RNA, pharmaceutical composition, conjugate and application

Abstract

The invention relates to the technical field of retinal ischemia reperfusion injury, in particular to RNA, a pharmaceutical composition, a conjugate and application. The nucleotide sequence of the RNA is as shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. The RNA can inhibit proliferation of retinal Muller cells, increase mitochondrial membrane potential change of the retinal Muller cells, promote Muller cell apoptosis, relieve Muller cell colloid activation, protect ganglion cells from being damaged and reduce retinal ischemia-reperfusion injury inflammatory response, and can be used for preventing and treating retinal ischemia-reperfusion injury. The invention has application prospects in prevention and treatment of retinal ischemia reperfusion injury.

Description

Technical Field

[0001] The present application relates to the technical field of retinal ischemia-reperfusion injury, and in particular to RNA, pharmaceutical compositions, conjugates and applications. Background Art

[0002] Retinal ischemia-reperfusion injury (RIRI) is the main pathological process leading to permanent visual impairment and blindness, and is associated with many eye diseases, such as acute glaucoma, diabetic retinopathy, ischemic optic neuropathy, retinal vascular occlusion, and neonatal retinopathy of prematurity (ROP). "Ischemia" refers to the situation where local tissue blood supply is insufficient due to vascular occlusion and other reasons. "Reperfusion" refers to the process of restoring blood perfusion after tissue ischemia. In the retina, when ischemia occurs due to vascular occlusion and other reasons, and then the blood vessels are reopened or blood flow is restored, retinal ischemia-reperfusion injury may occur. This type of injury involves multiple pathological mechanisms such as oxidative stress, inflammatory response, and cell apoptosis. It is one of the key research contents in the field of ophthalmology, especially in the research of retinal vascular diseases, glaucoma and other diseases.

[0003] Currently, treatment strategies for RIRI focus on halting disease progression through intraocular injections (such as anti-VEGF drugs), angiostatic steroids, eye drops, or surgical intervention. However, these treatments mainly target late-stage lesions through a single action, so there is an urgent need to develop novel therapies that can limit early lesions and have multiple actions. Summary of the invention

[0004] The inventors of the present application creatively discovered an RNA that can inhibit the proliferation of retinal Müller cells, increase the changes in mitochondrial membrane potential of retinal Müller cells, promote Müller cell apoptosis, reduce Müller cell glial activation and protect ganglion cells from damage, and reduce the inflammatory response of retinal ischemia-reperfusion injury. The RNA has application prospects in the prevention and treatment of retinal ischemia-reperfusion injury.

[0005] To this end, the embodiments of the present application disclose at least the following technical solutions:

[0006] In a first aspect, the embodiments disclose an RNA, the nucleotide sequence of which is shown in SEQ ID NO: 1 (GAGUCCAGAGUGCUAACCAUUACAC) and / or SEQ ID NO: 2 (GTGTAAUGGUUAGCACUCUGGACUC).

[0007] In a second aspect, a pharmaceutical composition comprises the RNA described in the first aspect and a pharmaceutically acceptable diluent, carrier or adjuvant.

[0008] In a third aspect, the embodiments disclose a conjugate comprising the RNA of the first aspect.

[0009] In a fourth aspect, the embodiment discloses the application of the RNA described in the first aspect. The application is selected from at least one of the following:

[0010] Preparation of drugs for preventing or treating retinal ischemia-reperfusion injury;

[0011] Preparation of drugs for preventing or treating diabetic retinopathy;

[0012] Preparation of drugs related to inhibiting the proliferation of retinal Müller cells;

[0013] Preparation of drugs related to increasing changes in mitochondrial membrane potential of retinal Müller cells;

[0014] Preparation of drugs related to promoting apoptosis of retinal Müller cells;

[0015] Preparation of drugs related to reducing Müller cell glial activation;

[0016] Preparation of drugs related to protecting ocular ganglia;

[0017] Preparation of drugs for reducing inflammatory response to retinal ischemia-reperfusion injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 These are the GFAP staining images and GS staining images of mouse primary Müller cells provided in the examples.

