Preparation method of vinasse pigeon meat

Abstract

The invention discloses a preparation method of vinasse pigeon meat, and belongs to the technical field of food. The corynebacterium glutamicum type I and the aspergillus niger are firstly used for inoculated fermentation, and then the sorghum vinasse is added for secondary fermentation, so that the maturing time of the vinasse pigeon meat can be shortened to 10 days, the risk caused by vinasse deterioration can be effectively reduced, and the unification of flavor can be maintained. Amino acid analysis shows that the method can improve the content of essential amino acids and flavor amino acids and improve the delicate flavor of the fermented vinasse pigeon meat. The research can provide a theoretical basis for optimization of a vinasse pigeon meat processing technology, standardized processing of flavor and a rapid fermentation process.

Description

Technical Field

[0001] The invention relates to a method for preparing distiller's grains pigeon meat, and belongs to the technical field of food. Background Art

[0002] At present, China is the country with the largest pigeon meat production in the world, with an annual production and sales of nearly 700 million squabs, accounting for 80% of the global total. Nutritional research shows that pigeon meat is a nutritious, fat-reduced meat with a protein content of 23.16% and a fat content of only 4.32%. The fatty acid composition is better than that of chicken, beef and pork, and it has a good processing and eating prospect. Although dishes such as braised pigeon, stewed pigeon and roasted pigeon are becoming more and more popular, the research on their cooking methods is far less than that of chicken, duck and goose, and is limited to a few processes such as roasting, stewing and braising. Therefore, it has become a trend to enrich pigeon meat processing technology, among which fermentation is an important method to improve the nutritional value and sensory flavor of food. Applying it to pigeon meat processing may further improve the quality of pigeon meat.

[0003] Wine lees are the solid residue left after brewing. China is one of the world's largest wine producers, producing about 30 million tons of wine lees each year. Wine lees inherit the organic components of wine raw materials, such as protein, starch, cellulose, fat, etc. On the other hand, wine lees have high water content and high microbial content, and there are many microbial strains that are beneficial to the fermentation process. For example, in the traditional glutinous rice wine fermentation process, Pediococcus, Bacillus, Rhizopus and Saccharomyces cerevisiae are dominant microbial genera. They play an important role in the saccharification and alcoholization process, are conducive to the formation of ethanol and esters, and can enhance the flavor of food when processed with wine lees. Existing studies have confirmed that the use of kava wine lees and sake wine lees in the production of fermented sausages can improve the amino acid content and safety of fermented sausages and enrich their aroma. Therefore, if wine lees are used to ferment cooked pigeon meat, it can not only improve the reuse rate of wine lees, but also make full use of the characteristics of microorganisms to decompose biomolecules such as lipids and proteins, forming a new type of food that benefits both flavor and nutrition.

[0004] However, distiller's grains are prone to mildew and deterioration, and the traditional process of preparing distiller's grain pigeon meat has a long production cycle, which leads to unstable product flavor characteristics and quality, and is difficult to unify due to the influence of distiller's grain deterioration. This seriously affects the reuse of distiller's grains. At present, distiller's grains are widely used in feed production, preparation of organic fertilizers, extraction of functional substances and other fields, and are rarely used in food. Summary of the invention

[0005] In order to solve the above problems, the present invention optimizes the processing technology of distiller's grains pigeon meat, first inoculates and ferments with Corynebacterium glutamicum type I and Aspergillus niger, and then adds sorghum distiller's grains for secondary fermentation, which can reduce the maturation time of distiller's grains pigeon meat to 10 days and help maintain the uniformity of flavor. The results of the present invention will provide a theoretical basis for the efficient and standardized production of distiller's grains pigeon meat, and help improve the flavor quality of distiller's grains pigeon meat.

[0006] The first object of the present invention is to provide a method for preparing distiller's grains pigeon meat, comprising the following steps:

[0007] S1. Process the pigeon meat and stew it;

[0008] S2, cooling the stewed pigeon meat and subjecting it to low-temperature fermentation treatment using Corynebacterium and Aspergillus;

[0009] S3, wrapping the fermented pigeon meat with distiller's grains, and continuing low-temperature fermentation to prepare the distiller's grains pigeon meat.

