New application of circACACA

Abstract

The present invention relates to the technical field of poultry breeding, and specifically provides a new application of circACACA. The present invention obtained eight differentially expressed circRNAs, and these circRNAs are all expected to be used as markers for FLS diagnosis. The present invention also constructed a molecular regulatory network of circACACA and found that circACACA is significantly highly expressed in chicken liver, mainly located in the cytoplasm, and circACACA functions as a molecular sponge for miR-132b-5p and miR-101-2-5p. circACACA mediates the CBFB / PIM1 complex through the ceRNA mechanism, thereby regulating the AKT / mTOR and PPAR-γ signaling pathways and participating in the regulation of fat metabolism and the maintenance of health in poultry liver.

Description

Technical Field

[0001] The present invention relates to the technical field of poultry breeding, and particularly to a new application of circACACA. Background Art

[0002] Fatty Liver Syndrome (FLS) is the most common lipid metabolic disease in poultry, which generally occurs in laying hens with good body condition during the peak laying period. Infected chickens have a significantly shortened peak laying period, a significant decrease in egg production rate, often accompanied by an increase in body weight, and in severe cases, the mortality rate is as high as 5%-20%, which can cause huge economic losses to the poultry breeding industry. This disease is a complex pathological syndrome caused by a variety of factors such as genetics, environment, and metabolic stress. At present, domestic and foreign scholars mostly relieve the incidence of FLS by controlling energy levels, protein intake, and regulating the external environment. However, there is still a lack of effective preventive measures to completely prevent the occurrence of this disease. Some studies have shown that circRNAs play a key role in the regulation of fat metabolism. However, there is no report on whether and how circACACA regulates the pathological mechanism of FLS through biological processes. In addition, many functional circRNAs and their specific mechanisms of action have not been fully explored and need to be further studied and verified. Summary of the Invention

[0003] The present invention aims to deeply explore the potential role of circACACA in chicken liver steatosis and its molecular regulation mechanism, so as to provide new ideas and methods for solving chicken FLS, and thus proposes a new application of circACACA.

[0004] To achieve the above object, the technical solution of the present invention is as follows:

[0005] In a first aspect, the present invention provides an application of a circRNA marker in the preparation of an FLS diagnostic product, wherein the circRNA marker is selected from at least one of circACACA, circKMT2E, circAHCTF1, circMAP4K5, circUSP45, circRHEB, circPLXNC1, and circQPRT.

[0006] The FLS diagnostic product includes but is not limited to reagents, reagent kits, chips, etc.

[0007] Preferably, the circRNA marker is circACACA, or the circRNA marker is a combination of circACACA and at least one of circKMT2E, circAHCTF1, circMAP4K5, circUSP45, circRHEB, circPLXNC1, and circQPRT.

[0008] In a second aspect, the present invention provides an application of a reagent for reducing or inhibiting the expression of the circACACA gene in the preparation of a product for promoting lipid metabolism balance in the liver of chickens and / or enhancing the antioxidant stress capacity of liver cells and / or weakening liver cell autophagy, wherein the reagent has a sequence shown in SEQ ID NO. 1 to SEQ ID NO. 2 or a sequence shown in SEQ ID NO. 3 to SEQ ID NO. 4.

[0009] Preferably, the target miRNAs of the circACACA gene include miR-132b-5p and miR-101-2-5p, and the common target gene of miR-132b-5p and miR-101-2-5p is CBFB.

[0010] In a third aspect, the present invention provides an application of miR-132b-5p and / or miR-101-2-5p in the preparation of a product for promoting lipid metabolism balance in the liver of chickens and / or enhancing the antioxidant stress capacity of liver cells and / or weakening liver cell autophagy.

[0011] In a fourth aspect, the present invention provides an application of a reagent for enhancing or promoting the expression of miR-132b-5p or a reagent for reducing the adsorption of miR-132b-5p in the preparation of a product for promoting lipid metabolism balance in the liver of chickens and / or enhancing the antioxidant stress capacity of liver cells and / or weakening liver cell autophagy, wherein the reagent has a sequence shown in SEQ ID NO. 76.

[0012] In a fifth aspect, the present invention provides an application of a reagent for enhancing or promoting the expression of miR-101-2-5p or a reagent for reducing the adsorption of miR-101-2-5p in the preparation of a product for promoting lipid metabolism balance in the liver of chickens and / or enhancing the antioxidant stress capacity of liver cells and / or weakening liver cell autophagy, wherein the reagent has a sequence shown in SEQ ID NO. 78.

[0013] In a sixth aspect, the present invention provides an application of a reagent for reducing or inhibiting the expression of the CBFB gene in the preparation of a product for promoting lipid metabolism balance in the liver of chickens and / or enhancing the antioxidant stress capacity of liver cells and / or weakening liver cell autophagy, wherein the reagent has a sequence shown in SEQ ID NO. 84 to SEQ ID NO. 85.

[0014] In a seventh aspect, the present invention provides a product for promoting lipid metabolism balance in the liver of chickens and / or enhancing the antioxidant stress capacity of liver cells and / or weakening liver cell autophagy, which is characterized by comprising the reagents described in the second, fourth, fifth, and sixth aspects or miR-132b-5p and / or miR-101-2-5p described in the third aspect.

[0015] In an eighth aspect, the present invention provides a method for promoting lipid metabolism balance in the liver of chickens and / or enhancing the antioxidant stress capacity of liver cells and / or weakening autophagy of liver cells for non-therapeutic and non-diagnostic purposes, which is characterized by including: transfecting the sequences shown in SEQ ID NO. 1 to SEQ ID NO. 2, or transfecting the sequences shown in SEQ ID NO. 3 to SEQ ID NO. 4, or transfecting the sequence shown in SEQ ID NO. 76, or transfecting the sequence shown in SEQ ID NO. 78, or transfecting the sequences shown in SEQ ID NO. 84 to SEQ ID NO. 85, or transfecting miR-132b-5p and / or miR-101-2-5p into primary chicken liver cells.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0017] 1) The present invention obtained eight differentially expressed circRNAs: circACACA, circKMT2E, circAHCTF1, circMAP4K5, circUSP45, circRHEB, circPLXNC1, circQPRT, all of which are expected to be used as markers for FLS diagnosis.

[0018] 2) By constructing the molecular regulatory network of circACACA, the present invention found that circACACA was significantly highly expressed in the chicken liver and mainly located in the cytoplasm, and circACACA played a biological function as a molecular sponge for miR-132b-5p and miR-101-2-5p. miR-132b-5p and miR-101-2-5p can promote the balance of lipid metabolism in the liver, enhance the antioxidant stress capacity of liver cells, and at the same time weaken the activity of autophagy. CBFB is a common target downstream gene of miR-132b-5p and miR-101-2-5p. Similar to circACACA, CBFB can promote the accumulation of lipid droplets in liver cells, weaken the antioxidant stress capacity of cells, and induce the occurrence of autophagy. circACACA mediates the CBFB / PIM1 complex through the ceRNA mechanism, thereby regulating the AKT / mTOR and PPAR-γ signaling pathways and participating in the regulation of fat metabolism and the maintenance of health in the poultry liver.

[0019] In summary, the present invention provides new research ideas and directions for further in-depth exploration of the potential functions of circRNAs in diseases. Description of the Drawings

[0020] The accompanying drawings described herein are used to provide a further understanding of the present invention, and constitute a part of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention, and do not constitute an improper limitation of the present invention. In the drawings:

[0021] Figure 1 It is the quality assessment result of circRNA sequencing data of 6 samples in Example 1 of the present invention. Among them, A is the error rate distribution diagram of 6 samples; B is the GC content distribution diagram of 6 samples.

[0022] Figure 2 It is the analysis and identification result of circRNA in Example 1 of the present invention. Among them, A is the identification of circRNA in FL and CL; B is the statistical chart of circRNA sequence length; C is the statistics of circRNA sources of each sample; D is the circos diagram of the density distribution of circRNA of each sample on the chromosome.

[0023] Figure 3 It is the differential expression analysis result of circRNA in chicken FL and CL in Example 1 of the present invention. Among them, A is the volcano plot of differentially expressed circRNA; B is the analysis statistical chart of differentially expressed circRNA; C is the clustering map of differentially expressed circRNA.

[0024] Figure 4 It is the enrichment analysis result of genes from which differentially expressed circRNA is derived in Example 1 of the present invention. Among them, A is the KEGG enrichment analysis of genes from which differentially expressed circRNA is derived; B is the GO enrichment map of genes from which differentially expressed circRNA is derived.

[0025] Figure 5 It is the verification of the circular structure and stability of circRNA in Example 2 of the present invention. Among them, A is the circRNA source information and Sanger sequencing; B is the amplification results of circRNA and β-actin with N9 and Oligo d(T) primers; C is the expression levels of circRNA and β-actin after treatment with RNase R. **P < 0.01 indicates a highly significant difference.

[0026] Figure 6 It is the verification result of the expression levels of 8 kinds of circRNA in Example 2 of the present invention. *P < 0.05 indicates a significant difference, and **P < 0.01 indicates a highly significant difference.

[0027] Figure 7 It is the tissue expression pattern of circACACA in Example 2 of the present invention. abP < 0.05 indicates a significant difference.

[0028] Figure 8Subcellular localization of circACACA in Example 2 of the present invention.

[0029] Figure 9 Interference and overexpression efficiency of circACACA in Example 2 of the present invention, where A is the interference efficiency of circACACA; B is the overexpression efficiency of circACACA. *P < 0.05 indicates significant difference, **P < 0.01 indicates extremely significant difference.

[0030] Figure 10 Effect of circACACA on intracellular lipid metabolism in chicken liver cells detected by qPCR in Example 2 of the present invention, where (A-C) are the expressions of lipid synthesis-related genes, lipid transport-related genes, and fatty acid β-oxidation-related genes analyzed by qPCR after interfering with circACACA; (D-F) are the expressions of lipid synthesis-related genes, lipid transport-related genes, and β-oxidation-related genes analyzed by qPCR after overexpressing circACACA. *P < 0.05 indicates significant difference, **P < 0.01 indicates extremely significant difference.

[0031] Figure 11 Effect of circACACA on intracellular lipid metabolism in chicken liver cells detected by Western blot and TC, TG kits in Example 2 of the present invention, where A is the protein levels of FASN and ACOX1 detected by Western blot after interfering with circACACA; B is the protein levels of FASN and ACOX1 detected by Western blot after overexpressing circACACA; C is the detection of TG content in liver cells after interfering with and overexpressing circACACA; D is the detection of TC content in liver cells after interfering with and overexpressing circACACA. *P < 0.05 indicates significant difference, **P < 0.01 indicates extremely significant difference.

[0032] Figure 12 Effect of circACACA on lipid droplet accumulation in liver cells detected by BODIPY 493 / 503 staining in Example 2 of the present invention, where A is the BODIPY 493 / 503 fluorescence staining map of lipid droplets in liver cells after interfering with and overexpressing circACACA; B is the statistics of lipid droplet staining area after interfering with circACACA; C is the statistics of lipid droplet staining area after overexpressing circACACA. **P < 0.01 indicates extremely significant difference.

[0033] Figure 13In Example 2 of the present invention, qPCR and Western blot were used to analyze the effect of circACACA on cellular antioxidant stress. Among them, A shows the expression of antioxidant stress-related genes after interfering with circACACA by qPCR; B shows the expression of antioxidant stress-related genes after overexpressing circACACA by qPCR; C shows the protein expression of SOD and GPX7 after interfering with circACACA by Western blot; D shows the protein expression of SOD and GPX7 after overexpressing circACACA by Western blot. *P < 0.05 indicates a significant difference, and **P < 0.01 indicates an extremely significant difference.

[0034] Figure 14 In Example 2 of the present invention, the effects of circACACA on ROS and antioxidant stress enzyme activities were studied. Among them, A shows the effect of circACACA on ROS production detected by flow cytometry; B shows the effect of circACACA on the accumulation of MAD in cells; (C - E) show the effects of circACACA on the activities of antioxidant stress enzymes in cells. *P < 0.05 indicates a significant difference, and **P < 0.01 indicates an extremely significant difference.

[0035] Figure 15 In Example 2 of the present invention, qPCR and Western blot were used to analyze the effect of circACACA on autophagy in cells. Among them, A shows the mRNA expression of autophagy-related genes after interfering with circACACA detected by qPCR; B shows the mRNA expression of autophagy-related genes after overexpressing circACACA detected by qPCR; C shows the protein levels of autophagy-related genes after interfering with circACACA analyzed by Western blot; D shows the protein levels of autophagy-related genes after overexpressing circACACA analyzed by Western blot. *P < 0.05 indicates a significant difference, and **P < 0.01 indicates an extremely significant difference.

[0036] Figure 16 In Example 2 of the present invention, Mcherry-EGFP-LC3 adenovirus and transmission electron microscopy were used to detect the effect of circACACA on autophagy in cells. Among them, A shows the change in autophagic flux in cells after interfering with circACACA detected by Mcherry-EGFP-LC3 adenovirus; B shows the change in autophagosomes in cells after overexpressing circACACA observed by transmission electron microscopy.

[0037] Figure 17 In Example 3 of the present invention, the distribution map of miRNA sequencing error rates for 6 samples.

[0038] Figure 18 In Example 3 of the present invention, the chromosomal density distribution map of reads for 6 samples.

[0039] Figure 19 For the miRNA sequencing data analysis of 6 samples in Example 3 of the present invention, where A is the sequence length distribution diagram of 6 samples; B is the TPM density distribution diagram of 6 samples; C is the TPM box plot of 6 samples; D is the TPM interval distribution of miRNAs.

[0040] Figure 20 For the differential expression analysis of miRNAs in chicken FL and CL in Example 3 of the present invention, where A is the verification of miRNAs in chicken FL and CL; B is the volcano plot of differentially expressed miRNAs; C is the clustering diagram of differentially expressed circRNAs.