[0019] Figure 2 The results of the inhibitory effect of RNA on the viability of mouse Müller cells provided in the CCK-8 method test example.

[0020] Figure 3 The results of the inhibitory effect of RNA on the proliferation of mouse Müller cells provided in the EdU method test example.

[0021] Figure 4 The results of the effect of the RNA provided in the rhodamine staining experiment on the mitochondrial membrane potential of mouse Müller cells.

[0022] Figure 5 The results of the RNA-promoting apoptosis effect of Müller cells provided in the Calcein-AM / PI double staining experiment test example.

[0023] Figure 6This is an example of Tuj1 staining identification of primary retinal ganglion cells extracted from retinal tissue.

[0024] Figure 7 The results of the RNA provided in the PI / Hoechst double staining experiment test example inhibiting apoptosis of primary ganglion cells under Müller cell co-culture conditions.

[0025] Figure 8 The RNA provided in the retinal ischemia-reperfusion model animal experiment test example alleviates the mouse retinal tissue morphology caused by retinal ischemia-reperfusion injury.

[0026] Fig. 9 The results of RNA reduction of GS-positive cells provided in the retinal ischemia-reperfusion model animal experiment test example were obtained.

[0027] Fig.10 The results of increasing NeuN-positive cells using RNA provided in the retinal ischemia-reperfusion model animal experiment were tested.

[0028] Fig.11 The mRNA expression detection results of RNA inhibiting the expression of inflammatory factors provided in the retinal ischemia-reperfusion model animal experiment test embodiment.

[0029] Fig.12 The protein expression detection results of RNA inhibiting the expression of inflammatory factors provided in the retinal ischemia-reperfusion model animal experiment test example. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0031] The inventors of the present application creatively discovered an RNA, whose nucleotide sequence is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. The single-stranded molecule of the RNA (as shown in SEQ ID NO: 1 or SEQ ID NO: 2), or the double-stranded molecule of the RNA (consisting of at least one of the items shown in SEQ ID NO: 1 and SEQ ID NO: 2), can inhibit the proliferation of retinal Müller cells, increase the changes in mitochondrial membrane potential of retinal Müller cells, promote Müller cell apoptosis, reduce excessive glial activation of Müller cells and protect ganglion cells from damage, and reduce the inflammatory response of retinal ischemia-reperfusion injury, and has application prospects in the prevention and treatment of retinal ischemia-reperfusion injury.

[0032] In some test examples, the inhibitory effect of RNA such as SEQ ID NO: 1 on the proliferation of mouse Müller cells was tested by the CCK-8 method.

[0033] The testing process includes:

[0034] 1) Fresh retinal tissues of 7-day-old C57BL / 6J mice were obtained under sterile conditions and transferred to a mixture of DPBS containing 0.25% trypsin and DNaseI, and digested at 37°C for 30 min; the cell pellets were collected by centrifugation, resuspended in DMEM complete medium containing 12% FBS, and inoculated on 25 cm 2 The cells were cultured in a cell culture flask at 37°C in an incubator. The cells were subcultured when the cell density reached 80%. Purified primary mouse Müller cells were obtained after about 3 subcultures. Purified primary mouse Müller cells were identified by GFAP and GS. Figure 1 As shown, the proportion of GFAP-positive and GS-positive cells reached 90%, indicating that the purity of Müller cells reached more than 90% and was used in subsequent experiments.