[0010] In one embodiment of the present invention, the Corynebacterium genus is Corynebacterium glutamicum type I numbered CICC 10117.

[0011] In one embodiment of the present invention, the Aspergillus is Aspergillus niger numbered CICC 40048.

[0012] In one embodiment of the present invention, the ratio of Corynebacterium to Aspergillus is 1:0.8-1.2.

[0013] In one embodiment of the present invention, in step S2, the specific steps of low-temperature fermentation are: spraying Corynebacterium and Aspergillus onto the surface of pigeon meat at an inoculation amount of 10^6~8 CFU / g, and fermenting in an environment of 2~4°C for 4~6 days after packaging.

[0014] In one embodiment of the present invention, the distiller's grains are sorghum distiller's grains.

[0015] In one embodiment of the present invention, the mass ratio of the distiller's grains to pigeon meat is 1 to 3:1.

[0016] In one embodiment of the present invention, in step S3, the low-temperature fermentation is performed in an environment of 2 to 4° C. for 4 to 6 days after packaging.

[0017] In one embodiment of the present invention, the pigeon meat is processed by fully bleeding the pigeon meat, fully removing the hair, and leaving no internal organs.

[0018] In one embodiment of the present invention, the stewing step is to wash the pigeon meat and put it into boiling water and stew it for 30 to 60 minutes to make the meat cooked thoroughly, and no ingredients are added during the stewing process.

[0019] The second object of the present invention is to provide distiller's grains pigeon meat prepared by the method.

[0020] Beneficial Effects

[0021] The present invention first inoculates and ferments with Corynebacterium glutamicum type I and Aspergillus niger, and then adds sorghum distiller's grains for secondary fermentation, which can reduce the maturation time of distiller's grains pigeon meat to 10 days, effectively reduce the risk of distiller's grains deterioration, and help maintain the uniformity of flavor. Amino acid analysis shows that the method of the present invention can increase the content of essential amino acids and flavor amino acids, and enhance the umami taste of fermented distiller's grains pigeon meat. This study can provide a theoretical basis for the optimization of distiller's grains pigeon meat processing technology, standardized processing of flavors, and rapid fermentation process. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The results of microbiological analysis of pigeon meat fermented with wine lees alone;

[0023] Figure 2 is the relative total amount of volatile flavor substances when pigeon meat is fermented with wine lees alone;

[0024] Figure 3 The GC-MS analysis results of inoculated and fermented pigeon meat; A is the principal component analysis (PCA); B is the variable importance projection (VIP) score of VOCs. DETAILED DESCRIPTION

[0025] The experimental materials involved in the following examples are as follows:

[0026] Shanghai Shenyu Pigeon Breeding Cooperative provides pigeon meat. Pigeon meat is required to be fully bled, fully depilated, and without internal organs, and sent to the laboratory within 2 hours under refrigerated conditions.

[0027] Glutinous rice distiller's grains were purchased from Tangshan Qifang (Nanjing).

[0028] Sorghum distiller's grains were purchased from Boyan Grocery Store in Ganlin Town, Shengzhou City (Zhejiang).

[0029] Oatmeal distiller's grains were purchased from Wang Youcui Restaurant in Hangzhou Economic and Technological Development Zone (Zhejiang).

[0030] Corynebacterium glutamicum type I (CICC 10117), Aspergillus niger (CICC 40048), Saccharomyces cerevisiae (CICC 1810), and Weissella sp. (CICC 24389) were all purchased from China Industrial Microbiological Culture Collection Center.