[0041] Figure 21 For the prediction and identification of circACACA target miRNAs in Example 3 of the present invention, where A is the Venn diagram of RNAhybrid and circRNA-seq predicting circRNA target miRNAs; B is the detection of the expression levels of potential target miRNAs after interfering with the overexpression of circACACA by qPCR; (C, D) are the detection of the expression levels of miR-132b-5p and miR-101-2-5p after interfering with the overexpression of circACACA by qPCR; E is the expression pattern of miR-132b-5p and miR-101-2-5p in CL and FL in miRNA sequencing; (F, G) are the detection of the target relationship between circACACA and miR-132b-5p and miR-101-2-5p by FISH. *P < 0.05 indicates significant difference, **P < 0.01 indicates extremely significant difference.

[0042] Figure 22 For the verification of the target relationship between circACACA and miRNAs in Example 3 of the present invention, where (A, B) are the predicted diagrams of the binding sites between circACACA and miR-132b-5p and miR-101-2-5p; (C, D) are the construction of the circACACA dual luciferase reporter vector; (E, F) are the detection of the dual luciferase activity. *P < 0.05 indicates significant difference, **P < 0.01 indicates extremely significant difference.

[0043] Figure 23This is to detect the effect of miR-132b-5p on intracellular lipid metabolism in chicken liver cells in Example 3 of the present invention. Among them, (A, B) are for detecting the overexpression efficiency of miR-132b-5p interference; (C-E) are for qPCR analysis of the expression of genes related to lipid synthesis, transport and decomposition after interfering with miR-132b-5p; (F-H) are for qPCR analysis of the expression of genes related to lipid synthesis, transport and decomposition after overexpressing miR-132b-5p. *P < 0.05 indicates significant difference, and **P < 0.01 indicates extremely significant difference.

[0044] Figure 24 This is to detect the effect of miR-132b-5p on intracellular lipid metabolism in chicken liver cells by Western blot and TC, TG kits in Example 3 of the present invention. Among them, (A, B) are for detecting the protein levels of FASN and ACOX1 after interfering with miR-132b-5p by Western blot; (C, D) are for detecting the protein levels of FASN and ACOX1 after overexpressing miR-132b-5p by Western blot; E is for detecting the TG content in liver cells after interfering with and overexpressing miR-132b-5p; F is for detecting the TC content in liver cells after interfering with and overexpressing miR-132b-5p. **P < 0.01 indicates extremely significant difference.

[0045] Figure 25 This is to detect the effect of miR-132b-5p on intracellular lipid droplet accumulation in liver cells by BODIPY 493 / 503 staining in Example 3 of the present invention. Among them, A is the BODIPY 493 / 503 fluorescence staining map of lipid droplets in liver cells after interfering with and overexpressing miR-132b-5p; B is the statistics of the lipid droplet staining area after interfering with miR-132b-5p; C is the statistics of the lipid droplet staining area after overexpressing miR-132b-5p. **P < 0.01 indicates extremely significant difference.

[0046] Figure 26 This is to analyze the effect of miR-132b-5p on cellular antioxidant stress by qPCR and Western blot in Example 3 of the present invention. Among them, A is for qPCR analysis of the mRNA expression of antioxidant stress-related genes after interfering with miR-132b-5p; B is for detecting the protein expression of SOD and GPX7 after interfering with miR-132b-5p by Western blot; C is for qPCR analysis of the mRNA expression of antioxidant stress-related genes after overexpressing miR-132b-5p; D is for detecting the protein expression of SOD and GPX7 after overexpressing miR-132b-5p by Western blot. *P < 0.05 indicates significant difference, and **P < 0.01 indicates extremely significant difference.

[0047] Figure 27 For the effects of miR-132b-5p on ROS and antioxidant stress enzyme activities in Example 3 of the present invention, where (A, B) are the effects of miR-132b-5p on ROS production detected by flow cytometry; C is the effect of miR-132b-5p on the accumulation of MAD in cells; (D-F) are the effects of miR-132b-5p on the activities of antioxidant stress enzymes in cells. *P < 0.05 indicates a significant difference, and **P < 0.01 indicates an extremely significant difference.

[0048] Figure 28 For the effects of miR-132b-5p on autophagy in cells analyzed by qPCR and Western blot in Example 3 of the present invention, where A is the mRNA expression of autophagy-related genes detected by qPCR after interfering with miR-132b-5p; B is the protein level of autophagy-related genes analyzed by Western blot after interfering with miR-132b-5p; C is the mRNA expression of autophagy-related genes detected by qPCR after overexpressing miR-132b-5p; D is the protein level of autophagy-related genes analyzed by Western blot after overexpressing miR-132b-5p. *P < 0.05 indicates a significant difference, and **P < 0.01 indicates an extremely significant difference.

[0049] Figure 29 For the effects of miR-132b-5p on autophagy in cells detected by Mcherry-EGFP-LC3 adenovirus and transmission electron microscopy in Example 3 of the present invention, where A is the change in autophagic flux in cells detected by Mcherry-EGFP-LC3 adenovirus after interfering with miR-132b-5p; B is the change in autophagosomes in cells observed by transmission electron microscopy after overexpressing miR-132b-5p.

[0050] Figure 30 For the effects of miR-101-2-5p on lipid metabolism in chicken liver cells detected by qPCR in Example 3 of the present invention, where (A, B) are the detections of the overexpression efficiency of miR-101-2-5p interference; (C-E) are the qPCR analyses of the expressions of genes related to lipid synthesis, transport, and decomposition after interfering with miR-101-2-5p; (F-H) are the qPCR analyses of the expressions of genes related to lipid synthesis, transport, and decomposition after overexpressing miR-101-2-5p. *P < 0.05 indicates a significant difference, and **P < 0.01 indicates an extremely significant difference.

[0051] Figure 31In Example 3 of the present invention, Western blot and TC and TG kits were used to detect the effect of miR-101-2-5p on intracellular lipid metabolism in chicken liver cells. Among them, (A, B) show the protein levels of FASN and ACOX1 detected by Western blot after interfering with miR-101-2-5p; (C, D) show the protein levels of FASN and ACOX1 detected by Western blot after overexpressing miR-101-2-5p; E shows the detection of the TG content in liver cells after interfering with and overexpressing miR-101-2-5p; F shows the detection of the TC content in liver cells after interfering with and overexpressing miR-101-2-5p. **P < 0.01 indicates a highly significant difference.

[0052] Figure 32 In Example 3 of the present invention, BODIPY 493 / 503 staining was used to detect the effect of miR-101-2-5p on lipid droplet accumulation in liver cells. Among them, A is the BODIPY 493 / 503 fluorescence staining map of lipid droplets in liver cells after interfering with and overexpressing miR-101-2-5p; B is the statistics of the lipid droplet staining area after interfering with miR-101-2-5p; C is the statistics of the lipid droplet staining area after overexpressing miR-101-2-5p. **P < 0.01 indicates a highly significant difference.

[0053] Figure 33 In Example 3 of the present invention, qPCR and Western blot were used to analyze the effect of miR-101-2-5p on cellular antioxidant stress. Among them, A is the mRNA expression of antioxidant stress-related genes analyzed by qPCR after interfering with miR-101-2-5p; B is the protein expression of SOD and GPX7 detected by Western blot after interfering with miR-101-2-5p; C is the mRNA expression of antioxidant stress-related genes analyzed by qPCR after overexpressing miR-101-2-5p; D is the protein expression of SOD and GPX7 detected by Western blot after overexpressing miR-101-2-5p. *P < 0.05 indicates a significant difference, and **P < 0.01 indicates a highly significant difference.

[0054] Figure 34 In Example 3 of the present invention, the effect of miR-101-2-5p on ROS and antioxidant stress enzyme activity was studied. Among them, (A, B) show the effect of miR-101-2-5p on ROS production detected by flow cytometry; C shows the effect of miR-101-2-5p on the accumulation of MAD in cells; (D-F) show the effect of miR-101-2-5p on the activity of antioxidant stress enzymes in cells. *P < 0.05 indicates a significant difference, and **P < 0.01 indicates a highly significant difference.

[0055] Figure 35 In Example 3 of the present invention, qPCR and Western blot were used to analyze the effect of miR-101-2-5p on autophagy in cells. Among them, A shows the mRNA expression of autophagy-related genes detected by qPCR after interfering with miR-101-2-5p; B shows the protein levels of autophagy-related genes analyzed by Western blot after interfering with miR-101-2-5p; C shows the mRNA expression of autophagy-related genes detected by qPCR after overexpressing miR-101-2-5p; D shows the protein levels of autophagy-related genes analyzed by Western blot after overexpressing miR-101-2-5p. *P < 0.05 indicates a significant difference, and **P < 0.01 indicates an extremely significant difference.

[0056] Figure 36 In Example 3 of the present invention, Mcherry-EGFP-LC3 adenovirus and transmission electron microscopy were used to detect the effect of miR-101-2-5p on autophagy in cells. Among them, A shows the change in autophagic flux in cells detected by Mcherry-EGFP-LC3 adenovirus after interfering with miR-101-2-5p; B shows the change in autophagosomes in cells observed by transmission electron microscopy after overexpressing miR-101-2-5p.

[0057] Figure 37 In Example 3 of the present invention, prediction and identification of the target genes of miR-132b-5p and miR-101-2-5p were carried out. Among them, A is a Venn diagram of target genes of miR-132b-5p and miR-101-2-5p predicted by different software; B is the binding site of miR-132b-5p and miR-101-2-5p to CBFB predicted by RNAhybrid; (C, D) show the effect of miR-132b-5p and miR-101-2-5p on CBFB mRNA detected by qPCR; (E, F) show the construction of CBFB-WT and CBFB-MT dual-luciferase reporter vectors; (G, H) show the detection of dual-luciferase activity. *P < 0.05 indicates a significant difference, and **P < 0.01 indicates an extremely significant difference.

[0058] Figure 38 In Example 3 of the present invention, qPCR was used to detect the effect of CBFB on lipid metabolism in chicken liver cells. Among them, (A, B) show the detection of the overexpression efficiency of CBFB interference; (C-E) show the expression of genes related to lipid synthesis, transport, and decomposition analyzed by qPCR after interfering with CBFB; (F-H) show the expression of genes related to lipid synthesis, transport, and decomposition analyzed by qPCR after overexpressing CBFB. *P < 0.05 indicates a significant difference, and **P < 0.01 indicates an extremely significant difference.

[0059] Figure 39In Example 3 of the present invention, Western blot and TC and TG kits were used to detect the effect of CBFB on intracellular lipid metabolism in chicken liver cells. Among them, A shows the protein levels of FASN and ACOX1 detected by Western blot after interfering with CBFB; B shows the protein levels of FASN and ACOX1 detected by Western blot after overexpressing CBFB; C shows the detection of intracellular TG content after interfering with and overexpressing CBFB; D shows the detection of intracellular TC content after interfering with and overexpressing CBFB. **P < 0.01 indicates a highly significant difference.

[0060] Figure 40 In Example 3 of the present invention, BODIPY 493 / 503 staining was used to detect the effect of CBFB on lipid droplet accumulation in liver cells. Among them, A shows the BODIPY 493 / 503 fluorescence staining images of lipid droplets in liver cells after interfering with and overexpressing CBFB; B shows the statistics of the stained area of lipid droplets after interfering with CBFB; C shows the statistics of the stained area of lipid droplets after overexpressing CBFB. **P < 0.01 indicates a highly significant difference.

[0061] Figure 41 In Example 3 of the present invention, the effect of CBFB on antioxidant stress in liver cells was studied. Among them, A shows the mRNA expression of antioxidant stress-related genes analyzed by qPCR after interfering with CBFB; B shows the mRNA expression of antioxidant stress-related genes analyzed by qPCR after overexpressing CBFB; C shows the protein expression of SOD and GPX7 detected by Western blot after interfering with CBFB; D shows the protein expression of SOD and GPX7 detected by Western blot after overexpressing CBFB. (E, F) show the effect of CBFB on intracellular ROS production detected by flow cytometry; *P < 0.05 indicates a significant difference, and **P < 0.01 indicates a highly significant difference.

[0062] Figure 42 In Example 3 of the present invention, qPCR and Western blot were used to analyze the effect of CBFB on autophagy. Among them, A shows the mRNA expression of autophagy-related genes detected by qPCR after interfering with CBFB; B shows the mRNA expression of autophagy-related genes detected by qPCR after overexpressing CBFB; C shows the protein levels of autophagy-related genes analyzed by Western blot after interfering with CBFB; D shows the protein levels of autophagy-related genes analyzed by Western blot after overexpressing CBFB. *P < 0.05 indicates a significant difference, and **P < 0.01 indicates a highly significant difference.

[0063] Figure 43In Example 3 of the present invention, Mcherry-EGFP-LC3 adenovirus and transmission electron microscopy were used to detect the effect of CBFB on autophagy. Among them, A shows the change in autophagic flux in cells after interfering with CBFB detected by Mcherry-EGFP-LC3 adenovirus; B shows the change in autophagosomes in cells after overexpressing CBFB observed by transmission electron microscopy.

[0064] Figure 44 In Example 3 of the present invention, CBFB regulates the AKT / mTOR and PPAR-γ signaling pathways. Among them, (A, B) show the expression of key proteins in the AKT / mTOR signaling pathway and PPAR-γ signaling pathway detected by Western blot after interfering with CBFB; (C, D) show the expression of key proteins in the AKT / mTOR signaling pathway and PPAR-γ signaling pathway detected by Western blot after overexpressing CBFB. *P < 0.05 indicates significant difference, **P < 0.01 indicates extremely significant difference.

