Application of RNAaptamer R1SR13 in preparation of medicine for treating acute cerebrovascular diseases

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of RNA aptamer R1SR13 in preparation of a medicine for treating acute cerebrovascular diseases. The nucleotide sequence of the RNA aptamer provided by the invention is shown as SEQ ID NO.1. The aptamer can be specifically combined with RCAN1.1 L protein and is competitively combined with ATF2mRNA, so that the interaction between RCAN1.1 L and ATF2mRNA is inhibited, the accumulation of ATF2 in mitochondria is reduced, the mitochondrial function is protected, the cell apoptosis is inhibited, and the pathological process of the acute cerebrovascular disease is reversed. Therefore, the invention provides a new thought for the treatment of acute cerebrovascular diseases, and is beneficial to further widening the application range of RNA (Ribonucleic Acid).

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to an application of RNAaptamer R1SR13 in preparing a drug for treating acute cerebrovascular diseases. Background Art

[0002] Acute ischemic stroke (AIS) is one of the diseases with the highest mortality and disability rates in my country. Its pathogenesis is mainly due to local cerebral ischemia, which leads to insufficient oxygen and glucose supply, thus causing neuronal death and functional loss. Studies have shown that mitochondrial dysfunction plays a key role in the pathological process of AIS, especially in the ischemic penumbra, where mitochondrial morphological changes and functional impairment are important factors in inducing neuronal apoptosis. Therefore, protecting mitochondrial function and inhibiting apoptotic responses have gradually become important strategies for the treatment of AIS.

[0003] In clinical practice, although some drugs (such as edaravone and coenzyme Q10) have shown certain effects in protecting mitochondrial function or inhibiting apoptosis, their clinical effects are subject to many limitations, such as low bioavailability, limited efficacy, and a short time window for arterial recanalization treatment. In addition, methods such as calcium channel blockers and hypothermia therapy face challenges due to poor drug permeability and potential risks of complications. At present, the development of neuroprotective drugs has not achieved the expected clinical effects. Therefore, the development of new treatment strategies has become an important issue that needs to be solved urgently.

[0004] Previous studies by the inventors' research group have shown that the RNA binding protein RCAN1.1L plays a key role in promoting neuronal apoptosis. However, therapeutic strategies targeting this protein have not been fully developed. If a therapeutic method that effectively inhibits RCAN1.1L and its downstream effects can be developed, it will provide a new direction for the treatment of acute cerebrovascular diseases and have important clinical significance. Summary of the invention

[0005] In view of the prior art, the present invention provides an application of RNAaptamer R1SR13 in the preparation of a drug for treating acute cerebrovascular disease. The present invention regulates the mitochondrial apoptosis pathway from the source, fills the gap in existing treatment methods, has significant clinical transformation potential and application prospects, and provides an innovative treatment strategy for early intervention and long-term functional recovery of AIS.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] A use of RNAaptamer R1SR13 in preparing a drug for treating acute cerebrovascular disease, wherein the nucleotide sequence of the RNAaptamer R1SR13 is shown in SEQ ID NO.1.

[0008] AUACAACAAAAACAAAAACAAGAAA (SEQ ID NO. 1).

[0009] As an innovative neuroprotective drug, RNA aptamer R1SR13 has high specificity and affinity, and can target mitochondrial-related proteins or pathways to achieve more precise therapeutic effects. Its unique molecular structure also allows for modification to enhance stability and the ability to cross the blood-brain barrier, overcoming many limitations of existing treatments. The development of RNA aptamer R1SR13 can provide new therapeutic perspectives and tools for the development of this drug for the treatment of stroke.

[0010] Preferably, the acute cerebrovascular disease is acute ischemic stroke.

[0011] The present invention also provides a method for preparing a medicine for treating acute ischemic stroke, wherein the medicine comprises an effective dose of RNAaptamer R1SR13 and a pharmaceutically acceptable carrier or a viral vector.

[0012] Preferably, the pharmaceutically acceptable carrier comprises at least one of chitosan, cholesterol, liposomes and nanoparticles.

[0013] Preferably, the viral vector comprises at least one of a lentiviral vector, an adenoviral vector, and an adeno-associated virus.

[0014] Preferably, the dosage form of the drug is one of an injection and an oral preparation.