[0031] The detection methods involved in the following embodiments are as follows:

[0032] 1. Microbiological analysis

[0033] To evaluate bacterial diversity, genomic DNA was extracted from samples using a bacterial genomic DNA extraction kit (Solarbio, Beijing, China), and its concentration and quality were evaluated. Primers 515F (GTGCCAGCMGCCGCGGTAA) and 806R (GGACTACHVGGGTWTCTAAT) were used to amplify the V3-V4 region of the bacterial 16S rDNA gene. To analyze fungal diversity, total fungal DNA was extracted using a fungal genomic DNA extraction kit (Solarbio, Beijing, China). The concentration and quality of the extracted DNA were evaluated. The ITS2 variable region was amplified using primers ITS3F (GCATCGATGAAGAACGCAGC) and ITS4R (TCCTCCGCTTATTGATATGC).

[0034] The PCR reaction protocol was as follows: pre-denaturation at 98°C for 1 min; denaturation at 98°C for 10 s, denaturation at 50°C for 30 s, and denaturation at 72°C for 30 s, for a total of 30 cycles; and extension at 72°C for 5 min. The purified PCR product was purified using FLx800 TM The quantification was performed using a fluorescence reader (Agilent Technologies, Palo Alto, USA). Nano DNA LT Library Prep Kit (Illumina, San Diego, USA) was constructed according to the manufacturer's instructions. Library quality was assessed using the Agilent Bioanalyzer 2100 system, and sequencing was performed using the Illumina NovaSeq platform to generate 250 bp paired-end reads. Paired-end reads with overlapping regions were merged using FLASH, and the merged sequences were called raw tags. The raw tags were quality filtered using the QIIME quality filter to obtain high-quality clean tags. Non-redundant sequences (excluding singletons) were clustered into operational taxonomic units (OTUs) using the UPARSE software at a similarity threshold of 97%. The taxonomic information of each representative sequence was annotated using the Greengenes2 database (for bacterial diversity) and the Unite database (for fungal diversity) based on the Mothur algorithm.

[0035] 2GC-IMS analysis

[0036] 3.0 g of fermented pigeon meat sample was transferred to a headspace bottle and chromatographically analyzed using a FS-SE-54-CB-1 column (15 m × 0.53 mm, 1 μm film thickness). VOCs analysis was performed using an IMS system (Dortmund, Germany). Samples were incubated at 60 °C for 20 min with nitrogen as the carrier gas. The flow rates throughout the stages were as follows: (i) 2 mL / min for 2 min; (ii) 10 mL / min for 8 min; (iii) 50 mL / min for 10 min; and (iv) 150 mL / min for 10 min. IMS data were acquired in positive ion mode, and a combination of the NIST 23 mass spectral library, retention index (RI), IMS database, and drift time (Dt) were used to identify volatile flavor compounds. RI values ​​were calculated based on the retention time of n-ketones (C4–C9; Beijing Sinopharm Chemical Reagent Co., Ltd.). VOC intensity was quantified based on the peak volume of the selected signal.

[0037] 3Amino acid analysis

[0038] 100mg sample, 15mL 6mol / L hydrochloric acid solution and 3 drops of phenol were added to the hydrolysis tube and frozen for 3-5 minutes. The vacuum nitrogen purge process was repeated three times, and the tube was sealed under nitrogen. The hydrolysis tube was then placed at 110±1°C for 22 hours. Afterwards, the solution was filtered and diluted to 50mL with distilled water. 1mL of the solution was vacuum dried at 45°C. Next, 1.0mL of pH2.2 sodium citrate buffer solution was added to dissolve the dried sample. The resulting solution was filtered through a 0.22μm membrane to prepare a sample for analysis. The amino acid content was determined using an L-8900 fully automatic amino acid analyzer (Hitachi, Japan).