[0065] Figure 45 In Example 3 of the present invention, the interaction relationship between CBFB and PIM1 was verified. Among them, A shows the mRNA expression of PIM1 detected by qPCR after interfering with or overexpressing CBFB; (B, C) show the protein expression of PIM1 detected by Western blot after interfering with or overexpressing CBFB; D shows the verification of the binding relationship between CBFB and PIM1 by immunoprecipitation assay. *P < 0.05 indicates significant difference, **P < 0.01 indicates extremely significant difference.

[0066] Figure 46 In Example 3 of the present invention, PIM1 regulates the AKT / mTOR and PPAR-γ signaling pathways. Among them, A shows the expression of key proteins in the AKT / mTOR signaling pathway and PPAR-γ signaling pathway detected by Western blot after interfering with PIM1; B shows the statistics of the gray values of the key protein bands in the AKT / mTOR signaling pathway and PPAR-γ signaling pathway after interfering with PIM1. *P < 0.05 indicates significant difference, **P < 0.01 indicates extremely significant difference.

[0067] Figure 47 In Example 3 of the present invention, co-transfection experiments were used to verify that the CBFB and PIM1 complex participates in the AKT / mTOR and PPAR-γ signaling pathways. Among them, A shows the expression of proteins related to lipid metabolism, antioxidant stress and autophagy, and key proteins in the AKT / mTOR and PPAR-γ signaling pathways detected by Western blot after co-transfecting si-CBFB and si-PIM1; (B, C) show the statistics of the gray values of each protein band after co-transfection. *P < 0.05 indicates significant difference, **P < 0.01 indicates extremely significant difference.

[0068] Figure 48 In Example 3 of the present invention, circACACA regulates the AKT / mTOR and PPAR-γ signaling pathways by targeting miR-132b-5p. Among them, A is the expression of proteins related to lipid metabolism, antioxidant stress, and autophagy, as well as key proteins in the AKT / mTOR and PPAR-γ signaling pathways detected by Western blot after co-transfecting ov-circACACA and miR-132b-5p mimics; (B, C) are the statistics of the gray values of each protein band after co-transfection. *P < 0.05 indicates significant difference, and **P < 0.01 indicates extremely significant difference.

[0069] Figure 49 In Example 3 of the present invention, circACACA regulates the AKT / mTOR and PPAR-γ signaling pathways by targeting miR-101-2-5p. Among them, A is the expression of proteins related to lipid metabolism, antioxidant stress, and autophagy, as well as key proteins in the AKT / mTOR and PPAR-γ signaling pathways detected by Western blot after co-transfecting ov-circACACA and miR-101-2-5p mimics; (B, C) are the statistics of the gray values of each protein band after co-transfection. *P < 0.05 indicates significant difference, and **P < 0.01 indicates extremely significant difference.

[0070] Figure 50 In Example 3 of the present invention, circACACA regulates the AKT / mTOR and PPAR-γ signaling pathways by mediating CBFB. Among them, A is the expression of proteins related to lipid metabolism, antioxidant stress, and autophagy, as well as key proteins in the AKT / mTOR and PPAR-γ signaling pathways detected by Western blot after co-transfecting ov-circACACA and si-CBFB; (B, C) are the statistics of the gray values of each protein band after co-transfection. *P < 0.05 indicates significant difference, and **P < 0.01 indicates extremely significant difference. Detailed implementation manners

[0071] In the description of the present invention, it should be noted that for those not specified in the examples, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0072] The present invention uses the national approved variety Tianfu broiler as a research model. By performing circRNA sequencing analysis on the livers of FLS-infected chickens and normal chickens, a significantly differentially expressed circRNA, namely circACACA, was screened out. Subsequently, using in vitro cultured primary chicken liver cells, the specific functions and molecular regulatory mechanisms of circACACA in the process of chicken liver lipid metabolism and lesions were systematically explored.

[0073] In addition, it should be noted that "U" or "u" in all RNA sequences in the embodiments of the present invention is represented by "w" in the sequence listing.

[0074] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0075] Embodiment 1:

[0076] This example verifies FLS and sequences circRNA in fatty liver and normal liver, as follows:

[0077] (1) Experimental animals

[0078] The "Tianfu Broiler" supporting system was approved by the National Animal Genetic Resources Committee in September 2018. It utilizes the genetic resources of local chicken breeds in my country. The present invention selects Tianfu broiler parent-generation breeder chickens as research objects to explore the pathogenesis of chicken FLS.

[0079] In this study, 300 200-day-old Tianfu broiler parent-generation breeder chickens with consistent egg-laying conditions and similar basic body weight were selected for the experiment. All the experimental chickens came from and were raised at the Poultry Breeding Experimental Farm of Sichuan Agricultural University in Ya'an City, Sichuan Province. The feeding management and immunization and health care procedures were implemented in accordance with the "Tianfu Broiler" Supporting Parent-Generation Breeder Feeding and Management Manual, with 15 hours of light per day, automatic drinking water, and automatic feces cleaning.

[0080] In this experiment, 300 experimental chickens were randomly divided into two groups, namely the fatty liver group (experimental group) and the normal liver group (control group). The control group was given a basic diet of 125 g / chicken at the time of light on (5 o'clock) every day to meet the energy requirements of body growth and reproductive capacity, while the experimental group chickens were allowed to eat freely. After 300 days of age, some experimental chickens were selected and anesthetized by intravenous injection of water and chloral (50 mg / kg), and then other samples such as tissues and serum were collected. All animal experiments in this study were approved by the Experimental Animal Ethics Committee of Sichuan Agricultural University and strictly followed the relevant provisions of the national animal welfare ethics and animal protection principles.

[0081] (2) Test methods

[0082] (2-1) Sample collection

[0083] After reaching 300 days of age, 10 chickens were selected from each experimental group, and 15 mL of blood was collected using a blood collection tube without anticoagulant. After standing for 15 minutes, it was centrifuged at a speed of 3500 r / min for 10 minutes to separate the serum. The serum samples were frozen and stored at -20 °C for further testing.

[0084] Subsequently, the chickens were anesthetized by injecting water and chloral and then sacrificed. The abdominal cavity was opened aseptically, and part of the liver tissue was quickly collected, immediately frozen in liquid nitrogen and stored in an ultra-low temperature freezer at -80 °C for extracting total RNA for circRNA sequencing. And part of the liver tissue was collected and fixed in 4% paraformaldehyde for oil red O staining, hematoxylin-eosin (HE) staining and immunohistochemistry of LC3 for tissue sections.

[0085] (2-2) Determination of serum indexes

[0086] The contents of TG and TC in the serum were determined using kits from Nanjing Jiancheng Bioengineering Institute. The oxidation and antioxidant kits from Nanjing Jiancheng Bioengineering Institute were also used to detect the contents or activities of GSH, GSH-Px and T-AOC. The reagent preparation and operation steps were carried out according to the instructions.

[0087] (2-3) HE staining, oil red O staining and LC3 immunofluorescence

[0088] Three normal livers and three fatty livers of chickens were taken, and part of the liver tissue was taken out and the surrounding bloodstains were removed with phosphate buffered saline (PBS). Subsequently, the tissue was immersed in 4% paraformaldehyde for fixation. Then, the fixed liver tissue was embedded in paraffin and cut into thin slices. The slices were dewaxed in xylene and then dehydrated successively through 100%, 95%, 80% and 70% ethanol. Then, the slices were washed in distilled water for 5 minutes and immersed in hematoxylin staining solution, eosin staining solution and oil red O staining solution for staining. After staining, dehydration was carried out again through 70%, 80%, 95% and 100% ethanol. Finally, the slices were made transparent in xylene. After taking out the slices, a neutral gum mounting agent was dropped and a coverslip was covered. After the mounting agent was dried, the tissue sections were observed under a microscope.

[0089] For immunofluorescence staining of LC3, the processing steps are similar to those of HE staining and Oil Red O staining. First, the tissue samples are fixed, sectioned, dewaxed, dehydrated, and washed. Then, the sections are placed in an EDTA antigen retrieval buffer and heated in a microwave oven to 90 - 95 °C for 15 minutes to expose the antigen sites. Next, the sections are blocked with 5% bovine serum albumin (BSA) at room temperature for 30 minutes to reduce non-specific binding. Subsequently, the sections are immersed in a dilution containing a specific LC3 antibody and incubated overnight at 4 °C. The dilution of the fluorescently labeled secondary antibody is incubated with the sections at room temperature for 1 h. Finally, the sections are mounted and observed under a microscope.

[0090] (2 - 4) Library construction, sequencing, and analysis of the circRNA transcriptome

[0091] RNA extraction from the fatty liver and normal liver tissues of chickens was completed using a commercially available kit, and circRNA-seq of the fatty liver and normal liver of chickens was completed by Novogene Co., Ltd. in Beijing. This process is a conventional method in the art and will not be analyzed in detail here.

[0092] (2 - 4 - 1) RNA extraction from tissue samples

[0093] First, the fatty liver and normal liver tissue samples of chickens are ground into powder using liquid nitrogen, and a small amount of the powder is taken for RNA extraction. 1 ml of RNAiso Plus is added to each sample for lysis, followed by the addition of 200 µl of chloroform. After mixing, the samples are left to stand at 4 °C for 10 minutes. Then, they are centrifuged at 12000 rpm for 15 minutes, and the supernatant is collected. Next, 700 µl of pre-chilled isopropanol is added, and after mixing, the samples are left to stand for 10 minutes and centrifuged at 12000 rpm for 10 minutes. The supernatant is discarded. Then, 75% ethanol is added, and the samples are vortexed until a large amount of precipitate is suspended. They are then centrifuged at 12000 rpm for 5 minutes, and the supernatant is discarded. Finally, the EP tubes are inverted on filter paper for 3 - 5 minutes. After the precipitate is dried, it is diluted with DEPC water. Subsequently, the integrity of the sample RNA and the presence of DNA contamination are analyzed by agarose gel electrophoresis; the purity, concentration, and integrity of the RNA are further evaluated by Nanodrop and Agilent 2100 bioanalyzer. The qualified RNA samples are stored in a -80 °C ultra-low temperature freezer for later use.

[0094] (2 - 4 - 2) Library construction and sequencing

[0095] The circRNA-seq of chicken fatty liver and normal liver was completed by Beijing Novogene Technology Co., Ltd. A strand-specific circRNA library was constructed using the method of removing ribosomal RNA. First, the ribosomal RNA was removed from the total RNA using the Epicentre Ribo-ZeroTM kit, and then the RNA was fragmented into short fragments of 250-300 bp by RNase R enzyme. The fragmented RNA was used as a template, and random oligonucleotides were used as primers to synthesize the first strand of cDNA. Then, the RNA strand was degraded by RNase H, and the second strand of cDNA was synthesized using dNTPs (dUTP, dATP, dGTP, and dCTP) as raw materials. AMPure XP beads were used to purify the cDNA. The purified double-stranded cDNA was subjected to end repair, A-tailing, and ligation of sequencing adapters, and cDNA of about 350-400 bp was screened using AMPure XP beads. The second strand of cDNA containing U was degraded using USER enzyme, and finally, PCR amplification was performed to obtain the library. Qubit and Agilent 2100 bioanalyzer were used for library inspection. After the library inspection was qualified, Illumina PE150 sequencing was performed to obtain the information of the raw sequencing sequence (Raw data) of the fragment to be sequenced.

[0096] Analysis (2-4-3)

[0097] The quality of Raw data was evaluated by statistically analyzing data such as the sequencing error rate, data volume, and alignment rate. If the standards were met, information analysis of circRNA was performed. The specific analysis process was as follows: First, the Raw data was filtered to remove reads with sequencing adapters or low sequencing quality. The sequencing error rate and GC content distribution were checked to obtain clean reads. The clean reads obtained by sequencing were aligned to the reference genome (gallus_gallus_Ensembl_97 reference genome (ftp: / / ftp.ensembl.org / pub / release97 / fasta / gallus_gallus / dna / ) using the Hisat2 (http: / / ccb.jhu.edu / software / hisat2) software. Two software programs, find_circ and CIRI, were used jointly to analyze and identify circRNA. The length distribution of circRNA was statistically analyzed, its origin and chromosomal distribution were analyzed, and the expression levels of known and new circRNA in each sample were normalized using TPM. The formula was as follows, where libsize represents the sum of the sample circRNA readcounts.

[0098] TPM = (read count * 1,000,000) / libsize

[0099] Differential expression analysis was performed on two groups of samples using DESeq based on the negative binomial distribution. The overall distribution of differential circRNAs was evaluated by volcano plots, and differential circRNAs were screened according to the adjusted significance level (padj < 0.05) and fold change. After obtaining the differentially expressed circRNAs between the two groups, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed on the set of source genes of each group of differentially expressed circRNAs according to the corresponding relationship between circRNAs and their source genes. Finally, the miRanda software was used to analyze and predict the binding sites between the spliced circRNAs and miRNAs.

[0100] (2 - 5) Data analysis

[0101] SPSS 19.0 software was used for significance tests. Student's t - test was used for difference comparison between two groups, and one - way analysis of variance (One - way ANOVA) was used for difference analysis among multiple groups. The significance level was set as P < 0.05 indicating significant difference, denoted as *; P < 0.01 was extremely significant difference, denoted as **; different letters (a, b, c) with P < 0.05 represented significant differences between different treatment groups. All data were presented as mean ± standard error of the mean (SEM).

[0102] (3) Results and analysis

[0103] (3 - 1) Verification of the chicken fatty liver model

[0104] (3 - 1 - 1) Histomorphological comparison of chicken fatty liver (FL) and normal liver (CL)

[0105] Through the comparison of liver histomorphology, it was found that the livers of the experimental group chickens were significantly larger in volume, lighter in color, yellow in appearance, greasy to the touch, soft and fragile in texture, with bleeding points on the surface, and blunt edges compared with the control group ( Figure 1 in A). Oil Red O staining can stain lipid droplets in tissues red and is often used to evaluate the accumulation of fat in liver tissue samples. The results of this experiment showed that a large number of red - stained areas appeared in the livers of the experimental group chickens, indicating a large accumulation of lipid droplets in chicken liver cells ( Figure 1In B). In this study, HE staining technology was further used to observe the basic structure and pathological characteristics of the liver tissues of the two groups of chickens. The results showed that the liver cells of the treated group of chickens were filled with white fat, the volume was significantly increased, the cell nucleus was squeezed to one side by the fat, and a large number of inflammatory cells infiltrated ( Figure 1 In C).