[0015] The present invention also provides a detection reagent for RNA binding protein RCAN1.1L, wherein the detection reagent comprises a nucleotide sequence as shown in SEQ ID NO.1.

[0016] The present invention also provides an RNA binding protein RCAN1.1L detection kit, which comprises the detection reagent.

[0017] RCAN1 (calcineurin regulatory factor 1) is an RNA binding protein. The inventors found in the research process that RCAN1 is closely related to mitochondrial dysfunction and neuronal apoptosis in AIS. RCAN1.1L stabilizes ATF2 mRNA and promotes its accumulation in damaged mitochondria, thereby activating the mitochondrial apoptosis program. Based on this, the present invention obtains an inhibitory RNA aptamer R1SR13 that specifically binds to RCAN1.1L through systematic ligand evolution enrichment (SELEX) screening, and its structure can specifically bind to the RCAN1.1L 56-158 protein region, thereby preventing the interaction between RCAN1.1L and ATF2mRNA.

[0018] In the actual binding process, R1SR13 competitively binds to ATF2 mRNA by binding to RCAN1.1L protein, reducing the accumulation of ATF2 mRNA in mitochondria, thereby reducing the level of mtATF2 protein. The reduction of ATF2 protein effectively inhibits mitochondrial dysfunction and apoptosis, and alleviates neuronal death in the ischemic penumbra region in AIS. In the mouse MCAO model, R1SR13 significantly reduced the infarct volume of AIS, alleviated mitochondrial morphological damage, reduced the levels of Cyt c, cleaved caspase-9 and cleaved caspase-3, and inhibited mitochondrial-induced apoptosis. In addition, in SH-SY5Y cells, R1SR13 treatment can significantly improve mitochondrial membrane potential (ΔΨm), reduce reactive oxygen species (ROS) production, and increase mtDNA levels.

[0019] Therefore, R1SR13 screened by the present invention is a RNA aptamer that specifically binds to RCAN1.1L, which has the advantages of high targeting and clear molecular mechanism. It can competitively bind to RCAN1.1L protein, block the accumulation of ATF2 mRNA in mitochondria, significantly improve mitochondrial function, reduce the production of reactive oxygen (ROS), restore mitochondrial membrane potential (ΔΨm) and maintain mitochondrial DNA level, thereby effectively protecting neurons in the ischemic penumbra and inhibiting mitochondrial-induced cell apoptosis. The experimental results in the mouse MCAO model and human SH-SY5Y cells showed that R1SR13 significantly reduced the volume of cerebral infarction and the expression levels of key apoptotic proteins (Cyt c, cleaved caspase-9 and cleaved caspase-3), showing a strong mitochondrial protection and neuroprotection. Compared with traditional neuroprotectants or antioxidants, R1SR13 is more precise in its mechanism of action, can regulate the mitochondrial apoptosis pathway from the source, fills the gap in existing treatment methods, has significant clinical transformation potential and application prospects, and provides an innovative treatment strategy for early intervention and long-term functional recovery of AIS.

[0020] In summary, compared with the prior art, the present invention has the following advantages: by inhibiting the binding of RCAN1.1L to ATF2 mRNA, the screened R1SR13 can effectively protect the mitochondrial function of damaged neurons and slow down neuronal apoptosis, thereby providing a new targeted treatment strategy for the treatment of AIS. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The magnetic resonance imaging results of the mouse brain after injection of AAV-R1SR13 and control virus for MCAO modeling;

[0022] Figure 2 The results of immunofluorescence detection of ischemic penumbra in mice brain after injection of AAV-R1SR13 and control virus for MCAO modeling;

[0023] Figure 3 The mouse brain was injected with AAV-R1SR13 and control virus to establish MCAO model. Transmission electron microscopy was used to observe the ultrastructural results of mitochondria in the ischemic penumbra region of the mouse cortex.