[0039] 4GC-MS analysis

[0040] Accurately weigh 3.0g of the crushed sample and place it in a 20mL headspace bottle. Then quickly inject 50μL of internal standard (2-octanol, 1.68ng / g in methanol) and seal the sample bottle. Keep the sample bottle at 40°C for 15 minutes while stirring continuously at a speed of 250r / min. Use divinylbenzene / carboxyl / polydimethylsiloxane (DVB / CAR / PDMS, 50 / 30μm, 2cm) coated fiber to extract volatile flavor substances at 40°C for 40 minutes. Volatile flavor substances were analyzed by gas chromatography-mass spectrometry (TRACE 1610 / OrbitrapExploris GC 240, Thermo Fisher Scientific, USA) in electron ionization mode (EI, 70eV). The solid phase microextraction (SPME) fiber was inserted into the gas chromatograph injector, and the extracted analytes were thermally desorbed at 250 °C and subsequently separated on an HP-INNOWAX capillary column (30 m × 0.25 mm × 0.25 μm, Agilent, USA). The temperature program of elution during the analysis was as follows: (i) 60 °C for 5 min; (ii) heating to 100 °C at a rate of 3.5 °C / min for 5 min; (iii) heating to 200 °C at a rate of 8 °C / min for 5 min; and (iv) heating to 280 °C at a rate of 15 °C / min for 15 min. The carrier gas (He) flow rate was set at 1.2 mL / min. VOCs were identified using the NIST mass spectral library (NIST14, version 2.2) in full scan mode (m / z 30–550). VOCs were tentatively identified using GC-MS spectra, and compounds with a similarity of ≤80% to the NIST library were excluded. Furthermore, identification was confirmed by matching the Kovats index (KI) with that of authentic compounds or literature data, which was determined by linear interpolation relative to the retention time of a range of n-alkanes (C8–C20). The chromatographic response of the VOCs detected in the investigated samples (peak area counts) was monitored and compared, and the relative amounts of the components were determined using peak area normalization. Quantification was based on the internal standard 2-octanol.

[0041] Embodiment 1:

[0042] The pigeon meat is fully bled, fully depilated, and without leaving any internal organs, and sent to the laboratory under refrigerated conditions within 2 hours. Wash the pigeon meat and simmer it in boiling water for 40 minutes to make the meat cooked through. At the same time, no auxiliary ingredients are added during the simmering process. According to the mass ratio of pigeon meat to distiller's grains of 1:2, distiller's grains are added to the pigeon meat, the pigeon meat is wrapped with distiller's grains and the lid is covered. It is placed in an environment of 3±0.5℃ for low-temperature fermentation for 20 days. The breast meat of the fermented pigeon meat is taken as test samples at 0, 10, and 20 days, and the average number of samples is 5.

[0043] Among them, CK group: control sample without adding any lees

[0044] CR group: pigeon meat samples on day 0

[0045] GD group: pigeon meat fermented with glutinous rice wine lees

[0046] OD group: pigeon meat fermented with oatmeal lees

[0047] SD group: pigeon meat fermented with sorghum distiller's grains;

[0048] Among them, SD10 is the sample of the SD group fermented to the 10th day, and SD20 is the sample of the SD group fermented to the 20th day.

[0049] Microbiological analysis and volatile flavor substance analysis were performed on samples from each group. The results are as follows: Figure 1 and Figure 2 shown.

[0050] Microbiological analysis:

[0051] The composition and relative abundance of microorganisms significantly affected the volatile flavor compounds of fermented meat. Therefore, we focused on species with a relative abundance greater than 1% as dominant species. Figure 1 The bacterial and fungal colony compositions are shown in A and B, respectively. A total of 20 genera were identified using the 1% screening criteria. Figure 1 Figure A shows that there are differences in the dominant genera between the groups. In the CR group, the highest relative abundances were Staphylococcus (19.85%), marine lactobacilli JC017 (18.84%), and Lactococcus (12.06%), which may be derived from processing equipment and the surrounding environment. Staphylococcus is associated with the production of fatty acids and alcohols, compounds that can enhance the flavor of food. In the CK group, the highest relative abundance was unclassified Enterobacteriaceae (49.91%), followed by Weissella (34.87%). However, most Enterobacteriaceae are potential pathogens that may cause food spoilage and foodborne diseases. Weissella was the highest relative abundance in both GD20 and OD20 groups (GD: 74.78%, OD: 65.80%). Weissella is widely used in fermented food production and is related to the production of esters and alcohols. In addition, the relative abundance of Acinetobacter (11.22%) and Leuconostoc (11.16%) increased in the OD20 group. There were 8 dominant genera in the SD20 group, among which Corynebacterium (33.31%), Flavobacterium (12.73%) and unclassified Cyanobacteria (12.52%) had the highest relative abundance. Studies have shown that some strains of Corynebacterium can metabolize and produce L-glutamic acid, which improves the umami taste of fermented foods.