[0106] (3-1-2) Comparison of serum indexes of chicken FL and CL

[0107] The contents of TG and TC in the sera of the two groups of chickens were detected by a biochemical kit. The results showed that the TG level in the sera of the experimental group of chickens was significantly higher than that of the control group (P<0.05), and the TC content was extremely significantly higher than that of the control group ( Figure 2 In A; P<0.01). The activities of antioxidant stress-related enzymes in the sera were further evaluated. The results showed that the activities of GSH (P<0.01), GSH-Px (P<0.05) and T-AOC (P<0.01) in the sera of the treated group of chickens were significantly lower than those of the control group ( Figure 2 In B). The above results were all in line with the pathological characteristics of chicken FLS. Therefore, we preliminarily determined that the chicken FLS model was successfully constructed.

[0108] (3-1-3) LC3 immunofluorescence comparison of chicken FL and CL

[0109] To further confirm the successful construction of the chicken FLS model, we collected the liver tissues of the two groups of chickens, and performed fixation, embedding and sectioning. Subsequently, fluorescence staining was performed using the autophagy marker protein LC3 antibody. The results showed that the LC3 fluorescence staining area in CL was lower, while in the liver of the treated group, the fluorescence staining intensity was extremely significantly higher than that of the normal group ( Figure 3 ; P<0.01). These results further indicated that chickens suffering from FLS disease were successfully obtained in this experiment, providing a solid foundation for subsequent sequencing verification.

[0110] (3-21) circRNA sequencing of chicken FL and CL

[0111] (3-21-1) Data quality assessment of circRNA sequencing

[0112] Based on the above experimental results, we selected 3 FL samples and 3 CL tissue samples for circRNA transcriptome sequencing. The original sequencing data of the 6 samples have been deposited in the SRA database with the accession number PRJNA960781. The summary of the data quality of each sample is shown in Table 1. A total of 349,335,704 raw reads were obtained from all samples. After filtering out adapter-containing reads and reads with an N ratio greater than 0.002, 344,469,760 clean reads were obtained, with a total of 51.67 G of clean bases for subsequent data analysis. In addition, the error rate of all 6 samples was 0.03%, and its distribution is as shown in Figure 41 Figure A. The Q20 of each sample was higher than 97.23%, and Q30 was greater than 92.55%. The GC content of each sample was between 64.54% and 65.82%, and its content distribution is as shown in Figure 41 Figure B. The above results indicate that the sequencing data quality is good and subsequent analysis can be carried out.

[0113] Table 1 Data quality assessment of circRNA sequencing in chicken FL and CL

[0114]

[0115] (3-1-2)Analysis and identification of circRNA in circRNA sequencing

[0116] Furthermore, Hisat2 was used to align the clean reads to the genome, and circRNA was identified by two software, find_circ and CIRI. A total of 3979 circRNAs were identified in the 6 samples, of which 3187 circRNAs were found in the FL samples and 2924 circRNAs were found in the CL samples, while 2132 circRNAs were expressed in both the FL and CL samples ( Figure 2 Figure A). The lengths of these circRNAs were basically less than 1000 bp, mainly concentrated in 300 - 400 bp ( Figure 2 Figure B), and most circRNAs originated from exon splicing, with only a few circRNAs composed of introns and intergenic regions ( Figure 2 Figure C). The circRNA distribution density on each chromosome in each sample was statistically analyzed using a circos plot, and the results showed that circRNAs were randomly distributed on each chromosome ( Figure 2 Figure D).

[0117] (3-2)Data analysis of circRNA sequencing in chicken FL and CL

[0118] (3-2-1)Differential expression analysis of circRNA in chicken FL and CL

[0119] Differential expression analysis of circRNAs in two groups of samples was performed using DESeq2 based on the negative binomial distribution. The results showed that among 2,132 co-expressed circRNAs, 77 were differentially expressed in FL and CL samples. Compared with the control group, 46 circRNAs were up-regulated and 31 circRNAs were down-regulated ( Figure 3 in A, B), and the detailed information of differentially expressed circRNAs is listed in the attachment. The hierarchical clustering diagram of 77 differentially expressed circRNAs intuitively demonstrated the significant differences between the two groups of samples ( Figure 3 in C), further verifying the reliability and availability of the samples and sequencing data.

[0120] (3-2-2)Enrichment analysis of genes from which differentially expressed circRNAs originated

[0121] After obtaining the circRNAs with differential expression between the two groups, according to the corresponding relationship between circRNAs and their originating genes, KEGG and GO enrichment analyses were respectively performed on the genes from which these differentially expressed circRNAs originated. The results of KEGG enrichment analysis showed that the genes from which differentially expressed circRNAs originated were enriched in a total of 50 signal transduction pathways. Twenty pathways with the most significant enrichment were selected to draw a scatter plot for analysis, as Figure 4 shown in A, the parental genes of differentially expressed circRNAs were mainly significantly enriched in signal transduction pathways such as the insulin signaling pathway, the mTOR signaling pathway, fatty acid biosynthesis, and TGF-beta.

[0122] The results of GO enrichment analysis showed that the parental genes of differentially expressed circRNAs were significantly enriched in three main categories: Biological Process (BP), Cellular Component (CC), and Molecular Function (MF). In the BP category, it was mainly enriched in metabolic process; in the CC category, it was mainly enriched in cell part and intracellular; in the MF category, it was mainly enriched in catalytic activity, enzyme binding, and transferase activity ( Figure 4In B). The GO enrichment results showed that the host genes of these differentially expressed circRNAs were mainly involved in biological functions such as metabolic processes, cellular components, and catalytic activities. These results provided valuable clues for further exploring the role of circRNAs in poultry liver metabolic diseases, indicating that circRNAs may participate in chicken liver lipid metabolism and its growth and development through these key biological processes and signaling pathways.

[0123] Through the above analysis, this example considered that the top eight differentially expressed circRNAs: circACACA, circKMT2E, circAHCTF1, circMAP4K5, circUSP45, circRHEB, circPLXNC1, circQPRT, were all expected to be used as markers for FLS diagnosis. Among them, circACACA has been reported to be closely related to the occurrence, development, and energy metabolism process of various malignant tumors. Therefore, the present invention further focused on studying whether there is an association between circACACA and FLS, aiming to discover its new application directions.

[0124] Example 2:

[0125] This example carried out the identification and functional verification of circACACA, as follows:

[0126] (1) Experimental animals and experimental reagents

[0127] In this experiment, 30 Tianfu broilers at 200 days old with normal egg production were selected from the poultry breeding farm of Sichuan Agricultural University for the collection of primary liver cells. The animal experiment was approved by the Animal Ethics Committee of Sichuan Agricultural University, and the approval number was: 2021102006.

[0128] The main kits include: PrimeScriptTM RT reagent Kit With gDNA Eraser reverse transcription kit (TaKaRa, Dalian, catalog number RR047A), One Step TB Green® PrimeScript™ RT-PCR Kit II (TaKaRa, Dalian, RR086A), Western and IP cell lysis kit (Solarbio, Beijing, catalog number R0100), BCA protein quantification kit (Biobest, China, catalog number BB-3401), Super ECL chemiluminescence kit (Beyotime, Shanghai, catalog number P0018AS), ELISA kit (Newgeorge, Shanghai, catalog numbers NG-EH671, NG-EH250, NG-EH481 and NG-EH368), Omni-Easy™ one-step PAGE gel rapid preparation kit (Yaenzyme, China, catalog number PG212), endotoxin-free plasmid extraction kit (Omega, USA, catalog number D6948-01).

[0129] The main antibodies include: anti-β-Tubulin (Zhengneng, Chengdu, catalog number 200608), anti-GAPDH (Zhengneng, Chengdu, catalog number 390035), anti-ACOX1 (Aibotech, Wuhan, catalog number A8091), anti-FASN (Sanying, Wuhan, catalog number 10624-2-AP), anti-SOD (Sanying, Wuhan, catalog number 10269-1-AP), anti-GPX7 (Aibotech, Wuhan, catalog number A3902), anti-LC3 Ⅰ / Ⅱ (Cell Signaling Technology, USA, catalog number 12741), anti-P62 (Cell Signaling Technology, USA, catalog number 39749), anti-Beclin1 (Aibotech, Wuhan, catalog number A11761), anti-Mouse IgG H&L (HRP) (Zhengneng, Chengdu, catalog number 511103), anti-Rabbit IgG H&L (HRP) (Zhengneng, Chengdu, catalog number 511203).

[0130] (2) Test methods

[0131] (2-1) siRNA design and vector construction

[0132] Based on the full-length sequence of circACACA, two specific siRNAs spanning the splicing site were designed and synthesized. The detailed sequence information is shown in Table 2. The design and synthesis of this siRNA were both completed by Shanghai GenePharma Co., Ltd. Meanwhile, the complete linear sequence of circACACA was inserted into the pCD25-ciR vector to construct a stable overexpression plasmid of circACACA. This pcD25-ciR vector was purchased from Guangzhou Gisai Biotechnology Co., Ltd., and the synthesis of the overexpression vector was completed on behalf by Beijing Tsingke Biotechnology Co., Ltd.

[0133] Table 2 siRNA sequences of circACACA

[0134]

[0135] (2-2)Isolation, culture, and transfection of primary chicken liver cells

[0136] Tianfu broilers with relatively light body weight and continuous egg production were selected for the isolation of primary chicken liver cells. The specific operation steps are as follows:

[0137] 1) The chickens were subjected to light fasting 12 h before sampling. During sampling, the chickens were fixed on the operating table, and according to the body weight of the chickens, chloral hydrate (50 mg / kg) was slowly injected through the wing vein to anesthetize them. After anesthesia, sodium heparin (175 U / kg) was immediately injected through the wing vein to prevent blood coagulation and ensure the smooth progress of subsequent flushing steps.

[0138] 2) After the chickens were weak in limbs and had their eyes closed, the chicken bodies were disinfected with alcohol. Subsequently, the abdominal cavity of the chicken was opened under sterile conditions, and the complete liver was taken out. The bloodstains and other impurities on the surface of the liver were washed with normal-temperature PBS buffer, and the whole liver was immersed in PBS, and then transferred to a sterile cell culture room for subsequent operations.

[0139] 3) A 50 mL sterile syringe was used to draw calcium-free HEPES perfusion solution (pH 7.5) to slowly and continuously flush the liver. Then, the liver was continuously flushed with calcium-containing HEPES washing solution (pH 7.5) until its color changed from dark red to yellowish brown.

[0140] 4) The rinsed liver was transferred to a laminar flow hood, and a part of the liver tissue with sufficient perfusion was cut, and the surface capsule, internal blood vessels, and other connective tissues were removed. Then, the liver tissue was cut into particles of about 1 mm³ size with an ophthalmic scissors and centrifuged at 2000 rpm for 5 minutes to remove the excess liquid and yellow fat.

[0141] 5) Add triple volume of type II collagenase and trypsin mixture (ratio 2:1), and digest for 15 to 20 min. Subsequently, add an equal volume of culture medium to terminate digestion. After pipetting evenly, let it stand for 3 min, take the supernatant and filter it through 40um and 70um filter sieves respectively, collect the filtered liquid, centrifuge at 2000 rpm for 5 minutes, and collect the cell pellet.

[0142] 6) Add triple volume of red blood cell lysis buffer, pipette evenly and let it stand for 10 min to completely lyse red blood cells. Subsequently, wash with PBS multiple times until the supernatant becomes clear and transparent.

[0143] 7) Resuspend the cells in M199 medium containing 1% penicillin-streptomycin and 10% fetal bovine serum, plate according to experimental requirements, and place it in an incubator with 5% CO 2 , in a humid environment at 37°C for culture. After culturing for 24 h, change to fresh medium.

[0144] 8) When the cell confluence reaches 80%, perform cell transfection. 1 - 3 h before transfection, change to M199 medium without penicillin-streptomycin. First, incubate the corresponding siRNA and overexpression vector with Opti-MEM® medium to form solution A; then, mix Opti-MEM® medium and Lipofectamine® 3000 reagent to make solution B. Mix solution A and solution B, incubate at room temperature for 15 minutes, and then transfer it into the cells. According to experimental requirements, collect cell samples at different time points after transfection for corresponding experiments.

[0145] (2 - 3) RNA extraction and cRNA synthesis

[0146] Put tissue or cell samples into a centrifuge tube containing RNAiso plus reagent. For tissue samples, they can be quickly frozen with liquid nitrogen and ground into powder; for cell samples, the cell suspension can be directly added to RNAiso plus for lysis. The specific operation steps are as follows:

[0147] 1) Add 200ul chloroform to 1ml lysis buffer, shake vigorously for 30s, let it stand at 4°C for 10 min. After it is stratified and clear, centrifuge at 12000rpm for 15min.

[0148] 2) Carefully aspirate the upper layer liquid, add another 200ul of chloroform, and repeat step (1).

[0149] 3) Aspirate 400 - 500ul of the upper layer liquid, add 600ul of pre-cooled isopropanol, and shake for 30s. Let it stand at 4°C for 10 min, and centrifuge at 12000rpm for 10min.

[0150] 4) Discard the supernatant, add 1 ml of 75% ethanol (diluted with RNase-free water), vortex, and centrifuge at 12,000 rpm for 5 min.

[0151] 5) Discard the supernatant and repeat step (4).

