screening material of the bottle gourd is a heterozygous disease-susceptible material of the bottle gourd.

3. The method for screening Cucurbita pepo for resistance to powdery mildew according to claim 2, wherein: In step (3), the judgment of the resistance of the screening bottle gourd to powdery mildew by the amplification and detection results is specifically: if the fluorescence signal color of the PCR amplification result is consistent with the fluorescence linker color of the upstream primer SEQ ID NO. 2 combined with the disease-resistant site, the screening material of the bottle gourd is a homozygous disease-resistant material of the bottle gourd; if the fluorescence signal color of the PCR amplification result is consistent with the fluorescence linker color of the upstream primer SEQ ID NO. 3 combined with the disease-susceptible site, the screening material of the bottle gourd is a homozygous disease-susceptible material of the bottle gourd; otherwise, the screening material of the bottle gourd is a heterozygous disease-susceptible material of the bottle gourd.

4. The method for screening Cucurbita pepo for resistance to powdery mildew according to claim 2, wherein: In step (1), the detection sites of the screening material of the bottle gourd include the detection sites of the leaves, roots or stems.

Images