MED1 overexpression mesenchymal stem cell as well as preparation method and application thereof

Abstract

The invention relates to mesenchymal stem cells for overexpressing MED1 as well as a preparation method and application of the mesenchymal stem cells, and belongs to the technical field of stem cell treatment. The mesenchymal stem cell for overexpressing the MED1 disclosed by the invention comprises a nucleotide sequence as shown in SEQ ID NO: 2 and a dCas9-target plasmid. The MED1 gene modified MSCs are constructed for the first time, and the osteogenic differentiation function of the MED1 gene modified MSCs is improved, so that the clinical treatment effect of the MED1 gene modified MSCs in bone defects is promoted.

Description

Technical Field

[0001] The present invention relates to the technical field of stem cell therapy, and in particular to a mesenchymal stem cell overexpressing MED1 and a preparation method and application thereof. Background Art

[0002] Super enhancers (SEs) are composed of high-density clusters of traditional enhancers (TEs), which work synergistically to recruit high-density transcription factors (TFs) and cofactors to achieve efficient transcription. Their main characteristics are that they have a larger regional span than ordinary enhancers and a higher density of transcription activation-related histone modifications (such as H3K27Ac and H3K4me1).

[0003] Mesenchymal stem cells (MSCs) are multipotent stem cells with the potential for multidirectional differentiation such as osteogenic, adipogenic, and chondrogenic, maintaining tissue homeostasis and regeneration, and strong immunoregulatory ability. They are the main source of osteoblasts in the body and play a key role in bone repair and regeneration. Bone defects caused by severe trauma, infection, tumor surgery or femoral head necrosis are often difficult to heal naturally. MSCs transplantation to promote regeneration of bone defect sites is currently regarded as a potential treatment method. There are many experimental and clinical studies that extracellular matrix cells promote bone regeneration. However, most of them only show limited therapeutic effects. In order to enhance the osteogenic potential of MSCs and promote clinical application, engineering strategies based on gene-modified MSCs have shown good application prospects. However, the traditional use of lentivirus or adeno-associated virus to genetically modify MSCs has potential biosafety risks, and other physical or chemical methods are also limited by factors such as low modification efficiency. Therefore, the application of MSCs transplantation to treat bone defects in clinical practice has been hindered. At present, due to the various limitations of bone transplantation surgery, there is an urgent need to develop effective treatments for bone defects that are difficult to heal. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a mesenchymal stem cell overexpressing MED1 capable of promoting bone repair and bone regeneration, and a preparation method and application thereof.

[0005] To achieve the above object, the technical solution adopted by the present invention is:

[0006] In a first aspect, the present invention provides a mesenchymal stem cell overexpressing MED1, comprising a nucleotide sequence as shown in SEQ ID NO: 2 and a dCas9-target plasmid.

[0007] The present invention finds that mediator complex subunit 1 (MED1) is a key transcriptional coactivator in the super enhancer (SEs) regulatory mechanism, which can bind to SEs and improve the osteogenic differentiation ability of mesenchymal stem cells (MSCs), thereby enhancing the therapeutic effect of MSCs transplantation. The present invention uses improved CRISPRa / dCas9 technology, artificially mutates the two domains of Cas9, RuvC and HNH, to make it lose the activity of nuclease endonuclease, and then designs MED1-specific gRNA to specifically guide the dCas9 fused with transcription factors VP64, p65 activation domain and Rta to the transcription start site (TSS) site of MED1, promotes the transcription of MED1 in MSCs through the activation of transcription factors, and successfully constructs MSCs that stably overexpress MED 1. It was verified by in vitro and in vivo experiments that transplanting MED1-overexpressing MSCs can treat bone defects and promote bone regeneration.

[0008] As a preferred embodiment of the first aspect, the dCas9-target plasmid is a dSp-VP64-p65-RT A plasmid.

[0009] As a preferred embodiment of the first aspect, the mesenchymal stem cells further include a nucleotide sequence as shown in SEQ ID NO:1.