[0152] 6) Discard the supernatant, air-dry the pellet for 5 - 10 minutes, avoiding over-drying. Dissolve the dried RNA pellet in an appropriate amount of RNase-free water (usually 20 - 50 µL).

[0153] 7) Use a Nanodrop 2000 spectrophotometer to detect the absorbance of RNA at different wavelengths and evaluate the purity and concentration of the extracted RNA.

[0154] Using the PrimeScriptTM RT reagent Kit With gDNA Eraser reverse transcription kit, reverse transcribe the qualified RNA into cDNA. The detailed steps are as follows:

[0155] 1) According to the kit instructions, prepare the reaction mixture for removing genomic DNA (Table 3), and perform the reaction on a PCR instrument according to the program of reacting at 42°C for 2 min and storing at 12°C.

[0156] Table 3 Reverse transcription reaction system 1

[0157]

[0158] 2) After the first-step reaction, refer to the instructions, prepare the reaction mixture (Table 4) in the corresponding ratio and order. Add this mixture to the product of the first-step reaction and perform the following reaction on a PCR instrument: react at 37°C for 15 min, react at 85°C for 5 s, and then store at 12°C.

[0159] Table 4 Reverse transcription reaction system 2

[0160]

[0161] (2 - 4) Fluorescent quantitative PCR (qPCR)

[0162] All primers in this section were designed by Premier 5 software and synthesized by Beijing Tsingke Biotechnology Co., Ltd. The detailed sequence information of the primers is shown in Table 5. The reaction system for qPCR was as follows: 1 μl of template cDNA, 0.5 μl of forward primer, 0.5 μl of reverse primer, 5 μl of TB Green Premix Ex Taq II, and then diluted to a total volume of 10 μl with RNase-free water. The qPCR reaction conditions were as follows: reaction at 95°C for 5 min, reaction at 95°C for 10 s, reaction at the appropriate annealing temperature according to the primer for 20 s, reaction at 72°C for 20 s, for 40 cycles. β-actin was used as an internal reference gene.

[0163] Table 5 qPCR primer sequences

[0164]

[0165]

[0166] (2-5)Circular RNA circularization identification

[0167] Using the cDNA mixed sample of chicken liver cells as a template, PCR amplification was performed using the circRNA primers in section (2-4). The amplification program was as follows: first, react at 95°C for 10 minutes, then react at 95°C for 30 seconds, react for 30 seconds according to the annealing temperature of the primer, then react at 72°C for 30 seconds, for 36 cycles. Finally, react at 72°C for 10 minutes and store at 4°C. The amplification products were then subjected to Sanger sequencing, and the sequencing results were aligned using BioEdit Sequence Alignment Editor. The RNA of chicken liver cells was also used for the RNase R digestion experiment. Take 1 μg of RNA for RNase R digestion treatment, and at the same time take 1 μg of RNA for control treatment using RNase-free water. The treated RNAs were respectively reverse transcribed into cDNA and used as templates for qPCR fluorescence quantitative analysis using the circRNA primers in section (2-4). In addition, take 1 μg of the RNA mixed sample of liver cells for reverse transcription using random primer N9, and take another 1 μg of RNA for reverse transcription using Oligo d(T) primer, and analyze the expression levels of circRNA and β-actin by qPCR fluorescence quantitative analysis.

[0168] (2-6)Fluorescence In situ Hybridization (FISH)

[0169] First, based on the full-length sequence of circACACA, FISH probes spanning the splicing site were designed and synthesized by Beijing Tsingke Biotechnology Co., Ltd. The detailed sequence information is shown in Table 6. Subsequently, FISH experiments were conducted, and the operating steps are as follows:

[0170] 1) Cell collection and fixation: Adherent liver cells were collected. After discarding the culture medium, the cells were washed with PBS and then fixed with 4% paraformaldehyde for 15 min.

[0171] 2) Permeabilization treatment: The fixed cell samples were treated with RNase A and proteinase K to permeabilize the cell membrane and ensure that the probes could smoothly enter the cell interior.

[0172] 3) Probe preparation: The probes were diluted with sterile DEPC water to prepare a probe mixture.

[0173] 4) Hybridization incubation: The probe mixture was added to the cell samples to ensure that the probes evenly covered the sample area. Then, it was incubated overnight at 37 °C.

[0174] 5) Nuclear staining: The probe mixture was discarded. After washing the samples, DAPI working solution was added for staining for 10 min.

[0175] 6) Fluorescence microscopy observation: The fluorescence signals in the samples were observed using a fluorescence microscope, images were captured, and an image analysis software was used to record the positions and intensities of the probe signals.

[0176] Table 6 FISH probe sequences for circACACA

[0177]

[0178] (2 - 7) Western blot

[0179] First, primary chicken liver cells were seeded in 6-well plates for cell transfection. After 48 h, proteins were harvested for Western blot experiments. This process is a routine operation in the art and will not be described in detail here.

[0180] (2 - 8) BODIPY 493 / 503 staining

[0181] BODIPY 493 / 503 Staining: Seed the cells in a 96-well plate. After 48 h of transfection, discard the culture medium and wash the cells 3 times with PBS. Then, add 4% paraformaldehyde for fixation for 30 min. Subsequently, add the diluted BODIPY 493 / 503 staining solution to each well, stain for 15 min in the dark, and then wash with PBS. Next, add Hoechst staining solution to stain the cell nuclei for 15 min and wash with PBS again. Finally, observe the cell staining under a fluorescence inverted microscope and take stained photos.

[0182] Flow Cytometry ROS Assay (2 - 9)

[0183] Seed the cells in a 6-well plate. After 48 h of transfection, digest the cells with trypsin. Then centrifuge at 2000 rpm for 5 min to collect the cells, wash the cells twice with PBS, and centrifuge the cell pellet into an EP tube. Dilute DCFH-DA at a ratio of 1:1000 with serum-free culture medium and add 1 mL of the diluted solution to each sample. Incubate in an incubator at 37 °C for 20 min, and invert and mix the tubes every 3 - 5 min to ensure sufficient contact between the probe and the cells. After incubation, centrifuge at 2000 rpm for 5 min and discard the supernatant. Then wash the cells 3 times with serum-free culture medium to remove the DCFH-DA that has not entered the cells. Finally, perform the upper machine detection on the flow cytometer and analyze the flow cytometry data with CytExpert software.

[0184] Elisa Assay (2 - 10)

[0185] Use an Elisa enzyme-linked immunosorbent assay kit to detect the activities of MDA and antioxidant stress-related enzymes (SOD, GSH, and T-AOC) in the cells. Operate according to the kit instructions. At the same time, this process is a routine test operation in this field and will not be described in detail here.

[0186] LC3 Adenovirus Transfection (2 - 11)

[0187] Seed primary chicken liver cells in a 6-well plate and culture until the cell density reaches 70 - 80% confluence, then perform cell transfection. After 24 h of transfection, replace with fresh medium without antibiotics and culture for 1 h to stabilize the cell state. Subsequently, add an appropriate amount of virus solution to each well and gently shake the culture plate to ensure sufficient contact between the virus and the cells. After 8 h of incubation, replace with fresh medium and continue to culture for 48 h. Then collect the cells and fix them with 4% paraformaldehyde. Finally, observe the fluorescence signal of LC3 under a fluorescence microscope and randomly take fluorescence images.

[0188] Transmission Electron Microscopy (2 - 12)

[0189] Cells were seeded in 6-well plates. After 48 h of transfection, the cells were gently scraped off using a cell scraper, and the cells were collected by centrifugation at 2000 rpm for 5 minutes. Subsequently, 1 ml of electron microscopy fixative was added to fix the cells. After fixation, the cells were successively dehydrated in 30%, 50%, 70%, 90%, 95% and 100% ethanol solutions, with each treatment for 15 h, and finally dehydrated twice in pure acetone, with each time for 10 h. Then, the cells were embedded and polymerized, and the embedded samples were cut into ultra-thin sections 60-90 nm thick using an ultramicrotome. The sections were then stained in the dark with 2% uranyl acetate solution for 15-30 minutes, and then stained with lead citrate for 5 minutes. After that, the sections were gently rinsed with distilled water to remove the excess stain, and the sections were air-dried naturally. Finally, the samples were observed through a transmission electron microscope, and ultra-structural images were captured, and the collected images were processed and analyzed using image analysis software.

[0190] (2-13)Determination of TG and TC contents

[0191] The contents of TG and TC in cells were detected using a Nanjing Jiancheng biochemical kit. This is a routine operation and will not be described in detail here.

[0192] (2-14)Data analysis

[0193] The 2-△△t method was used to calculate the relative expression levels of target genes in qPCR experiments. Graph plotting was performed using GraphPad Prism 8.0 software, while the significance difference test was completed using SPSS 19.0 software.

[0194] (3)Results and analysis

[0195] (3-1)Verification of circRNA

[0196] (3-1-1)Verification of circRNA circular structure and stability

[0197] According to the sequencing and annotation results, the sequence characteristics and source information of differentially expressed circRNAs were analyzed in detail. Figure 5 Figure A shows the exon circularization structures of the top eight differentially expressed circRNAs. Then, the present invention designed open amplification primers targeting the circRNA circular splicing sites, and PCR amplification was performed using the cDNA mixed sample of chicken liver cells as a template. The amplification products were subjected to Sanger sequencing, and the results were compared with the sequences in the circRNA sequencing data, as Figure 5As shown by the red arrow in A, the splicing sites of circRNA were successfully amplified in this experiment. Random primers (N9) can effectively reverse transcribe all RNAs, while Oligo d(T) primers specifically target linear RNAs with Poly A tails. To further confirm the circular structure of circRNA, these two primers were used to amplify and perform qPCR analysis on the RNA of chicken liver cells. The results showed that the amplification efficiency of Oligo d(T) primers for circRNA was extremely low (P<0.01), indicating that the selected circRNAs in this experiment did not contain Poly A tails but existed in chicken liver cells in a head-to-tail circular structure ( Figure 5 in B). As shown in Figure 5 C, after treatment with RNase R, the expression level of circRNA remained basically unchanged, while the linear RNA β-actin was significantly degraded (P<0.01). In summary, the first eight differentially expressed circRNAs stably existed in chicken liver in a head-to-tail circular structure, which further verified the accuracy and reliability of the sequencing data.

[0198] (3-1-2) Verification of circRNA expression level

[0199] Furthermore, qPCR experiments were performed using liver tissue samples to verify the expression trends of differentially expressed circRNAs in the sequencing data. The results showed that circACACA, circKMT2E, circAHCTF1, circMAP4K5, circUSP45, and circRHEB were significantly highly expressed in fatty liver tissues (P<0.05), while the expression levels of circPLXNC1 and circQPRT were higher in normal liver tissues ( Figure 6 ; P<0.05). This result was consistent with the circRNA sequencing data, providing a reliable basis for subsequent experiments on these circRNAs as FLS diagnostic markers.

[0200] (3-2) Expression pattern and subcellular localization of circACACA

[0201] (3-2-1) Tissue expression pattern of circACACA

[0202] In view of the previous research progress on circACACA and its relatively high and significantly different expression levels, it was selected as the main research object in this experiment. The expression of circRNA is highly tissue-specific. Exploring the expression patterns of circRNA in different tissues plays an important role in the study of its potential biological functions and molecular mechanisms. In this study, 10 tissues including the liver, heart, spleen, lung, kidney, pectoral muscle, leg muscle, fat, brain, and intestine of normal chickens were collected, and the expression levels of circACACA in different tissues were detected by qPCR. The results showed that circACACA was expressed in the liver, fat, pectoral muscle, and heart tissues, and its expression level in the liver was significantly higher ( Figure 7 ; P < 0.05). This result suggests that circACACA may play an important role in lipid metabolism and health of chicken liver.

[0203] Subcellular localization of circACACA (3-2-2)

[0204] Based on the sequence of circACACA, specific in situ hybridization fluorescent probes were designed at its head and tail binding sites, and FISH verification was carried out in chicken liver cells, FL tissues, and CL tissues. The results showed that circACACA was expressed in both the nucleus and cytoplasm, but mainly concentrated in the cytoplasm ( Figure 8 ). This result implies that circACACA may carry out post-transcriptional regulation and play the function of a molecular sponge in the cytoplasm.

[0205] Effects of circACACA on lipid metabolism, antioxidant stress, and autophagy in chicken liver (3-2-3)

[0206] Effects of circACACA on lipid metabolism in the liver (3-2-3-1)

[0207] To explore the potential role of circACACA in chicken liver metabolism and development, two siRNAs spanning the splicing sites were designed and synthesized based on the full-length sequence of circACACA, named s1-circACACA and s2-circACACA (sequences are shown in Table 2). Meanwhile, its full-length sequence was cloned into the pcD25-ciR vector to construct a stable overexpression plasmid of circACACA, named ov-circACACA. Subsequently, the two siRNAs and the overexpression vector were transfected into primary chicken liver cells respectively to detect the expression level of circACACA under different treatment conditions. The results showed that both s1-circACACA and s2-circACACA could significantly reduce the expression of circACACA (P<0.05), and the inhibitory effect of s2-circACACA was more significant (P<0.01). Therefore, s2-circACACA was selected for subsequent experiments and named si-circACACA ( Figure 9 in A). In addition, transfection of the ov-circACACA vector also significantly increased the expression of circACACA ( Figure 9 in B; P<0.01). The above results indicate that the siRNA and overexpression plasmid of circACACA can significantly regulate the expression of circACACA in primary chicken liver cells in vitro and can be applied to subsequent functional verification experiments.