[0024] Figure 4 After SH-SY5Y cells were infected with Lv-R1SR13 and control virus, transmission electron microscopy was used to detect the mitochondrial structure of cells under oxygen and glucose deprivation in the OGD 6h model;

[0025] Figure 5The results of Western blot detection of apoptosis-related proteins in the OGD 6h model after SH-SY5Y cells were infected with Lv-R1SR13 and control virus respectively;

[0026] Figure 6 Image J software Figure 5 Quantitative analysis of the results

[0027] Figure 7 The results of detecting mitochondrial membrane potential by fluorescence microscopy combined with JC-1 dye in the OGD 6h model after SH-SY5Y cells were infected with Lv-R1SR13 and control virus respectively;

[0028] Figure 8 The results and quantitative graphs of intracellular reactive oxygen species (ROS) levels detected by flow cytometry in the OGD 6h model after SH-SY5Y cells were infected with Lv-R1SR13 and control virus respectively;

[0029] Fig. 9 The results of detecting the expression level of mtND1 by RT-qPCR in the OGD 6h model after SH-SY5Y cells were infected with Lv-R1SR13 and control virus respectively;

[0030] Fig.10 This is the result of RNA binding experiment;

[0031] Fig.11 The results of RNAscope in the ischemic penumbra of mice injected with AAV-R1SR13 and control virus respectively for MCAO modeling;

[0032] Fig.12 The results of using RT-qPCR to detect ATF2 mRNA levels in the cytoplasm and mitochondria in the OGD 6h model after SH-SY5Y cells were infected with Lv-R1SR13 and control virus respectively;

[0033] Fig.13 The results of Western blot analysis of the expression level of mitochondrial ATF2 protein in the OGD 6h model after SH-SY5Y cells were infected with Lv-R1SR13 and control virus respectively;

[0034] Fig.14 To use Image J Fig.13 Quantitative analysis chart of

[0035] Figure 15-16 The results of immunofluorescence co-localization analysis in the OGD 6h model were shown after SH-SY5Y cells were infected with Lv-R1SR13 and control virus respectively;

[0036] Fig.17 MRA and T2WI scans were performed on mice in the MCAO model and sham operation group. DETAILED DESCRIPTION

[0037] The present invention is further described below in conjunction with examples. These examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually carried out according to conventional conditions in the art or according to the conditions recommended by the manufacturer; the raw materials, reagents, etc. used, unless otherwise specified, are all raw materials and reagents that can be obtained from commercial channels such as conventional markets. Any non-substantial changes and substitutions made by those skilled in the art on the basis of the present invention belong to the scope of protection claimed by the present invention.

[0038] Example 1 Synthesis of R1SR13

[0039] RNA aptamers that specifically bind to RCAN1.1L were screened by SELEX technology. The aptamer was synthesized by chemical synthesis (Jima Gene, China) to ensure that its structure and stability meet the requirements of drug development. The final screened R1SR13 can be used as a candidate drug for the treatment of AIS, which can inhibit the interaction between RCAN1.1L and ATF2 mRNA, reduce mitochondrial damage and cell apoptosis, and improve the prognosis of stroke.

[0040] The specific process of SELEX screening is as follows:

[0041] First, an oligonucleotide library containing 35 random nucleotides was established, and an RNA library was generated after in vitro transcription. Then, the purified RCAN1.1L 56-158 protein, the purified random RNA library and the Ni beads were combined in vitro, incubated at 4°C for 2 hours, and then the Ni beads were rinsed 3 times, and then the RNA was extracted. The extracted RNA was reversed into a cDNA library, and then PCR amplified. The amplified double-stranded DNA was once again transcribed in vitro to form an RNA library, and the above steps were repeated. After 4 repeated screenings, we cut the double-stranded DNA and inserted it into a blank vector for molecular cloning. Finally, the positive clones were sequenced for the first generation to obtain the RCN1 aptamer R1SR13, the sequence of which is shown in SEQ ID NO:1:

[0042] AUACAACAAAAACAAAAACAAGAAA (SEQ ID NO. 1).

[0043] Test Example 1 Performance Verification

[0044] 1. Test samples: After screening R1SR13 in the present invention, chemical synthesis was performed (Jima Gene, China), and the random sequence R1SR13mt was synthesized: AUCACCACCCCCACCCCCACCUCAA (SEQ ID NO.2) as a control. In this study, AAV9-GFP was used as a vector for delivering R1SR13 / R1SR13mt in animal models, named AAV9-R1SR13 and AAV-R-CON (Weizhen Biotechnology, China); Lv-GFP was used as a vector for delivering R1SR13 / R1SR13mt in cell models, named Lv-R1SR13 and Lv-R-CON (Weizhen Biotechnology, China).

[0045] 2. Experimental animals: The experimental animals were purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd. and were all male KM mice (25-30 g, 4-6 weeks old).