[0052] Compared with the abundant bacterial phyla, a total of 10 fungal genera with the highest relative abundance were identified ( Figure 1In the CR group, Aspergillus (49.14%) and Arthrostomyces (40.37%) showed the highest relative abundance. Aspergillus is widely used in the fermentation process of black tea and Chinese liquor and is closely related to the metabolism of flavonoids, lipids and proteins. In addition, Aspergillus can release peptidases, promote the production of free amino acids, and increase the content of flavor amino acids. Studies have shown that Arthrostomyces exhibits obvious resistance to desiccation and salt, and some strains can produce toxins, which may bring potential food safety issues. In the CK20 group, Ustilago (80.54%) was the most dominant genus, followed by Aspergillus (15.04%). Similarly, in the GD20 group, the genus Ustilago (50.39%) showed the highest relative abundance. The genus Ustilago is also common in wine fermentation, and it plays a key role in flavor formation. In the SD20 group, Aspergillus was the most abundant genus, followed by unclassified Rhodesia (27.84%) and Mycobacterium (25.37%). This contributes to the formation of ideal sensory qualities in fermented pigeon meat. In the OD20 group, Pichia (54.83%) was the most dominant genus. Pichia is a non-brewery yeast that is increasingly being utilized in various fermentation processes, including wine and light beer. In summary, significant differences in fungal genera were observed in different types of wine lees, which led to different flavor profiles observed between the groups. Therefore, Corynebacterium and Aspergillus were preferred as dominant strains to explore the feasibility of the inoculation fermentation process of wine lees pigeon meat.

[0053] Analysis of volatile flavor compounds:

[0054] The types and intensities of volatile flavor compounds during the fermentation of pigeon meat were determined using GC-IMS. A total of 67 VOCs were identified from the fermentation process, including 14 aldehydes, 14 alcohols, 13 ketones, 17 esters, 5 alkanes, and 4 other compounds.

[0055] The relative amount of volatile flavor substances in pigeon meat from different distiller's grains was studied. Figure 2As shown in the figure, the results showed that microbial fermentation and distiller's grains could increase the relative total amount of volatile flavor substances in pigeon meat. The relative total amount of the CR group was 31989.50±460.97. The relative total amount of the CK group on the 10th day (40568.08±2356.98) and the 20th day (52414.29±538.85) was higher than that of the CR group, which showed the contribution of microorganisms in increasing the relative total amount of volatile flavor substances. On the 10th day of fermentation, the relative total amount of the SD10 group was significantly higher than that of the other treatment groups (P<0.05), which was 73693.16±1611.57. On the 20th day, the relative total amount of the SD20 group was also significantly higher than that of the other treatment groups (P<0.05), which was 89819.78±846.46, and showed an increasing trend over time. Therefore, sorghum distiller's grains can bring a richer aroma to fermented pigeon meat, and this was used as the research object to explore the feasibility of the inoculation fermentation process of distiller's grains pigeon meat.

[0056] Embodiment 2:

[0057] The pigeon meat was fully bled, fully depilated, and without leaving any internal organs, and sent to the laboratory within 2 hours under refrigerated conditions. The pigeon meat was washed and stewed in boiling water for 40 minutes to make the meat cooked thoroughly. At the same time, no auxiliary ingredients were added during the stewing process.