[0035] 2) Mouse primary Müller cells were cultured in DMEM medium containing 12% fetal bovine serum, 1% penicillin and 1% streptomycin at 37°C and 5% CO2 in 24-well plates until the confluence reached about 60% and then divided into model group (OGD / R), treatment group (RNA), non-treatment group (NC) and blank group (Ctrl). In the treatment group, 1×10 5 Müller cells were mixed with lipofectamine 3000 (Cat No: L3000015, Thermo Fisher) and 50 nM RNA shown in SEQ ID NO: 1 and cultured for 6 h. In the non-treated group, 1×10 5Müller cells were mixed with lipofectamine 3000 and 50 nM RNA shown in SEQ ID NO: 11 and cultured for 6 hours. The blank group cells and the model group cells were added with the same volume of culture medium and cultured for 6 hours. The treated group cells, non-treated group cells and model group cells cultured for 6 hours were treated with oxygen-glucose deprivation for 6 hours and then reoxygenated and re-glucose (the blank group cells were not treated with oxygen-glucose deprivation and reoxygenated and re-glucose), the culture medium was discarded, and the cells were incubated with basal medium containing 10% CCK-8 (Cat No: C0038; China Bio-Tech) at 37°C for 1 hour for color development, and the absorbance was measured at 450 nm. The cell viability (%) of each group was calculated based on the absorbance, and the cell viability was the percentage of the difference between the absorbance at 450 nm measured by each group of cells and the absorbance at 450 nm of the blank group to the absorbance at 450 nm of the blank group.

[0036] like Figure 2 As shown, the cell viability of the treatment group was lower than that of the model group, while that of the non-treatment group was higher than that of the model group, which indicates that the RNA provided in the present application can inhibit the proliferation of Müller cells.

[0037] In some test cases, the inhibitory effect of RNA such as SEQ ID NO: 1 on the proliferation of mouse primary Müller cells was tested by EdU method.

[0038] The testing process includes:

[0039] 1) Müller cells were seeded in 24-well plates and cultured in complete medium containing 12% fetal bovine serum and 1% penicillin / streptomycin until the cell density reached about 60%. Then, the cells were divided into model group (OGD / R), treatment group (RNA), non-treatment group (NC) and blank group (Ctrl). In the treatment group, 2×10 5 Müller cells were mixed with lipofectamine 3000 and 50 nM RNA shown in SEQ ID NO: 1 and cultured for 6 hours. In the non-treatment group, Müller cells were mixed with lipofectamine 3000 and 50 nM RNA shown in SEQ ID NO: 11 and cultured for 6 hours. The blank group cells and the model group cells were added with the same volume of culture medium and cultured for 6 hours. The treated group cells, non-treated group cells and model group cells cultured for 6 hours were treated with oxygen-glucose deprivation for 6 hours and then reoxygenated and re-glucose (the blank group cells were not treated with oxygen-glucose deprivation and then reoxygenated and re-glucose).

[0040] 2) Discard the culture medium, wash the cells twice with PBS buffer, and use EdU working solution (EdU stock solution was diluted 1000 times with complete culture medium, and EdU stock solution was obtained from BeyoClick TMEdU-488 cell proliferation detection kit, CatNo: C0071S, Bio-Tech) was added to a 24-well plate at a volume of 1 mL / well; after incubation for 3 hours, the EdU working solution was discarded, 1 mL of 4% paraformaldehyde was added to each well, and fixed at room temperature for 15 minutes; the paraformaldehyde was discarded, 500 μL of washing solution (PBS containing 3% BSA) was added to each well, and washed 3 times, each time for 3-5 minutes; the washing solution was discarded, 500 μL of permeabilization solution (PBS containing 0.3% Triton X-100) was added to each well, and incubated at room temperature for 10-15 minutes; the permeabilization solution was discarded, and 500 μL of washing solution was added to each well, washed 1-2 times, each time for 3-5 minutes; the washing solution was discarded, and the Click reaction solution was prepared according to the manufacturer's instructions, and 200 μL of Click reaction solution, incubate at room temperature in the dark for 30 minutes; discard the reaction solution, add 500μL washing solution to each well and wash 1-2 times, 3-5 minutes each time; discard the washing solution, add 200μL DAPI to each well, incubate at room temperature in the dark for 10 minutes; discard the DAPI staining solution, add 500mL PBS to each well and wash 3 times, 3-5 minutes each time. Use a fluorescence microscope to take pictures, where the blue signal is the DAPI signal and the red is the EdU signal.