[0208] After transfection of si-circACACA into primary chicken liver cells cultured in vitro, it was detected by qPCR experiment that the mRNA expression levels of genes related to lipid synthesis (ACACA, SCD1, FASN, and SREBP) decreased significantly ( Figure 10 in A; P<0.01), but the mRNA expression levels of genes related to lipid transport (ApoVLDL-II, CPT1, and APOA1) (P<0.05) and genes related to fatty acid β-oxidation (ACADS, ACSL1, and ACOX1) (P<0.01) increased significantly ( Figure 10 in B, C). Conversely, after overexpression of circACACA in chicken liver cells, the expression levels of genes related to lipid synthesis increased significantly ( Figure 13 in D; P<0.01), while the expression of genes related to lipid transport and lipid catabolism was inhibited ( Figure 10 in E, F; P<0.01). The Western blot experiment further verified the changes at the protein expression level of related genes. The results showed that interfering with circACACA significantly inhibited the expression of FASN and promoted the expression of ACOX1 at the same time ( Figure 11in A; P < 0.01). On the contrary, with the increase in the expression of circACACA, the protein expression of FASN also increased, while the expression of ACOX1 showed the opposite trend ( Figure 11 in B; P < 0.05). Detecting the contents of TG and TC in cells is also one of the important indicators for evaluating liver lipid metabolism. As Figure 11 shown in C and D, with the increase in the expression level of circACACA, the accumulation of TG (P < 0.01) and TC (P < 0.05) in chicken liver cells increased significantly. The results of BODIPY staining showed that compared with the si-NC transfection group, the area of green fluorescence staining in cells of the si-circACACA transfection group decreased significantly ( Figure 12 in A and B; P < 0.01); while compared with the control group, a large number of positively stained cells were observed in the ov-circACACA treatment group ( Figure 12 in A and C; P < 0.01). In summary, circACACA can promote the accumulation of fat in liver cells and disrupt the metabolic balance of intracellular fat.

[0209] (3-2-3-2) Effects of circACACA on liver antioxidant stress

[0210] In addition, this study explored the potential role of circACACA in the antioxidant stress of liver cells. First, the qPCR results showed that inhibiting the expression of circACACA significantly increased the mRNA expression levels of antioxidant stress-related genes SOD, GPX7, TRX, and GST ( Figure 13 in A; P < 0.05), while overexpressing circACACA significantly downregulated the mRNA expression of SOD and TRX ( Figure 13 in B; P < 0.01). The Western blot results were consistent with the qPCR results. Interfering with circACACA significantly upregulated the protein expression of SOD and GPX7 ( Figure 13 in C; P < 0.05), while transfecting ov-circACACA had the opposite effect, significantly downregulating their protein expression ( Figure 13 in D; P < 0.05). In this experiment, the content of ROS in cells of different treatment groups was analyzed by flow cytometry. The results showed that with the increase in the expression level of circACACA, the accumulation of ROS in cells increased significantly ( Figure 14 in A; P < 0.01). Overexpression of CircACACA significantly increased the production of intracellular MDA ( Figure 14 in B; P < 0.05). In addition, interfering with circACACA significantly enhanced the activities of antioxidant stress-related enzymes SOD, GSH, and T-AOC ( Figure 14Among C-E; P < 0.05), while overexpression of circACACA led to a decrease in the activities of SOD and T-AOC ( Figure 14 Among C-E; P < 0.05). In summary, circACACA can induce an increase in the intracellular antioxidant stress level.

[0211] (3-2-3-3) Effect of circACACA on autophagy in liver cells

[0212] To further explore the effect of circACACA on autophagy in liver cells, qPCR and Western blot were used to detect the expression of autophagy marker genes at the mRNA and protein levels respectively. The qPCR results showed that interfering with circACACA significantly reduced the mRNA expression levels of Beclin1, ATG5, ATG7, and ATG9, and simultaneously led to an increase in the expression of P62 ( Figure 15 Among A; P < 0.05). On the contrary, overexpression of circACACA significantly promoted the expression of Beclin1 and ATG9 and reduced the expression of P62 ( Figure 15 Among B; P < 0.05). The Western blot results were consistent with the qPCR results. Reducing the expression of circACACA could alleviate the protein levels of autophagy-related genes ( Figure 15 Among C; P < 0.05), and overexpression of circACACA significantly increased the levels of autophagy-related proteins, but not including P62 ( Figure 15 Among D; P < 0.05). In addition, Mcherry-EGFP-LC3 adenovirus was used to track autophagosomes. The fluorescence protein labeling results showed that the positive fluorescence staining area in the cells transfected with si-circACACA was significantly lower than that in the control group ( Figure 16 Among A). Further observation by transmission electron microscopy found that overexpression of circACACA could increase the number of autophagosomes in cells ( Figure 16 Among B). In summary, circACACA can promote autophagy in chicken liver cells.

[0213] Example 3:

[0214] This example studies the molecular mechanisms by which circACACA regulates chicken liver lipid metabolism, antioxidant stress, and autophagy, as follows:

[0215] (1) Experimental animals and experimental reagents

[0216] The sources of the experimental animals were the same as those in Example 1 and Example 2.

[0217] Kit: Dual-luciferase reporter gene detection kit (Shanghai Beyotime, product number RG027), and other kits were the same as those in Example 2.

[0218] The antibodies included: anti-AKT (Wuhan Abbkine, product number A8P0140), anti-P-AKT (Wuhan Abbkine, product number A14687), anti-mTOR (Chengdu Zenith, product number 380411), anti-p-mTOR (Chengdu Zenith, product number 381557), anti-PPAR-γ (Chengdu Zenith, product number 340844), anti-RXRA (Chengdu Zenith, product number R383177), anti-PIM1 (Chengdu Zenith, product number R381112), anti-Flag (Wuhan Abbkine, product number AE005), and other antibodies were the same as those in Example 2.

[0219] (2) Test method

[0220] (2-1) Construction, sequencing and analysis of miRNA transcriptome, specifically including the following steps:

[0221] 1) Library construction

[0222] The qualified RNA samples were used to construct libraries with the Small RNA Sample Pre Kit. First, taking advantage of the unique 3'-end and 5'-end structures of Small RNAs, starting with total RNA samples, adapters were added to both ends of the Small RNAs, and cDNA was generated by reverse transcription. Subsequently, PCR amplification was performed, and the target DNA fragments were separated by PAGE gel electrophoresis. After cutting and recovering the gel, the cDNA library could be obtained.

[0223] 2) Sequencing

[0224] After the library construction was completed, first, Qubit 2.0 was used for preliminary quantification, and then the insert fragment size of the library was detected by high-sensitivity Agilent 2100. When the fragment size met the expectation, qPCR was used to accurately determine the effective concentration of the library to ensure that the library quality met the requirements of subsequent experiments. After the library was detected to be qualified, adapter primers, DNA polymerase, and four dNTPs with base-specific fluorescent labels were added to the reaction system. When dNTPs were added to the newly synthesized DNA strand, the buffer required to excite fluorescence was added, and the fluorescence signal was excited by laser. Subsequently, the fluorescence signal was recorded and analyzed by computer, and the collected optical signal was converted into sequencing bases, thus completing the Illumina SE50 sequencing process.

[0225] 3) Analysis

[0226] The raw data (Raw Data or Raw Reads) obtained by Illumina Novoseq sequencing are first quality controlled to remove reads with adapters and low-quality reads to obtain high-quality clean reads. Subsequently, the clean reads of each sample are length-screened, and sRNAs within a certain length range are selected for subsequent analysis. Bowtie is used to map the length-screened sRNA sequences to the reference genome to analyze the distribution characteristics of sRNAs on the reference sequence. Subsequently, the successfully located reads are compared with the sequences in the specified range in the miRBase database to obtain detailed information on the matching sRNAs in each sample, including the secondary structure of the matched known miRNAs, the sequence, length, and frequency of occurrence of miRNAs in each sample.

[0227] Next, the expression of known and newly discovered miRNAs in each sample was statistically analyzed and normalized by TPM. Differential expression analysis was performed using DESeq2 based on negative binomial distribution to determine the differentially expressed miRNAs between the two groups. On this basis, according to the correspondence between miRNAs and their target genes, the target gene sets of each group of differentially expressed miRNAs were enriched by GO and KEGG pathways to explore their potential biological functions and involved signaling pathways.

[0228] (2-2) Prediction of miRNA-target relationships

[0229] RNAhybrid online prediction software (https: / / bibiserv.cebitec.uni-bielefeld.de / rnahybrid / ) was used to analyze the target relationship and binding sites between circRNA and miRNAs. TargetScan (http: / / www.targetscan.org / vert_71 / ) and miRDB (http: / / mirdb.org / ) were used to predict the interaction relationship between miRNAs and mRNAs.

[0230] (2-3) Construction of dual luciferase reporter plasmid

[0231] According to the miRNA binding sites predicted by RNAhybrid, site-directed mutagenesis was performed on them. The mutant sites and the sequences of 150 bp before and after each mutant site were selected, and the mutant fragment was cloned into the multiple cloning site of the pmirGLO vector using T4 DNA ligase to construct a circACACA vector containing the mutant sequence, namely circACACA-MT. In addition, a sequence fragment containing the binding site and 150 bp before and after it was selected and inserted into the pmirGLO vector to construct a wild-type dual-luciferase reporter vector of circACACA, namely circACACA-WT. Similarly, according to the binding sites of miRNAs and target mRNAs, wild-type (CBFB-WT) and mutant (CBFB-MT) dual-luciferase reporter vectors were constructed using the pmirGLO vector.

[0232] (2 - 4) Cultivation, passage and transfection of DF-1 cells

[0233] The DF-1 cell line was cultured in F12 medium containing 10% FBS and 1% penicillin-streptomycin and continuously cultured in an incubator at 37 °C under humid conditions. Fresh medium was changed every 24 h during this period. When the cell confluence reached about 90%, cell passage was started. First, 0.25% trypsin was added to digest adherent cells. After the cells were completely detached, an equal volume of F12 medium was added to terminate trypsin digestion. Then, the cells were collected by centrifugation at 2000 rpm for 5 min, resuspended and seeded into 48-well plates. When the cells grew to 70% - 80% confluence, circACACA-WT + miRNA mimics, circACACA-WT + mimics NC, circACACA-MT + miRNA mimics and circACACA-MT + mimics NC were transfected into DF- cells respectively. The transfection steps were similar to those of primary chicken liver cells. For detailed operations, see Example 2 "(2 - 2) Isolation, culture and transfection of primary chicken liver cells".

[0234] (2 - 5) Dual-luciferase reporter assay

[0235] After 72 hours of transfection, the cells were collected and 100 μl of reporter gene cell lysis buffer was added to lyse the cells thoroughly. Subsequently, the supernatant was transferred to a 96-well enzyme-linked immunosorbent assay (ELISA) plate. According to the instructions of the dual-luciferase reporter gene assay kit, 100 μl of firefly luciferase assay reagent was added, and the detection interval was set to 2 seconds and the measurement time was 10 seconds to measure the relative light units (RLU) of luciferase. Then, according to the amount required for each sample, the Renilla luciferase assay buffer and Renilla luciferase assay substrate (100X) were diluted at a ratio of 1:100 to prepare the detection working solution. 100 μl of the Renilla luciferase assay working solution was added to each sample, and after mixing, its RLU value was measured. By dividing the RLU value of firefly luciferase by the RLU value of Renilla luciferase, using Renilla luciferase as an internal reference, the ratio was calculated. Finally, by comparing the ratios of different samples, the relative activity levels of the target reporter gene in each sample were evaluated.

[0236] (2 - 6) qPCR

[0237] For the detailed operation steps of qPCR and the information of partial primer sequences, see "(2 - 4) Fluorescence Quantitative PCR (qPCR)" in Example 2. The information of the new primers required in this section is as follows:

[0238] Table 7 qPCR Primer Sequences

[0239]

[0240] (2 - 7) FISH

[0241] For the detailed operation steps of the FISH assay and the fluorescence probe sequence of circACACA, see "(2 - 6) Fluorescence In situ Hybridization (Fluorescence In situ Hybridization, FISH)" in Example 2. The information of the fluorescence probe sequences of miR - 132b - 5p and miR - 101 - 2 - 5p required in this section is shown in Table 8 below:

[0242] Table 8 FISH Probe Sequences of miRNAs

[0243]

[0244] (2 - 8) Other assay methods involved in this example, such as the isolation, culture and transfection of primary chicken liver cells, RNA extraction and synthesis, Western blot, BODIPY 495 / 503 staining, flow cytometry, Elisa assay, LC3 adenovirus transfection, transmission electron microscopy, TG and TC kit detection and data analysis, etc., are all referred to in "(2) Assay Methods" in Example 2.

[0245] (3) Results and Analysis

[0246] (3-1) miRNA Sequencing and Analysis of Chicken FL and CL

[0247] (3-1-1) Quality Assessment of miRNA Sequencing Data

[0248] Based on the experimental results of Example 1, we selected 3 FL samples and 3 CL tissue samples for miRNA transcriptome sequencing experiments. The original miRNA sequencing data of the 6 samples have been deposited in the SRA database with the accession number PRJNA957563. Subsequently, we performed a quality assessment on the original sequencing output data of the 6 samples. As shown in Table 9, a total of 9,974,115 to 14,853,155 original reads were obtained from the 6 samples. After removing adapter-containing and low-quality reads, 9824635 to 14606056 clean reads were obtained for subsequent data analysis. The error rate of all 6 samples was 0.01%, and its distribution is as Figure 17 . The Q20 of all samples was higher than 98.82%, and the Q30 was higher than 96.40%. The GC content of each sample was between 48.93% and 49.79%. The above results indicate that the miRNA sequencing data of chicken FL and CL are of good quality and can be used for subsequent analysis and experiments.

[0249] Table 9 Quality Assessment of miRNA Sequencing Data in Chicken FL and CL

[0250]

[0251] (3-1-2) Data Analysis of miRNA Sequencing

[0252] Further, in this experiment, circos plots were used to perform density statistics on the reads mapped to each chromosome of the genome in the 6 samples. The results showed that miRNAs were randomly distributed on each chicken chromosome ( Figure 18 ). Subsequently, this experiment performed a statistical analysis on the sequence lengths of miRNAs and found that the lengths of most miRNAs were concentrated between 21 and 23 nucleotides ( Figure 19 A). The distribution states of the expression patterns and expression levels of miRNAs in the 6 samples are as Figure 19 B, C shown. And the number of miRNAs with different TPM interval distributions was counted, and it was found that the most miRNAs were in the range of 0 to 0.1 TPM, followed by miRNAs in the range of 0.3 to 3.75 TPM ( Figure 19 D).