[0058] The stewed pigeon meat was placed in a fresh-keeping box for fermentation. First, Corynebacterium glutamicum type I (CICC 10117) and Aspergillus niger (CICC 40048) were sprayed on the surface of the pigeon meat in a ratio of 1:1 according to the final concentration of 10^7 CFU / g inoculation amount. After covering the lid, it was placed in an environment of 3±0.5℃ for low-temperature fermentation for 5 days. Then, sorghum distiller's grains were added to the pigeon meat at a mass ratio of 1:2 between pigeon meat and distiller's grains. The pigeon meat was wrapped with distiller's grains and covered. It was continued to be placed in an environment of 3±0.5℃ for low-temperature fermentation for 5 days. The breast meat of the fermented pigeon meat was taken as the test sample, and the sampling average was 5, which was set as the MA10 group.

[0059] Embodiment 3:

[0060] The steps were consistent with those in Example 1. After adding sorghum distiller's grains, the fermentation was continued for 15 days. The breast meat of fermented pigeon meat was also taken as the test sample. The average number of samples was 5, which was set as the MA20 group.

[0061] Comparative Example 1:

[0062] The pigeon meat was fully bled, fully depilated, and without leaving any internal organs, and sent to the laboratory within 2 hours under refrigerated conditions. The pigeon meat was washed and stewed in boiling water for 40 minutes to make the meat cooked thoroughly. At the same time, no auxiliary ingredients were added during the stewing process.

[0063] The stewed pigeon meat was placed in a fresh-keeping box for fermentation. First, Corynebacterium glutamicum type I (CICC 10117) and Saccharomyces cerevisiae (CICC 1810) were sprayed on the surface of the pigeon meat at a ratio of 1:1 according to the final concentration of 10^7 CFU / g inoculation amount. After covering the lid, it was placed in an environment of 3±0.5℃ for low-temperature fermentation for 5 days. Then, sorghum distiller's grains were added to the pigeon meat at a mass ratio of 1:2 between pigeon meat and distiller's grains. The pigeon meat was wrapped with distiller's grains and covered. It was continued to be placed in an environment of 3±0.5℃ for low-temperature fermentation for 5 days. The breast meat of the fermented pigeon meat was taken as the test sample, and the sampling average was 5, which was set as the MB10 group.

[0064] The above pigeon meat was further placed in a low-temperature fermentation environment at 3±0.5°C for 10 days, and the sampling was set as the MB20 group.

[0065] Comparative Example 2:

[0066] The pigeon meat was fully bled, fully depilated, and without leaving any internal organs, and sent to the laboratory within 2 hours under refrigerated conditions. The pigeon meat was washed and stewed in boiling water for 40 minutes to make the meat cooked thoroughly. At the same time, no auxiliary ingredients were added during the stewing process.

[0067] The stewed pigeon meat was placed in a fresh-keeping box for fermentation. First, Weissella sp. (CICC 24389) and Aspergillus niger (CICC 40048) were sprayed on the surface of the pigeon meat at a ratio of 1:1 according to the final concentration of 10^7 CFU / g inoculation amount. After covering the lid, it was placed in an environment of 3±0.5℃ for low-temperature fermentation for 5 days. Then, sorghum distiller's grains were added to the pigeon meat at a mass ratio of 1:2 between pigeon meat and distiller's grains. The pigeon meat was wrapped with distiller's grains and covered. It was continued to be placed in an environment of 3±0.5℃ for low-temperature fermentation for 5 days. The breast meat of the fermented pigeon meat was taken as the test sample, and the sampling average was 5, which was set as the MC10 group.

[0068] The above pigeon meat was further placed in a low-temperature fermentation environment at 3±0.5°C for 10 days, and the sampling was set as the MC20 group.

[0069] Test example:

[0070] (1) Analysis of volatile flavor substances: The samples of the CR group, SD group, and MA10, MA20, MB10, MB20, MC10, and MC20 groups were analyzed for volatile flavor substances. A total of 146 volatile flavor substances were detected, including 23 aldehydes, 32 alcohols, 13 ketones, 23 acids, 42 esters, 21 alkanes, and 13 other compounds. The GC-MS detection data were collated and analyzed. Figure 3 shown.