[0041] like Figure 3 As shown, using OGD / R to simulate the pathological environment, the proliferation signal of Müller cells treated with the RNA provided in the examples of the present application was reduced, indicating that the RNA treatment provided in the examples of the present application can significantly inhibit the proliferation ability of Müller cells under pathological conditions induced by OGD / R.

[0042] In some test cases, the effect of RNA such as SEQ ID NO: 1 on the mitochondrial membrane potential of mouse primary Müller cells was tested by rhodamine staining experiment.

[0043] The testing process includes:

[0044] 1) Müller cells were seeded in 24-well plates and cultured in complete medium containing 12% fetal bovine serum and 1% penicillin / streptomycin until the cell density reached about 60%. Then, the cells were divided into model group (OGD / R), treatment group (RNA), non-treatment group (NC) and blank group (Ctrl). In the treatment group, 2×10 5Müller cells were mixed with lipofectamine 3000 and 50 nM RNA shown in SEQ ID NO: 1 and cultured for 6 h. In the non-treatment group, Müller cells were mixed with lipofectamine 3000 and 50 nM RNA shown in SEQ ID NO: 11 and cultured for 6 h. The blank group cells and the model group cells were added with the same volume of culture medium and cultured for 6 h. The treated group cells, non-treated group cells and model group cells cultured for 6 h were treated with oxygen-glucose deprivation for 6 h and then reoxygenated and rehydrated (the blank group cells were not treated with oxygen-glucose deprivation and then reoxygenated and rehydrated).

[0045] 2) Prepare 1 mL / mL of rhodamine stock solution with deionized water, aspirate the culture medium in each group of cell wells, wash twice with preheated sterile PBS solution, then add 1 mL of serum-free DMEM culture medium to each well, and then add 5 μL of rhodamine stock solution in sequence, and then place in a 37°C, 5% CO2 incubator for staining for 30 minutes, and observe with an inverted fluorescence microscope.

[0046] like Figure 4 As shown, OGD / R was used to simulate the pathological environment, and the RNA provided in the examples of the present application significantly increased the changes in the mitochondrial membrane potential of Müller cells under OGD / R-induced pathological conditions.

[0047] In some embodiments, the effect of RNA of SEQ ID NO: 1 on inhibiting the apoptosis of Müller cells induced by OGD / R pathological conditions was tested by Calcein-AM / PI double staining experiment.

[0048] The testing process includes:

[0049] 1) Müller cells were seeded in 24-well plates and cultured in complete medium containing 12% fetal bovine serum and 1% penicillin / streptomycin until the cell density reached about 60%. Then, the cells were divided into model group (OGD / R), treatment group (RNA), non-treatment group (NC) and blank group (Ctrl). In the treatment group, 2×10 5 Müller cells were mixed with lipofectamine 3000 and 50 nM RNA shown in SEQ ID NO: 1 and cultured for 6 h. In the non-treatment group, Müller cells were mixed with lipofectamine 3000 and 50 nM RNA shown in SEQ ID NO: 11 and cultured for 6 h. The blank group cells and the model group cells were added with the same volume of culture medium and cultured for 6 h. The treated group cells, non-treated group cells and model group cells cultured for 6 h were treated with oxygen-glucose deprivation for 6 h and then reoxygenated and rehydrated (the blank group cells were not treated with oxygen-glucose deprivation and then reoxygenated and rehydrated).

[0050] 2) Remove the culture medium of each group of cells, wash twice with preheated sterile phosphate buffered saline (PBS), then add 1 mL of serum-free DMEM, then add 2 μL of 1 mg / mL PI stock solution and 3 μL of 1 mg / mL Calcein-AM stock solution (solvent is DMSO), then place in a 37°C, 5% CO2 incubator for staining for 10 minutes, observe under an inverted fluorescence microscope, excite at 490±10 nm wavelength, observe yellow-green living cells, then excite at 545 nm wavelength, see red dead cells, and take pictures for record. I is the red dead cell signal, and Calcein-AM is the green live cell signal.