[0253] (3-1-3) Differential Expression Analysis of miRNAs in Chicken FL and CL

[0254] A total of 644 miRNAs were detected in two groups of liver samples, among which 479 miRNAs were co-expressed in both groups of samples ( Figure 20 as shown in A). To study the differential expression of miRNAs, the DESeq2 method based on negative binomial distribution was used in this experiment to analyze the differential expression of miRNAs in the two groups of samples. The analysis results showed that among these 479 co-expressed miRNAs, 19 miRNAs showed significant differential expression between FL and CL samples, among which 13 miRNAs were up-regulated and 6 miRNAs were down-regulated ( Figure 20 as shown in B). The detailed information of the differentially expressed miRNAs has been listed in the attachment. In addition, we performed hierarchical clustering visualization analysis on the 19 differentially expressed miRNAs ( Figure 20 as shown in C). The clustering results intuitively demonstrated the significant differences between the two groups of samples, not only verifying the accuracy of sample classification, but also further supporting the reliability of sequencing data and the availability of analysis results, laying a solid foundation for subsequent research.

[0255] (3-2) Prediction and identification of circACACA target miRNAs

[0256] Furthermore, we explored the potential target miRNAs of circACACA. First, we used the online prediction software RNAhybrid to predict the target miRNAs of circACACA and performed Venn analysis in combination with the circRNA sequencing results. Finally, 9 miRNAs were screened out, namely miR-132b-5p, miR-1653, miR-301b-5p, miR-6596-3p, miR-130b-5p, miR-3531-3p, miR-1771, miR-1626-5p and miR-101-2-5p ( Figure 21 as shown in A). Subsequently, we used qPCR to preliminarily verify the expression relationship between the 9 screened miRNAs and circACACA. The results showed that among these miRNAs, only miR-132b-5p and miR-101-2-5p showed significantly opposite expression levels to circACACA ( Figure 21 as shown in B-D; P<0.01). Then, combined with miRNA sequencing data for joint analysis, the results found that miR-132b-5p and miR-101-2-5p were significantly highly expressed in CL, further confirming the opposite expression patterns of these two miRNAs and circACACA ( Figure 21 as shown in E; P<0.05). The FISH experiment also detected the co-localization phenomenon of circACACA and these two miRNAs in cells (Figure 21 In F, G), these results provide a basis for the interaction between them. Further, based on the binding sites of circACACA with miR-132b-5p and miR-101-2-5p predicted by the RNAhybrid software ( Figure 22 In A, B), we constructed wild-type (circACACA-WT) and mutant (circACACA-MT) dual-luciferase reporter vectors containing the binding sites of miR-132b-5p and miR-101-2-5p, respectively ( Figure 22 In C, D). Subsequently, these reporter vectors were co-transfected with miR-132b-5p mimic and miR-101-2-5p mimic into DF-1 cells for dual-luciferase reporter assays. The results showed that both miR-132b-5p and miR-101-2-5p could significantly reduce the fluorescence activity of circACACA-WT, but had no obvious effect on the fluorescence activity of circACACA-MT ( Figure 22 In E, F; P < 0.05). The above results suggest that circACACA can act as a molecular sponge for miR-132b-5p and miR-101-2-5p.

[0257] (3-3) Effects of miR-132b-5p on chicken liver lipid metabolism, antioxidant stress, and autophagy

[0258] (3-3-1) Effects of miR-132b-5p on liver lipid metabolism

[0259] To study the effects of miR-132b-5p on chicken liver health, in this experiment, its inhibitor and agonist were synthesized according to the sequence of miR-132b-5p, as shown in Table 10, and these reagents were transfected into primary chicken liver cells cultured in vitro. By qPCR detection, we found that miR-132b-5p inhibitor could significantly reduce its expression level ( Figure 23 In A; P < 0.01), while miR-132b-5p mimic significantly increased its expression level ( Figure 23 In B; P < 0.01).

[0260] Table 10 Sequences of inhibitors and agonists of miR-132b-5p and miR-101-2-5p

[0261]

[0262] Furthermore, qPCR results showed that interfering with miR-132b-5p significantly increased the gene expression of ACACA, SCD1, FASN, and SREBP ( Figure 26 in C; P < 0.01), but inhibited the mRNA levels of genes related to lipid transport and fatty acid β-oxidation ( Figure 23 in D, E; P < 0.05). Conversely, overexpressing miR-132b-5p significantly decreased the mRNA levels of genes related to lipid synthesis ( Figure 23 in F; P < 0.01), and promoted the expression of genes related to lipid transport and lipolysis ( Figure 23 in G, H; P < 0.01). Western blot results showed that after transfection with miR-132b-5p inhibitor, the protein content of ACOX1 was significantly downregulated, but the protein expression of FASN had an upward trend ( Figure 24 in A, B; P < 0.05). After overexpressing miR-132b-5p, the protein expressions of ACOX1 and FASN showed opposite trends ( Figure 24 in C, D; P < 0.01). In addition, we found that the intracellular contents of TG and TC were also negatively correlated with the expression level of miR-132b-5p ( Figure 24 in E, F; P < 0.01). BODIPY staining results further revealed that after reducing the expression of miR-132b-5p, the green fluorescence staining area in liver cells increased significantly ( Figure 25 in A, B; P < 0.01), but with the increase in the expression level of miR-132b-5p, the accumulation of lipid droplets in cells also decreased significantly ( Figure 25 in A, C; P < 0.01). In summary, miR-132b-5p can alleviate the accumulation of fat in liver cells and is beneficial to the maintenance of lipid metabolism.

[0263] (3-3-2) Effects of miR-132b-5p on liver antioxidant stress

[0264] Subsequently, we explored the effects of miR-132b-5p on antioxidant stress in liver cells. Interfering with miR-132b-5p significantly inhibited the mRNA levels of SOD, GST, and TRX ( Figure 26 in A; P < 0.05). After inhibiting miR-132b-5p, the changes in the protein expression levels of GPX7 and SOD were consistent with their mRNA expressions ( Figure 26 in B; P < 0.05). Conversely, overexpressing miR-132b-5p significantly promoted the mRNA and protein expressions of genes related to antioxidant stress ( Figure 26In C and D; P < 0.05). Flow cytometry analysis showed that transfection with miR-132b-5p inhibitor significantly increased the accumulation of intracellular ROS, while overexpression of miR-132b-5p inhibited the production of ROS ( Figure 27 In A and B; P < 0.05). In addition, the production of intracellular MAD was negatively correlated with miR-132b-5p ( Figure 27 In C; P < 0.01), but the activities of antioxidant stress-related enzymes such as SOD, GSH, and T-AOC were significantly increased with the increase of miR-132b-5p ( Figure 27 In D-F; P < 0.05). In summary, miR-132b-5p can enhance the antioxidant stress ability of chicken liver cells.

[0265] (3-3-3) Effects of miR-132b-5p on autophagy in liver cells

[0266] Next, we investigated the effects of miR-132b-5p on autophagy in chicken liver cells. Inhibition of miR-132b-5p significantly upregulated the mRNA levels of autophagy-related genes (Beclin1, ATG5, ATG7, and ATG9) ( Figure 28 In A; P < 0.01). Meanwhile, the protein expressions of LC3 and Beclin1 were also significantly increased, while the expression of P62 showed the opposite trend ( Figure 28 In B; P < 0.05). Conversely, overexpression of miR-132b-5p significantly inhibited the mRNA levels of autophagy-related genes ( Figure 28 In C; P < 0.05), and the protein contents of LC3 and Beclin1 were also significantly decreased, while the expression of P62 was increased ( Figure 28 In D; P < 0.05). In addition, the Mcherry-EGFP-LC3 adenovirus transfection assay showed that the fluorescence staining area in cells transfected with miR-132b-5p mimic was significantly lower than that in the control group ( Figure 29 In A). Transmission electron microscopy further confirmed that inhibition of miR-132b-5p could significantly increase the number of autophagosomes in cells. ( Figure 29 In B). In summary, miR-132b-5p can weaken the autophagy level of cells.

[0267] (3-4) Effects of miR-101-2-5p on lipid metabolism, antioxidant stress, and autophagy in chicken liver

[0268] (3-4-1) Effects of miR-101-2-5p on lipid metabolism in the liver

[0269] To explore the potential effects of miR-101-2-5p on the health of primary chicken hepatocytes, we constructed its inhibitor and mimic and performed in vitro transfection experiments as shown in Table 10. The qPCR results showed that the expression level of miR-101-2-5p was successfully altered ( Figure 30 in A, B; P < 0.01). Subsequently, we found that downregulating miR-101-2-5p significantly promoted the mRNA levels of genes related to lipid synthesis ( Figure 30 in C; P < 0.05), while the expression of genes related to lipid transport and fatty acid β-oxidation was significantly inhibited ( Figure 30 in D, E; P < 0.05). Conversely, overexpressing miR-101-2-5p attenuated the expression of lipid synthesis genes ( Figure 30 in F; P < 0.01) and upregulated the mRNA levels of genes related to lipid transport and fatty acid β-oxidation ( Figure 30 in G, H; P < 0.05). Western blot analysis further verified the results at the protein level, that is, interfering with miR-101-2-5p decreased the expression of ACOX1 and increased the expression of FASN simultaneously ( Figure 31 in A, B; P < 0.01); while overexpressing miR-101-2-5p promoted the expression of ACOX1 and inhibited the protein level of FASN ( Figure 31 in C, D; P < 0.01). In addition, we also detected the intracellular accumulation levels of TG and TC by kits, and the results showed that downregulating miR-101-2-5p significantly increased the intracellular content of TG and TC, and overexpression had the opposite effect ( Figure 31 in E, F; P < 0.01). BODIPY 493 / 503 staining also revealed a large area of fluorescence staining in the miR-101-2-5p inhibitor transfection group ( Figure 32 in A, B; P < 0.01), but relatively less fluorescence staining in the miR-101-2-5p mimic transfection group ( Figure 32 in A, C; P < 0.01). In summary, miR-101-2-5p is beneficial to maintaining the balance of lipid metabolism in liver cells.

[0270] (3-4-2) Effects of miR-101-2-5p on liver antioxidant stress

[0271] Subsequently, this experiment evaluated the effects of miR-101-2-5p on antioxidant stress in liver cells. The qPCR results showed that interfering with miR-101-2-5p significantly inhibited the mRNA expression of genes related to antioxidant stress ( Figure 33A; P < 0.01). The Western blot results further confirmed the inhibitory effect of downregulating miR-101-2-5p on the protein expression of GPX7 and SOD ( Figure 33 B; P < 0.05). Overexpressing miR-101-2-5p had the opposite effects on the mRNA and protein levels of antioxidant stress-related genes ( Figure 33 C, D; P < 0.05). The results of flow cytometry showed that miR-101-2-5p inhibited the production of ROS in liver cells ( Figure 34 A, B; P < 0.05). As the expression level of miR-101-2-5p increased, the content of MAD in cells gradually decreased ( Figure 34 C; P < 0.05), while the accumulation of SOD, GSH, and T-AOC was positively correlated with the expression of miR-101-2-5p ( Figure 34 D-F; P < 0.05). In summary, miR-101-2-5p can effectively alleviate the antioxidant stress response in liver cells.

[0272] (3-4-3) Effects of miR-101-2-5p on autophagy in liver cells

[0273] Finally, we also explored the effects of miR-101-2-5p on autophagy in liver cells. The results showed that interfering with miR-101-2-5p significantly increased the mRNA expression levels of autophagy-related genes Beclin1, ATG5, ATG7, and ATG9, and at the same time significantly inhibited the expression of P62 ( Figure 35 A; P < 0.05). In addition, the Western blot results of autophagy-related proteins after interfering with miR-101-2-5p were similar to its qPCR results ( Figure 35 B; P < 0.05). Conversely, overexpressing miR-101-2-5p decreased the mRNA levels of Beclin1, ATG5, ATG7, and ATG9, while increasing the expression of P62 ( Figure 35 C; P < 0.05). The Western blot results also showed that upregulating the expression of miR-101-2-5p could increase the protein content of P62, but could downregulate the protein expression of LC3 and Beclin1 ( Figure 35 D; P < 0.05). The results of the Mcherry-EGFP-LC3 adenovirus infection experiment showed that the staining area of autophagosomes in liver cells was significantly lower than that of the control group after upregulating miR-101-2-5p ( Figure 36 A). The electron microscopy results also revealed that cells transfected with miR-101-2-5p inhibitor contained more autophagosomes and autolysosomes ( Figure 36In B). In summary, miR-101-2-5p can inhibit the occurrence of autophagy.

[0274] (3-5) Prediction and identification of target genes of miR-132b-5p and miR-101-2-5p

[0275] To further explore the molecular mechanisms of miR-132b-5p and miR-101-2-5p, we used miRDB and Targetscan online prediction software, and combined with miRNA sequencing data to predict the downstream target genes of these two miRNAs. The results of Venn analysis showed that CBFB was the only common target gene of miR-132b-5p and miR-101-2-5p ( Figure 37 In A). The predicted target binding sites of miR-132b-5p and miR-101-2-5p with CBFB by RNAhybrid are as Figure 37 shown in B. Further, their expression levels were verified by qPCR. The results showed that down-regulation of miR-132b-5p and miR-101-2-5p both promoted the mRNA expression of CBFB, while up-regulation of miR-132b-5p and miR-101-2-5p inhibited the mRNA expression of CBFB ( Figure 37 In C, D; P<0.05). Subsequently, we constructed wild-type and mutant dual-luciferase reporter vectors of CBFB for dual-luciferase reporter assay ( Figure 37 In E, F). The results showed that the addition of miR-132b-5p and miR-101-2-5p mimics significantly reduced the fluorescence activity of the CBFB wild-type vector ( Figure 37 In G, H; P<0.01). In summary, CBFB is the common downstream target gene of miR-132b-5p and miR-101-2-5p.