[0071] Figure 3 Figure A is a PCA diagram constructed from GC-MS detection data. The differences between PC1 and PC2 explained 51.5% and 23.6% of the variance, respectively. The distribution of all groups in the four quadrants showed that there were significant differences in the types and concentrations of volatile flavor substances in each group. The differences between the MC and MB groups were relatively small on the 10th and 20th days; similarly, the CR group had the smallest difference compared with the SD10 group. In contrast, the differences in the composition of volatile flavor substances between the SD20, MA10, and MA20 groups were small, which indicates that the inoculation and fermentation of distiller's grains can greatly shorten the maturation time of the flavor, and the MA10 group can achieve an effect close to that of MA20. In addition, the change of the inoculated fermentation strain also greatly changed the flavor composition of distiller's grains.

[0072] PLS-DA analysis ( Figure 3 Middle B) Combined PCA shows that PC1 captures the main variability between the main types of volatile flavor substances, where groups with higher concentrations of compounds such as ethanol, 3-methyl-1-butanol, isoamyl acetate, and diethyl succinate (succinic acid, diethyl ester) scored positively, while groups with lower concentrations scored negatively. PC2 reflects another important part of the variability between volatile flavor substances, where groups with higher concentrations of 1-hexanol and octamethylcyclotetrasiloxane scored positively, while groups with lower concentrations scored negatively. Therefore, PCA analysis shows that different inoculated fermentation strains significantly affect the flavor components of distiller's grains pigeon.

[0073] Further analysis was combined with GC-MS detection data. First of all, for aldehydes, hexanal is the aldehyde with the highest content. Hexanal makes the wine pigeon produce grassy and fatty flavors, but high concentrations can also cause unpleasant odors, which are closely related to lipid oxidation. On the 10th day of fermentation, the hexanal content of SD, MB and MC groups was the highest, which were 4128.69±139.52ng / g, 2822.61±197.90ng / g and 2514.78±90.81ng / g, respectively. The hexanal content of MA10 group was 105.04±5.74ng / g. During further fermentation, except for MA group, the hexanal content of other groups decreased, and the hexanal content of MA20 group was 262.09±22.32ng / g.

[0074] Alcohol compounds add herbal and fatty aromas to meat products, contributing to the formation of desirable flavor and aroma in distiller's grains. Among them, 1-hexanol, which has a fruity aroma, was the highest alcohol compound in the MA10 group at 3053.88±4.76ng / g. By the 20th day of fermentation, only the SD group showed a shift from methanol to 1-hexanol (3906.19±188.36ng / g). The highest concentrations of ethanol were found in the MB group (both 10 and 20 days) and the MC10 group (both 10 and 20 days).

[0075] Ketones play an important role in fermented meat products. Among them, 2,5-octanedione is the most abundant ketone, but 2,5-octanedione mainly exhibits moldy and ketone aromas. A moderate content can bring a unique aroma to fermented meat, enhance the complexity and layering of the overall flavor, and make the meat flavor more intense and rich. However, too high a content may cause the flavor to be too strong, or even produce an unpleasant odor, affecting the balance of the overall flavor. The 2,5-octanedione content in the SD20 group was 262.27±23.96ng / g, the 2,5-octanedione concentration in the MA10 group was 74.48±3.05ng / g, the 2,5-octanedione concentration in the MA20 group was 83.02±2.71ng / g, and the concentration in the MB10 group was 593.13±22.64ng / g, and the concentration in the MC10 group was 588.06±51.69ng / g, producing a relatively strong flavor.

[0076] Ester formation was mainly based on acid esterification, which was related to the activity of microbial esterase. Only three esters were detected in both the CR and SD groups, and the concentrations were low. The ester content in pigeon meat increased significantly after inoculation and fermentation. There were 10 types of ester compounds in the MA group, including 5 ethyl esters, with the highest content of ethyl acetate, reaching 125.08±0.35ng / g on the 10th day. Esters, especially ethyl esters, can bring fruity and sweet flavors to fermented meat, help cover up the bad rancid odor, and enhance the overall flavor of fermented meat.