[0010] As a preferred embodiment of the first aspect, the mesenchymal stem cells are selected from one or more of mesenchymal stem cells derived from bone marrow, fat, umbilical cord, induced pluripotent stem cells, and embryonic stem cells.

[0011] As a preferred embodiment of the first aspect, the mesenchymal stem cells include bone marrow-derived mesenchymal stem cells.

[0012] Since human bone marrow-derived MSCs (BMSCs) are more effective in promoting osteogenesis, while umbilical cord-derived MSCs are more capable of promoting angiogenesis. Induced pluripotent stem cell (iPS)-derived MSCs and human embryonic stem cell-derived MSCs have similar osteogenesis abilities. Further studies have found that in the comparison of endochondral ossification potential in vitro and in vivo, only BMSCs were able to form three-dimensional cartilage discs in vitro and successfully healed huge bone defects in mice. Therefore, BMSCs are considered to be the cell type with the greatest potential for osteogenesis and regeneration.

[0013] In a second aspect, the present invention provides use of the mesenchymal stem cells described in the first aspect in preparing a drug or preparation for treating or repairing bone defects.

[0014] As a preferred embodiment of the second aspect, a specific sgRNA is designed according to the TSS upstream sequence of MED1, and dCas9 fused with transcription factors VP64, p65 activation domain and Rta is specifically guided to the TSS site of MED1 through the sgRNA, and the transcription of MED1 in mesenchymal stem cells is promoted through the activation of transcription factors, so as to construct mesenchymal stem cells overexpressing MED1; the nucleotide sequence of the TSS upstream sequence of MED1 is shown in SEQ ID NO: 1.

[0015] As a preferred embodiment of the second aspect, the sequence of the specific sgRNA designed according to the TSS upstream sequence of MED1 is shown in SEQ ID NO: 2;

[0016] As a preferred embodiment of the second aspect, the dCas9 fused with the transcription factor VP64, p65 activation domain and Rta is the plasmid dSp-VP64-p65-RTA.

[0017] In a third aspect, the present invention provides a method for constructing the mesenchymal stem cells described in the first aspect, characterized in that it comprises the following steps:

[0018] S1. Design a specific sgRNA according to the TSS upstream sequence of MED1 as shown in SEQ ID NO: 1, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 2;

[0019] S2, mix dCas9-target plasmid, sgRNA and opti-MEM medium to obtain premix 1;

[0020] S3, mixing the auxiliary transfection reagent with the opti-MEM culture medium to obtain a premix 2;

[0021] S4. Premix 1 and premix 2 are mixed and added to the cell culture medium. After incubation at room temperature, the culture medium is added to the well plate for culturing mesenchymal stem cells. Puromycin is then added to the culture medium to select surviving mesenchymal stem cells, thereby constructing MSCs that overexpress MED1.

[0022] As a preferred embodiment of the third aspect, the dCas9-target plasmid in step S2 is a dSp-VP 64-p65-RTA plasmid.

[0023] In a fourth aspect, the present invention provides the use of the construction method described in the third aspect in the preparation of a drug or preparation for treating or repairing bone defects.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The inventors found that mediator complex subunit 1 (MED1) plays an important role as a transcriptional coactivator for SEs in regulating the osteogenic differentiation of MSCs; therefore, the present invention improves the osteogenic function of MSCs by regulating the expression of MED1 based on the super enhancer mechanism, which can more accurately and effectively enhance the osteogenic function of MSCs, thereby promoting the application effect of MSCs transplantation in bone defect transplantation. The present invention is the first to construct MED1 gene-modified MSCs to improve their osteogenic differentiation function, thereby promoting their clinical treatment effect in bone defects. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Experimental flow chart for the construction and effect verification of MED1 overexpressing MSCs;

[0027] Figure 2 Schematic diagram of Western blot results of MED1 overexpressing MSCs;

[0028] Figure 3 Schematic diagram of the experimental results of Alizarin red staining of MED1-overexpressing MSCs and normal MSCs;