[0276] (3-6) Effects of CBFB on chicken liver lipid metabolism, antioxidant stress and autophagy

[0277] (3-6-1) Effects of CBFB on liver lipid metabolism

[0278] To explore the potential role of CBFB in liver health and development, we designed and synthesized three siRNAs against CBFB and its overexpression vector. The results showed that s3-CBFB (named si-CBFB) significantly inhibited the expression of CBFB in vitro in liver cells ( Figure 38 In A; P<0.01), while the overexpression vector (named ov-CBFB) significantly increased the expression level of CBFB ( Figure 38B; P < 0.01). Further qPCR results showed that interfering with CBFB would reduce the mRNA levels of genes related to lipid synthesis ( Figure 38 C; P < 0.01), but the expression of genes related to lipid transport and fatty acid β-oxidation was increased ( Figure 38 D, E; P < 0.01). Conversely, overexpression of CBFB promoted the expression of genes related to lipid synthesis ( Figure 38 F; P < 0.05), while inhibiting the mRNA levels of genes related to lipid transport and breakdown ( Figure 38 G, H; P < 0.05). Western blot further confirmed that downregulating CBFB was beneficial to the expression of ACOX1 protein, but could inhibit the protein level of FASN ( Figure 39 A; P < 0.05). Overexpression of CBFB, however, promoted the expression of FASN, but was not conducive to the expression of ACOX1 ( Figure 39 B; P < 0.05). In addition, the intracellular accumulation levels of TG and TC also changed accordingly with the change of CBFB ( Figure 39 C, D; P < 0.05). Finally, through BODIPY 493 / 503 staining assay, it was found that in the si-CBFB transfection group, the intracellular lipid droplet accumulation was significantly less than that in the control group ( Figure 40 A, B; P < 0.05), while a large fluorescence staining area was observed in the ov-CBFB transfection group ( Figure 40 A, C; P < 0.05). In summary, similar to circACACA, CBFB can disrupt the lipid metabolism balance in the liver.

[0279] Table 11 siRNA sequences and overexpression vector sequences of CBFB

[0280]

[0281] ov-CBFB was obtained by cloning the sequence of CBFB into the PCDNA3.1 vector. The sequence is (SEQ ID NO.86): ATGCCGCGGGTCGTCCCCGACCAGCGCAGCAAGTTCGAGAACGAGGAGTTCTTCAGGAAGCTGAGCCGCGAGTGCGAGATCAAGTACACCGGCTTCAGGGACCGGCCCCACGAGGAGAGGCAGGCCCGCTTCCAGAACGCCTGCCGCGACGGCCGCTCCGAGATCGCTTTTGTGGCCACGGGAACCAATCTGTCTCTCCAGTTTTTTCCGGCCAGCTGGCAGGGGGAGCAGCGGCAGACACCAACCCGGGAGTATGTCGACTTTGAGAGAGAAGGAGGCAAGGTGTACTTGAAGGCACCTATGATTCTTAATGGTGTCTGTGTAATCTGGAAAGGCTGGATAGATCTACAGAGACTGGATGGTATGGGCTGCCTGGAATTTGATGAAGAGAGAGCACAGCAGGAGGATGCATTGGCACAACAAGCCTTTGAAGAAGCTCGAAGAAGAACCCGTGAATTCGAAGACAGAGACAGGTCTCATCGGGAGGAAATGGAGGCAAGAAGACAACAAGACCCTAGTCCTGGATCCAACCTAGGAAGTGGTGATGATCTCAAACTACGTTAA

[0282] (3 - 6 - 2) Effects of CBFB on liver antioxidant stress

[0283] In addition, this experiment also explored the effects of CBFB on antioxidant stress in liver cells. The qPCR results showed that interfering with CBFB significantly increased the mRNA expression levels of antioxidant stress-related genes SOD, GPX7, and GST ( Figure 41 in A; P < 0.01), while upregulating CBFB inhibited the expression of these genes ( Figure 41 in B; P < 0.05). The Western blot results also revealed that the protein expression levels of antioxidant stress-related genes increased significantly with the downregulation of CBFB, while decreased significantly with the upregulation of CBFB ( Figure 41 in C, D; P < 0.05). The results of ROS flow cytometry showed that after interfering with CBFB, the ROS content in liver cells was significantly lower than that in the control group, while overexpressing CBFB significantly promoted the production of intracellular ROS ( Figure 41Among them, E, F; P < 0.01). In summary, CBFB can weaken the antioxidant stress ability of cells and cause oxidative damage to cells.

[0284] (3-6-3) Effects of CBFB on autophagy in liver cells

[0285] To investigate the effect of CBFB on autophagy in liver cells, we analyzed the expression levels of autophagy-related genes at two levels: mRNA and protein. qPCR data revealed that interfering with CBFB significantly promoted the mRNA level of P62, but downregulated the expression of Beclin1, AUG5, and AUG7 ( Figure 42 Among them, A; P < 0.01). On the contrary, overexpressing CBFB promoted the expression of Beclin1, ATG7, and ATG9, but decreased the mRNA level of P62 ( Figure 42 Among them, B; P < 0.05). Western blot results showed that downregulation of CBFB inhibited the protein expression of LC3 and Beclin1, and simultaneously promoted the protein expression of P62 ( Figure 42 Among them, C; P < 0.05); on the contrary, upregulation of CBFB enhanced the accumulation of autophagy-related proteins LC3 and Beclin1, but decreased the expression of P62 ( Figure 42 Among them, D; P < 0.05). The results of the Mcherry-EGFP-LC3 adenovirus labeling assay further suggested that reducing the expression of CBFB significantly reduced the number of autophagosomes in cells ( Figure 43 Among them, A). Transmission electron microscopy results confirmed again the promoting effect of CBFB on autophagy in liver cells ( Figure 43 Among them, B). The above results suggest that CBFB can induce the occurrence of autophagy in liver cells.

[0286] (3-7) circACACA regulates AKT / mTOR and PPAR-γ signaling pathways through the ceRNA mechanism to affect liver health

[0287] (3-7-1) CBFB regulates AKT / mTOR and PPAR-γ signaling pathways by binding to PIM1

[0288] Furthermore, we conducted an in-depth study on the mechanism of action of CBFB in liver cells. Western blot results showed that interfering with CBFB did not have a significant effect on the protein expression of AKT and mTOR, but significantly increased the protein levels of p-AKT and p-mTOR. In addition, downregulation of CBFB significantly promoted the expression of key proteins PPAR-γ and RXRA in the PPAR-γ signaling pathway ( Figure 44In A and B, P < 0.05). Similarly, overexpression of CBFB had no significant effect on the protein expression of AKT and mTOR, but significantly inhibited the phosphorylation levels of AKT and mTOR, and simultaneously decreased the expression of PPAR-γ and RXRA ( Figure 44 In C and D, P < 0.05). The above results suggest that CBFB can inhibit the activities of the AKT / mTOR signaling pathway and the PPAR-γ signaling pathway.

[0289] Previous studies have shown that CBFB can participate in and regulate multiple signaling pathways by binding to PIM1, thereby exerting its biological functions. However, the specific mechanism of the binding relationship between CBFB and PIM1 in chicken liver has not been verified. Therefore, this experiment was carried out to verify the interaction between CBFB and PIM1 in chicken liver, so as to further understand its potential regulatory role in avian fat metabolism and related signaling pathways. The qPCR results showed that interfering with CBFB significantly upregulated the mRNA expression of PIM1, while overexpressing CBFB had the opposite effect, inhibiting the gene expression level of PIM1 ( Figure 45 In A, P < 0.05). The Western blot results were consistent with the qPCR results. When CBFB was downregulated, the protein level of PIM1 increased significantly, while when CBFB was overexpressed, the protein level of PIM1 decreased ( Figure 45 In B and C, P < 0.05). Finally, the immunoprecipitation assay results found that the expression of Flag and PIM1 proteins was detected in both the IP-Flag group and the Input group, indicating an interaction between CBFB and PIM1 ( Figure 45 In D). The above results indicate that there is an interaction between CBFB and PIM1, and CBFB has a negative regulatory effect on PIM1.

[0290] Next, this experiment explored the potential effects of PIM1 on the AKT / mTOR signaling pathway and the PPAR-γ signaling pathway. The results showed that the effects of PIM1 on the two signaling pathways were opposite to those of CBFB. Downregulating the expression of PIM1 significantly inhibited the phosphorylation levels of AKT and mTOR. In addition, interfering with the expression of PIM1 also led to a decrease in the protein levels of PPAR-γ and RXRA ( Figure 46 In A and B, P < 0.05). Further, we performed co-transfection experiments of si-CBFB+si-NC, si-CBFB+si-PIM1, and si-NC+si-NC. The results showed that downregulating PIM1 could reverse the inhibitory effects of si-CBFB on fat accumulation, antioxidant stress, and autophagy ( Figure 47Among A, B; P < 0.05). In addition, inhibition of PIM1 also weakened the promoting effects of si-CBFB on the AKT / mTOR signaling pathway and the PPAR-γ signaling pathway ( Figure 47 Among A, C; P < 0.05). In summary, we conclude that CBFB regulates the AKT / mTOR and PPAR-γ signaling pathways through its interaction with PIM1, thereby participating in liver lipid metabolism and development.

[0291] (3-7-2) circACACA regulates the inactivation of the CBFB / PIM1 complex and the AKT / mTOR and PPAR-γ signaling pathways by acting as a molecular sponge for miR-132b-5p and miR-101-2-5p

[0292] To further demonstrate that circACACA participates in the AKT / mTOR and PPAR-γ signaling pathways and exerts regulatory functions through the ceRNA mechanism, we conducted co-transfection experiments of circACACA with miR-132b-5p and miR-101-2-5p. Western blot results showed that adding circACACA in liver cells could relieve the inhibition of miR-132b-5p on the lipogenic protein FASN, and at the same time reduce the promoting effect of miR-132b-5p on the lipolytic protein ACOX1. In addition, the addition of circACACA could also reverse the inhibitory effect of miR-132b-5p mimics on antioxidant stress and autophagy ( Figure 48 Among A, B; P < 0.05). Meanwhile, overexpressing circACACA in cells significantly weakened the promoting effect of miR-132b-5p mimics on PIM1, and the expression of key proteins in the AKT / mTOR and PPAR-γ signaling pathways also decreased accordingly ( Figure 48 Among A, C; P < 0.05). Co-transfecting ov-circACACA and miR-101-2-5p in cells had similar effects on lipid metabolism, antioxidant stress, autophagy-related proteins, and key proteins in the AKT / mTOR and PPAR-γ signaling pathways ( Figure 49 Among A-C; P < 0.05). Finally, we also explored the effects of co-transfection of circACACA and CBFB on chicken liver health and related signaling pathways. Western blot results revealed that interfering with CBFB relieved the promoting effects of circACACA on lipid accumulation, oxidative stress, and autophagy in the liver ( Figure 50 Among A, B; P < 0.05). Meanwhile, inhibiting the expression of CBFB could also activate the activities of the AKT / mTOR and PPAR-γ signaling pathways ( Figure 50Among A and C; P < 0.05). In summary, circACACA regulates the inactivation of the CBFB / PIM1 complex, AKT / mTOR, and PPAR-γ signaling pathways by acting as a molecular sponge for miR-132b-5p and miR-101-2-5p, thereby participating in hepatic lipid metabolism, antioxidant stress, and autophagy.

[0293] Therefore, circACACA exerts its biological function as a molecular sponge for miR-132b-5p and miR-101-2-5p. miR-132b-5p and miR-101-2-5p can promote the balance of lipid metabolism in the liver, enhance the antioxidant stress capacity of liver cells, and simultaneously weaken the activity of autophagy. CBFB is a downstream gene that is a common target of miR-132b-5p and miR-101-2-5p. Similar to circACACA, CBFB can promote the accumulation of lipid droplets in liver cells, weaken the antioxidant stress capacity of cells, and induce autophagy. circACACA mediates the CBFB / PIM1 complex through the ceRNA mechanism, thereby regulating the AKT / mTOR and PPAR-γ signaling pathways and participating in the regulation of lipid metabolism and the maintenance of health in poultry livers.

[0294] In summary, the present invention deeply explores the potential role of circACACA in liver lipid metabolism diseases and comprehensively constructs the molecular regulatory network of circACACA. This study not only provides a new theoretical basis for the health management and molecular breeding of poultry but also offers new strategies for the prevention and treatment of human non-alcoholic fatty liver disease (NAFLD).

[0295] Although the embodiments of the present invention have been shown and described, it will be understood by those of ordinary skill in the art that various changes, modifications, substitutions, and variations can be made therein without departing from the principles and spirit of the invention, and the scope of the invention is defined by the appended claims and their equivalents. The above-described embodiments merely represent several embodiments of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention. It should be noted that for those of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the appended claims.

Claims

1. Use of an agent for enhancing or promoting the expression of miR-132b-5p or an agent for reducing the adsorption of miR-132b-5p in the preparation of a product for preventing chicken fatty liver syndrome, wherein the agent has a sequence as shown in SEQ ID NO.

76.

2. A method for promoting lipid metabolism balance in the liver of chickens and / or enhancing the ability of liver cells to resist oxidative stress and / or reducing liver cell autophagy for non-therapeutic or non-diagnostic purposes, characterized in that: include: The sequence shown in SEQ ID NO. 76 was transfected into primary chicken liver cells.

Images