[0077] In summary, in the MA group, the contents of various volatile flavor substances could reach a relatively high level on the 10th day. Fermentation with Corynebacterium glutamicum (CICC10117) and Aspergillus niger (CICC 40048) for 5 days before the wine lees treatment could greatly shorten the maturation time of pigeon meat flavor.

[0078] (2) Amino acid analysis: The types and contents of amino acids in meat are important indicators for evaluating the nutritional value and flavor of meat protein. In this paper, the total amino acid content of distiller's grains pigeon after inoculation and fermentation was detected by acid hydrolysis, as shown in Table 1. This application analyzed 17 amino acids, among which Glu, Asp, Leu and Lys had high amino acid contents. Among them, Glu, Asp and Lys are important umami amino acids, which have the effect of enhancing umami and making people happy. One-way ANOVA found that the contents of the above four amino acids in the MA group and the MB group were significantly higher than those in the SD group and the MC group (P<0.05), and there was no significant difference between the MA group and the MB group (P>0.05). Therefore, the MA group and the MB group are beneficial to improving the flavor of distiller's grains pigeon after inoculation and fermentation. In addition, essential amino acids can reflect the nutritional value of distiller's grains pigeon and are an important indicator of consumer concern. Inter-group comparison of the 7 essential amino acids found that distiller's grains treatment can increase the content of essential amino acids, and it shows an upward trend with the fermentation time. The EAA content in the MA and MB groups was significantly higher than that in the SD and MC groups (P<0.05), and there was no significant difference between the MA and MB groups (P>0.05). It can be seen that fermentation with Corynebacterium glutamicum type I (CICC 10117) and Aspergillus niger (CICC 40048) for 5 days before distiller's grains treatment can effectively increase the content of flavor amino acids and essential amino acids in pigeon meat, and the amino acid content after 10 days of inoculation and fermentation exceeds the amino acid content after only 20 days of distiller's grains treatment.

[0079] Table 1 Effect of inoculation and fermentation treatment on the total amino acid content of distiller's grains pigeon

[0080]

[0081] Note: The values ​​marked with different letters (ad) on the same day are significantly different (P<0.05)

[0082] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A method for preparing distiller's grains pigeon meat, characterized in that: The following steps are involved: S1. Process the pigeon meat and stew it; S2, cooling the stewed pigeon meat and subjecting it to low-temperature fermentation treatment using Corynebacterium and Aspergillus; S3, wrapping the fermented pigeon meat with distiller's grains, and continuing low-temperature fermentation to prepare the distiller's grains pigeon meat.

2. The preparation method according to claim 1, characterized in that: The Corynebacterium genus is Corynebacterium glutamicum type I numbered CICC 10117.

3. The preparation method according to claim 1, characterized in that: The Aspergillus is Aspergillus niger numbered as CICC 40048.

4. The preparation method according to any one of claims 1 to 3, characterized in that: The ratio of Corynebacterium to Aspergillus is 1:0.8-1.

2.

5. The preparation method according to claim 1, characterized in that: In step S2, the specific steps of low-temperature fermentation are: spraying Corynebacterium and Aspergillus onto the surface of pigeon meat according to an inoculation amount of 10^6~8 CFU / g, and fermenting in an environment of 2~4°C for 4~6 days after packaging.

6. The preparation method according to claim 1, characterized in that: The distiller's grains are sorghum distiller's grains.

7. The preparation method according to any one of claims 5 to 6, characterized in that: The mass ratio of the wine lees to the pigeon meat is 1 to 3:

1.

8. The preparation method according to claim 1, characterized in that: In step S3, low temperature fermentation is performed in an environment of 2 to 4°C for 4 to 6 days after packaging.

9. The preparation method according to claim 1, characterized in that: In step S1, the pigeon meat is processed by fully bleeding and depilating the pigeon meat without leaving any internal organs; the stewing is to wash the pigeon meat and then put it into boiling water and stew it for 30 to 60 minutes to make the meat cooked through, and no ingredients are added during the stewing process.

10. Distillers grains pigeon meat prepared by the method according to any one of claims 1 to 9.

Images