[0051] like Figure 5 As shown, using OGD / R to simulate the pathological environment, the RNA provided in the present application can significantly increase the apoptosis of primary mouse Müller cells under OGD / R-induced pathological conditions and reduce the glial activation of the cells.

[0052] In some embodiments, the effect of RNA such as SEQ ID NO: 1 on inhibiting apoptosis of primary retinal ganglion cells under OGD / R-induced pathological conditions and Müller cell co-culture conditions was tested by PI / Hoechst double staining experiment.

[0053] The testing process includes:

[0054] 1) Fresh retinal tissue was obtained from C57BL / 6J pups within 0-3 days after birth, transferred to a mixture of papain and DNaseI in DPBS and digested at 37°C for 30 min; the cell pellet was collected by centrifugation, resuspended in DMEM complete medium containing 10% FBS, and inoculated on 25 cm 2 Cell culture flasks were cultured in a 37°C incubator; the culture fluid was transferred to a cell culture dish coated with anti-mouse macrophage antibody (CatNo: MABF2252; Millipore) for preliminary purification; the cell suspension that was not bound to the antibody was transferred to a culture dish coated with anti-Thy1.2 antibody (CatNo: ab269343; Abcam) for secondary purification; the supernatant was discarded, and mouse retinal ganglion cell culture medium (CatNo: CM-M122; Pronocell) was added to gently blow the cells at the bottom of the dish to obtain mouse primary retinal ganglion cell suspension. The cells were inoculated in a culture plate and cultured in a 37°C incubator; identification and experiments were performed when the cell density reached 80%; the purified mouse primary ganglion cells were identified by immunofluorescence staining with the ganglion-specific antibody Tuj1 (XY-809, Xinyu Biotechnology). If the proportion of Tuj1-positive cells reached 90%, it indicated that the purity of the primary retinal ganglion cells reached more than 90% and could be used for subsequent experiments. Figure 6The figure shows the identification of Tuj1, and the purity of the obtained primary retinal ganglion cells is more than 90%.

[0055] 2) Place 1×10 5 Müller cells were inoculated in the upper chamber of the 24-well cell co-culture system, and primary ganglion cells were inoculated in the bottom chamber of the co-culture system. After being cultured in complete medium containing 12% fetal bovine serum and 1% penicillin / streptomycin until the cell density reached about 60%, they were divided into a blank group (Ctrl), a model group (OGD / R), a treatment group (RNA), and a non-treatment group (NC). In the treatment group, Müller cells were mixed and cultured with 50nM of RNA shown in SEQ ID NO:1 for 6h. In the non-treatment group, Müller cells were mixed and cultured with lipofectamine 3000 and 50nM of SEQ ID NO:11 for 6h. The blank group cells and the model group cells were added with the same volume of culture medium and cultured for 24h. The treatment group cells, non-treatment group cells and model group cells cultured for 24h were treated with oxygen-glucose deprivation for 6h and then reoxygenated and rehydrated (the blank group cells were not treated with oxygen-glucose deprivation and then reoxygenated and rehydrated). The primary ganglion cells in the group were stained with PI / Hoechst.

[0056] like Figure 7 As shown, using OGD / R to simulate the pathological environment and co-culturing with the mouse primary Müller cells treated with the RNA provided in the present application can inhibit the apoptosis of primary ganglion cells. This shows that the RNA treatment provided in the present application significantly inhibits the apoptosis of mouse primary ganglion cells under the pathological conditions induced by OGD / R.

[0057] In some test examples, the effect of RNA such as SEQ ID NO: 1 in alleviating retinal ischemia-reperfusion injury was tested through retinal ischemia-reperfusion model animal experiments.