[0029] Figure 4 Schematic diagram of the results of skull defect repair and regeneration experiments using MED1-overexpressing MSCs and common MSCs;

[0030] Figure 5 Schematic diagram of the plasmid map of plasmid dSp-VP64-p65-RTA. DETAILED DESCRIPTION

[0031] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0032] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0033] Example 1 Construction of MSCs stably overexpressing the MED1 gene

[0034] according to Figure 1 The experimental process shown here is to construct MSCs that stably overexpress MED1 and verify its application effect, as follows:

[0035] 1. Design sgRNA:

[0036] The base sequence of 250 bp upstream of TSS of MED1 gene was found through Ensembl website (https: / / www.ensembl.org / index.html?redirect=no) (GGGATCTGGAGATTTTAATTTGCGA GCTGTTTAACTGCTAAAATAAAAAAAAAATGGCGGTTTCCGCAGGGGAGCCGAAAGCTACCGGCCGGCAGGTTTAATATCCAGCGGCGCGAGGCCTGAGACAGCTCAGATCAAAGGGAAGACTGCGCTGAAAGAAATCTCGCGAGGCCGACGCATTGACCAATATTCGCGAGATTTCGATGCCCTGTCCTCTTCCTCTCTCTGGCAGGACCACGGTTTATCTCGC, SEQ ID NO:1), and designed sgRNA upstream of TSS through the sgRNA design website CRISPick (https: / / portals.broadinstitute.org / ). According to the returned results, the sgRNA sequence with the highest comprehensive score and no adverse effects (GCGAATATTGGTCAATGCGT, SEQ ID NO:2) was selected according to indicators such as the targeted target sequence score and the off-target effect score.

[0037] 2. Transfection and screening

[0038] The existing tool plasmid dSp-VP64-p65-RTA (addgene, #99670) can be used to promote the expression of specific genes through the guidance of sgRNA. The specific operations are as follows:

[0039] 1) Premix 1: Take 5 μg of dSp-VP64-p65-RTA plasmid and 25 ng of sgRNA, linearize the dSp-VP64-p65-RTA plasmid, and then connect the linearized plasmid with sgRNA to form a sgRNA-Cas9 connected plasmid; mix the sgRNA-Cas9 connected plasmid with opti-MEM (ThermoFisher, 31985070) medium to a total volume of 150 μl;

[0040] Premix 2: Mix auxiliary transfection reagent Lipofectamine 3000 (ThermalFish, L3000-015) and opti-MEM to 150 μl;

[0041] Transfection: Mix premix 1 and premix 2, incubate at room temperature for 15 minutes, aspirate the original culture medium in the well plate, add the premix to the culture medium (DMEM medium (Gibco, #11885084) supplemented with 10% fetal bovine serum (Gibco, #10099141)), and then add 1×10 5 MSCs / well in a six-well plate and cultured for 48 h;

[0042] 2) Screening: Puromycin (1 μg / ml) is added to the culture medium to screen cells through the puromycin resistance gene carried by the plasmid. The surviving MSCs are the MSCs with normal overexpression after plasmid transfer.

[0043] 3) Verification: MSCs were selected after puromycin screening, and the overexpression efficiency of MED1 was verified by Western blot (e.g. Figure 2 As shown, the control group was MSCs transfected with blank vector plasmid) and then used for subsequent experiments.

[0044] Example 2 Functional Verification

[0045] 1. Alizarin red staining experiments verified that the function of MSCs in differentiating into osteoblasts in vitro was enhanced after overexpression of MED1:

[0046] Ordinary MSCs and the stably overexpressed MSCs constructed in Example 1 were planted in 24-well cell culture plates, and osteogenic differentiation was induced using osteogenic induction solution (DMEM low-glucose medium, 10% fetal bovine serum, 100 IU / ml penicillin, 100 IU / ml streptomycin, 0.1 uM dexamethasone, 10 mM β-phosphoglycerate, 50 uM vitamin C). The osteogenic induction solution was changed every 3 days. Alizarin red staining was performed after 14 days of induction to observe the osteogenic differentiation function of different MSCs in vitro. Alizarin red staining was used to stain MSCs at room temperature for 15 minutes using 1% ARS (pH 4.2). After rinsing with PBS to remove non-specific staining, the macroscopic images of the stained wells and the staining images under the microscope were collected to evaluate the differences in calcium nodule formation.