[0046] The mouse MCAO (middle cerebral artery occlusion) model is a commonly used animal model in ischemic stroke research. The specific modeling process is as follows: the mouse is dissected to expose the right carotid artery, external carotid artery and internal carotid artery, and a silicon-coated nylon filament (MSMC23B120PK50, Reward, China) is inserted into the right middle cerebral artery (MCA) to induce local ischemia. The laser speckle blood flow imaging system (LSCI, Reward, China) is used to repeat cerebral blood flow detection at 10 minutes and 24 hours after surgery. Mice with a cerebral blood flow reduction of more than 70% compared with baseline were included in the study.

[0047] Representative Data of the Mouse MCAO (Middle Cerebral Artery Occlusion) Model

[0048] The experimental results are as follows Fig.17 As shown, the experimental results showed that the model of the middle cerebral artery occlusion (MCAO) group was successfully established. After 24 hours, MRA of the MCAO group mice showed no visualization of the right middle cerebral artery, and a large area of ​​infarction occurred in the right cerebral hemisphere.

[0049] 3. Experimental process: The study used a middle cerebral artery occlusion (MCAO) mouse model and SH-SY5Y cells treated with oxygen-glucose deprivation (OGD), and evaluated by comparing the effects of R1SR13 and R1SR13mt. In the animal model, MRI detection showed that R1SR13 could significantly reduce the infarct area induced by MCAO, and immunofluorescence analysis showed that it reduced the levels of cytochrome c and cleaved caspase-9 and caspase-3 in the ischemic penumbra, suggesting that R1SR13 inhibited mitochondrial apoptosis. Transmission electron microscopy observations found that R1SR13 effectively alleviated mitochondrial morphological damage under simulated ischemic conditions after MCAO, improved mitochondrial membrane potential, mitochondrial DNA levels, and reduced reactive oxygen production.

[0050] The results of the above animal model were verified in the cell model. SH-SY5Y cells were infected with Lv-R1SR13 and control virus and then subjected to OGD conditions for 6 hours. Transmission electron microscopy observation showed that R1SR13 effectively alleviated mitochondrial morphological damage, improved mitochondrial membrane potential and mitochondrial DNA levels, and reduced reactive oxygen production. Immunofluorescence analysis showed that it reduced the levels of cytochrome c and cleaved caspase-9 and caspase-3 in the ischemic penumbra.

[0051] The results of RNA binding experiments, mitochondrial protein isolation tests, RNAscope and immunofluorescence co-localization analysis to explore the specific mechanism showed that R1SR13 competitively bound to ATF2mRNA with RCAN1.1L protein, thereby reducing the level of mtATF2 protein, thereby reversing mitochondrial damage and preventing cell apoptosis.

[0052] 4. Test results: Specific test results are as follows: Figures 1 to 16 As shown by Figure 1 It can be seen that the magnetic resonance imaging (MRI) T2-weighted imaging (T2WI) technology showed that the infarct area of ​​mice treated with R1SR13 for 24 hours after MCAO (middle cerebral artery occlusion) was significantly reduced compared with the control group (n=5).

[0053] Figure 2 (Scale bar: 5 μm (n=3)) indicates that in the MCAO model, after mice were stereotaxically injected with AAV9-R-CON or AAV9-R1SR13, immunofluorescence showed that the levels of cytochrome c (Cytc), cleaved caspase-3 and cleaved caspase-9 proteins in the ischemic penumbra white matter area of ​​the AAV9-R1SR13-GFP group were significantly reduced.

[0054] Figure 3 The figure shows (scale bar: 1 μm). The mitochondrial ultrastructure of neurons in the white matter region of mice was observed using transmission electron microscopy (TEM). The results showed that after injection of AAV9-R1SR13, mitochondrial morphological damage was significantly alleviated and the integrity of the mitochondrial membrane structure was protected.

[0055] Figure 4 (Scale bar: 1 μm) indicates that in SH-SY5Y cells, after culturing the cells treated with R1SR13 under oxygen-glucose deprivation (OGD) conditions for 6 hours, the mitochondrial morphology was significantly protected as observed by transmission electron microscopy, and the mitochondrial swelling and cristae damage were significantly reduced compared with the control group.