[0058] The testing process includes:

[0059] 1) 6-8 week old C57BL / 6J mice (Institute of Model Animals, Nanjing University) were anesthetized by intraperitoneal injection of ketamine (80 mg / kg) and xylazine (4 mg / kg); 0.5% tropicamide and 2.5% phenylephrine were used to dilate the pupil before the cornea, and then 0.4% lidocaine hydrochloride was used to anesthetize the cornea; after the pupil was dilated, a 30 gague needle was inserted into the anterior chamber under a microscope, and sterile saline was connected to hang water to increase the intraocular pressure and maintain it at 80-100 mmHg for 45 minutes; after 45 minutes, the needle was carefully pulled out, and then the intraocular pressure returned to normal. To prevent bacterial infection, tobramycin ointment was applied to the eyes. Seven days after modeling, the retinal thickness was significantly reduced and the number of cells in the GCL layer was reduced, which was considered a successful modeling, and animal experiments were performed at this time.

[0060] 2) C57BL / 6J normal mice were used as the blank group (Ctrl), and the retinal ischemia-reperfusion model mice were divided into a model group (RIR), a treatment group (RNA), and a non-treatment group (NC). The mice in the blank group and the model group were not treated. On the third day after modeling, the mice in the treatment group were injected with 1 nmol 1 μL of RNA such as SEQ ID NO: 1 into the vitreous cavity. On the 7th day after modeling, the retinal tissues of the mice were collected for HE staining of paraffin sections and immunofluorescence staining of frozen sections. On the third day after modeling, the mice in the non-treatment group were injected with 1 nmol 1 μL of RNA such as SEQ ID NO: 11 into the vitreous cavity. On the 7th day after modeling, the retinal tissues of the mice were collected for HE staining of paraffin sections and immunofluorescence staining of frozen sections.

[0061] A HE staining measurement process includes: intraperitoneal injection of ketamine (80mg / kg) and xylazine (4mg / kg) to anesthetize mice in each group, fix the head, limbs and tail of the mice, with the abdomen facing up, remove the hair on the chest and abdomen, cut the skin at the xiphoid process, bluntly separate the fascia, cut the ribs, and expose the chest cavity. After the left ventricle is perfused with normal saline, the eyeballs are immediately harvested to make paraffin sections. Take out the paraffin sections and put them in a 65-degree oven for 25 minutes; then dewax and hydrate: xylene for 30 minutes, anhydrous ethanol for 2 minutes. 95% ethanol for 2 minutes; 80% ethanol for 2 minutes; 70% ethanol for 2 minutes, ddH2O for 2 minutes. Hematoxylin for 5 minutes, wash with water to remove the dye, and eosin for 2 minutes. Ethanol is dehydrated step by step to make it transparent, and the slides are sealed with neutral gum, dried and photographed.

[0062] like Figure 8 As shown, in RIR model mice, intravitreal injection of the RNA provided by the present application alleviated the decrease in thickness of the entire retinal layer and inner plexiform layer (IPL) of the mouse retina, and reduced the loss of ganglion cells in the ganglion cell layer (GCL). The results showed that the RNA provided by the present application alleviated the changes in retinal tissue morphology of mice caused by retinal ischemia-reperfusion injury.

[0063] The frozen section immunofluorescence staining assay process includes: collecting mouse retinal tissue on the 7th day after modeling and preparing frozen sections; rinsing with PBS to remove OCT gel, blocking and permeabilizing with 1% Triton X-100 and 5% BSA for 45 minutes; preparing glutamine synthetase (GS (CatNo: ab228590, Abcam) and neuronal nuclear antigen antibody (NeuN antibody, CatNo: ab177487, Abcam) in appropriate proportions, and incubating with the sample tissue at 4°C overnight; incubating with the corresponding secondary antibody in the dark for 2 hours the next day, and recording the images with a fluorescence microscope.