[0047] The results are as follows Figure 3 As shown, compared with common MSCs, the in vitro osteogenic ability of the overexpressed MSCs constructed in Example 1 was significantly enhanced.

[0048] 2. Verify that MED1-overexpressing MSCs transplantation promotes skull defect repair and regeneration through skull defect model:

[0049] An 8-week-old mouse was taken and the skin was cut after anesthesia to separate the subcutaneous tissue and expose the skull. A skull bone defect was created using an electric bone drill with a 2.5 mm sterile drill bit to construct a bone defect model. 5Bone marrow mesenchymal stem cells (MSCs overexpressing MED1, ordinary MSCs) were resuspended in 1% sodium alginate saline solution and transplanted into the skull defect, and the wound was sutured. Three weeks after surgery, the mice were killed and imaged using micro-CT.

[0050] The results are as follows Figure 4 As shown, the skull defect mouse model after transplantation of MSCs overexpressing MED1 showed stronger skull defect repair.

[0051] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A mesenchymal stem cell overexpressing MED1, characterized in that: It includes the nucleotide sequence shown in SEQ ID NO: 2 and a dCas9-target plasmid.

2. The mesenchymal stem cell according to claim 1, wherein Also included is the nucleotide sequence shown in SEQ ID NO:

1.

3. The mesenchymal stem cell according to claim 1 or 2, characterized in that The mesenchymal stem cells are selected from one or more of mesenchymal stem cells derived from bone marrow, fat, umbilical cord, induced pluripotent stem cells, and embryonic stem cells.

4. Use of the mesenchymal stem cells according to any one of claims 1 to 3 in the preparation of a drug or preparation for treating or repairing bone defects or bone regeneration.

5. The use according to claim 4, characterized in that A specific sgRNA is designed according to the TSS upstream sequence of MED1, and the dCas9 fused with the transcription factors VP64, p65 activation domain and Rta is specifically guided to the TSS site of MED1 through the sgRNA, and the transcription of MED1 in mesenchymal stem cells is promoted through the activation of transcription factors, so as to construct mesenchymal stem cells overexpressing MED1; the nucleotide sequence of the TSS upstream sequence of MED1 is shown in SEQ ID NO:

1.

6. The use according to claim 5, characterized in that The sequence of the specific sgRNA designed according to the TSS upstream sequence of MED1 is shown in SEQ ID NO:

2.

7. The use according to claim 5, characterized in that The dCas9 fused with transcription factor VP64, p65 activation domain and Rta is the plasmid dSp-VP64-p65-RTA.

8. A method for constructing the mesenchymal stem cells according to any one of claims 1 to 3, characterized in that: The steps include: S1. Design a specific sgRNA according to the TSS upstream sequence of MED1 as shown in SEQ ID NO: 1, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 2; S2, mix dCas9-target plasmid, sgRNA and opti-MEM medium to obtain premix 1; S3, mixing the auxiliary transfection reagent with the opti-MEM culture medium to obtain a premix 2; S4. Premix 1 and premix 2 are mixed and added to the cell culture medium. After incubation at room temperature, the culture medium is added to the well plate for culturing mesenchymal stem cells. Puromycin is then added to the culture medium to screen for surviving mesenchymal stem cells, thereby obtaining mesenchymal stem cells that overexpress MED1.

9. The method according to claim 8, characterized in that The dCas9-target plasmid in step S2 is a dSp-VP64-p65-RTA plasmid.

10. Use of the construction method according to any one of claims 7 to 9 in the preparation of a drug or preparation for treating or repairing bone defects or bone regeneration.

Images