[0056] Figure 5In the second row, “-” corresponds to Lv-R-CON, and “+” corresponds to Lv-R1SR13. Western blot analysis showed that after 6 h of OGD, the expression of apoptosis-related proteins (Cyt c, cleaved caspase-9, and cleaved caspase-3) in SH-SY5Y cells treated with R1SR13 was significantly reduced, and the level of Fis1 was stable. Figure 6 The quantitative analysis results of Image J software further verified that the above differences were statistically significant (n=3).

[0057] Figure 7 The mitochondrial membrane potential (ΔΨm) was detected by fluorescence microscopy combined with JC-1 dye. The results showed that the ΔΨm of R1SR13-treated cells was significantly improved after 6 hours of OGD (n=3).

[0058] Figure 8 Flow cytometry was used to detect the level of intracellular reactive oxygen species (ROS). The results showed that ROS generation in SH-SY5Y cells treated with R1SR13 was significantly reduced under OGD conditions, and quantitative analysis of mean fluorescence intensity further confirmed this result (n=3).

[0059] Fig. 9 The results of RT-qPCR (the detection kit was purchased from Toyobo, Japan with the catalog number of QPK-201) are shown below. The expression level of mtND1 (mitochondrial DNA encoding gene) in SH-SY5Y cells treated with R1SR13 was significantly increased after 6 hours of OGD (n=4).

[0060]

[0061] Fig.10 The RNA binding experiment (the detection kit number is P2151, purchased from Bio-Tech Biotechnology) showed that R1SR13 significantly reduced the binding ability of ATF2 mRNA to RCAN1.1L 56-158 protein by competitively binding to RCAN1.1L protein, and this effect depended on the sequence integrity of R1SR13, and its mutants did not show similar effects.

[0062] Fig.11 (Scale bar: 5 μm) RNAscope (the detection kit has a catalog number of 323100, purchased from BioTechne, USA) results showed that in the MCAO model, R1SR13 significantly reduced the ATF2 mRNA level in mitochondria through competitive binding and significantly increased its level in the cell nucleus.

[0063] Fig.12The results of RT-qPCR (the detection kit was purchased from Toyobo, Japan with the catalog number QPK-201), and the primer sequences involved are shown below, which further verified that after SH-SY5Y cells were treated with R1SR13, the ATF2 mRNA levels in the cytoplasm and mitochondria at 6 hours of OGD were significantly reduced, while the expression level in the cell nucleus was significantly increased (n=3).

[0064]

[0065] Fig.13 The results of Western blot analysis showed that in SH-SY5Y cells treated with R1SR13, the expression level of ATF2 protein in the mitochondrial fraction (Mito) was significantly reduced after 6 hours of OGD, while the ATF2 protein level in the whole cell lysate (WC) remained stable. Fig.14 This finding was further supported by quantitative analysis using Image J (n=3).

[0066] Figure 15-16 (Scale bar: 5 μm) is the result of immunofluorescence colocalization analysis, indicating that R1SR13 treatment significantly inhibited the colocalization of ATF2 protein and MitoTracker-labeled mitochondria after 6 hours of OGD, and Image J line scanning analysis showed that the level of ATF2 protein in mitochondria was significantly reduced. This result was further confirmed by LSM 980 confocal microscope imaging.

[0067] Finally, it should be noted that the above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those familiar with the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A use of RNAaptamer R1SR13 in the preparation of a drug for treating acute cerebrovascular disease, characterized in that: The nucleotide sequence of the RNAaptamer R1SR13 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The acute cerebrovascular disease shown is acute ischemic stroke.

3. A method for preparing a drug for treating acute ischemic stroke, characterized in that: The drug comprises an effective dose of RNAaptamer R1SR13 and a pharmaceutically acceptable carrier or viral vector.

4. The drug according to claim 3, characterized in that The pharmaceutically acceptable carrier includes at least one of chitosan, cholesterol, liposomes and nanoparticles.

5. The drug according to claim 3, characterized in that The viral vector includes at least one of a lentiviral vector, an adenoviral vector, and an adeno-associated virus.

6. The drug according to claim 3, characterized in that The dosage form of the drug is one of an injection and an oral preparation.

7. A detection reagent for RNA binding protein RCAN1.1L, characterized in that: The detection reagent includes the nucleotide sequence shown in SEQ ID NO.

1.

8. A detection kit for RNA binding protein RCAN1.1L, characterized in that: The kit comprises the detection reagent according to claim 7.

Images