[0064] like Fig. 9 , 10As shown, in RIR model mice, after intravitreal injection of the RNA provided by the present application, the number of GS-positive cells (cells expressing glutamine synthetase) decreased and the number of NeuN-positive cells (cells that specifically bind to neuronal nuclear antibodies and show positive signals) increased, indicating that the RNA provided by the present application reduces RIR-induced mouse retinal glial activation and thereby reduces ganglion cell damage.

[0065] In some test cases, the changes in inflammatory factors in the above-mentioned animal model experiments were also tested.

[0066] The testing process includes:

[0067] 1) Total RNA from the retinal homogenate of each group of mice was extracted using a cell RNA column extraction kit (CatNo: RC112-01; Nanjing Novozyme Biotechnology Co., Ltd.), and the quality and purity of RNA were detected by spectrophotometry. Reverse transcription and PCR reagent SYBR Green (CatNo: RC112-01, 18091050, 100029284, Nanjing Novozyme Biotechnology Co., Ltd.) was used to reverse transcribe and generate cDNA, and real-time fluorescence quantitative PCR was performed. Take 4 μL 2×SYBE greenqPCRmasterMix, take 1 μL of a mixture of 10 μM upstream primers and 10 μM downstream primers (as shown in Table 1), 1 μL cDNA and 4 μL double distilled water for amplification. ABI 7500 Real-Time PCR system was used for amplification: 95℃30s, 95℃5s, 60℃34s, for a total of 40 cycles, and then 95℃15s, 60℃1min, 95℃30s and 60℃15s were used for melting curve analysis. Each sample was repeated 3 times. β-actin was used as the internal reference gene, and the 2-△△ct method was used to calculate the ct value. In addition, mouse IL-1β, IL-6 and TNF-α ELISA kits (Cat No: MM-0040M2, MM-0163M2, MM-0132M2, Wuhan Enzyme Immunity Biotechnology Co., Ltd.) were used to detect the expression of IL-1β, IL-6 and TNF-α proteins in the retina of each group of mice.

[0068] Table 1

[0069] Gene Upstream primer (5'→3') Downstream primer (5'→3') IL-1β GCCTGTGTTTTCCTCCTTGC, SEQ ID NO:3 TGCTGCCTAATGTCCCCTTG, SEQ ID NO:4 IL-6 TCCATCCAGTTGCCTTCTTG, SEQ ID NO:5 TTCCACGATTTCCCAGAGAAC, SEQ ID NO:6 TNF-α CAGGCGGTGCCTATGTCTC, SEQ ID NO:7 CGATCACCCCGAAGTTCAGTAG, SEQ ID NO:8 β-actin GGGAAATCGTGCGTGAC, SEQ ID NO:9 AGGCTGGAAAAGAGCCT, SEQ ID NO:10

[0070] like Fig.11 and 12 As shown, in RIR model mice, after intravitreal injection of the RNA provided by the present application, the RNA level of retinal inflammatory factors was reduced, indicating that the RNA provided by the present application can significantly reduce RIR-induced retinal inflammation in mice.

[0071] Based on the above test examples, the present application found that RNA such as SEQ ID NO: 1 and / or 2 can inhibit the proliferation of retinal Müller cells, increase the changes in mitochondrial membrane potential of retinal Müller cells, promote Müller cell apoptosis, reduce Müller cell glial activation and protect ganglion cells from damage, reduce the inflammatory response of retinal ischemia-reperfusion injury, and has application prospects in the prevention and treatment of retinal ischemia-reperfusion injury.

[0072] Based on this, the embodiment discloses an RNA, whose nucleotide sequence is shown in SEQ ID NO:1 and / or SEQ ID NO:2.

[0073] The embodiments disclose a pharmaceutical composition comprising the RNA described in the present application and a pharmaceutically acceptable diluent, carrier or adjuvant.

[0074] The Examples disclose conjugates comprising the RNA described herein.

[0075] The embodiment discloses the application of the RNA. The application is selected from at least one of the following:

[0076] Preparation of drugs for preventing or treating diabetic retinopathy;

[0077] Preparation of drugs for preventing or treating retinal ischemia-reperfusion injury;

[0078] Preparation of drugs related to inhibiting the proliferation of retinal Müller cells;

[0079] Preparation of drugs related to increasing changes in mitochondrial membrane potential of retinal Müller cells;

[0080] Preparation of drugs related to promoting apoptosis of retinal Müller cells;

[0081] Preparation of drugs related to reducing Müller cell glial activation;

[0082] Preparation of drugs related to protecting ocular ganglia;

[0083] Preparation of drugs for reducing inflammatory response to retinal ischemia-reperfusion injury.

[0084] In one embodiment of the present application, the oligomeric compound is connected to a ligand / conjugate, which can be used, for example, to increase the cellular uptake of antisense RNA. This conjugation can occur at the 5' / 3' terminal position, but the ligand can also occur on sugars and / or bases. In particular, the growth factor to which the antisense RNA can be conjugated can include transferrin or folic acid. Transferrin-polylysine-RNA complexes or folic acid-polylysine-RNA complexes can be prepared for cell uptake by expressing high levels of transferrin or folic acid receptors. Other examples of conjugates / ligands are cholesterol moieties, duplex intercalators such as acridine, poly-L-lysine, "capping" with one or more nuclease-resistant linking groups such as monothioate phosphorothioates, etc. The present application also provides a conjugate comprising a compound according to the present application as described herein, and at least one non-nucleotide or non-polynucleotide portion covalently attached to the compound. Therefore, in one embodiment in which the compound of the present application consists of a specified nucleic acid, as disclosed herein, the compound may also include at least one non-nucleotide or non-polynucleotide portion (e.g., not including one or more nucleotides or nucleotide analogs) covalently attached to the compound. The non-nucleotide base portion may, for example, be or include a sterol such as cholesterol.

[0085] Thus, it will be appreciated that the RNA of the present application, for example for use in a pharmaceutical (therapeutic) formulation, may comprise further non-nucleotide base components, for example a conjugate as defined herein.

[0086] Based on this, the embodiments disclose the RNA and a pharmaceutically acceptable diluent, carrier or adjuvant.

[0087] The RNA of the present application can be used directly or in the form of various pharmaceutically acceptable salts. As used herein, the term "pharmaceutically acceptable salt" refers to a salt that retains the desired biological activity of the RNA identified herein and shows minimal undesirable toxicological effects. Non-limiting examples of such salts can be formed with organic amino acids, and with metal cations or with cations formed by ammonium, N, N-dibenzylethylenediamine, D-glucosamine, tetraethylammonium or ethylenediamine, such as zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, sodium, potassium, etc.

[0088] In some embodiments, RNA can be in the form of a prodrug. RNA is negatively charged ions in nature. Due to the lipophilic nature of cell membranes, the cellular uptake of RNA is reduced compared to neutral or lipophilic equivalents. This polarity 'hinderment' can be avoided by using a prodrug approach (see, e.g., Crooke, RM (1998) in Crooke, ST Antisense research and Application. Springer-Verlag, Berlin, Germany, Vol. 131, pp. 103-140).

[0089] Pharmaceutically acceptable binders and adjuvants may constitute an integral part of the formulated pharmaceutical.

[0090] The pharmaceutical composition of the present application includes but is not limited to solutions, emulsions or liposome-containing preparations. These compositions can be produced by a variety of components, including but not limited to preformed liquids, self-emulsifying solids and self-emulsifying semisolids. The delivery of drugs to tumor tissues can be enhanced by carrier-mediated delivery, including but not limited to cationic liposomes, cyclodextrins, porphyrin derivatives, branched dendrimers, polyethyleneimine polymers, nanoparticles and microspheres (DassCR.JPharmPharmacol2002; 54 (1): 3-27). The pharmaceutical preparation of the present application, which can be conveniently present in unit dosage form, can be prepared according to conventional techniques well known to the pharmaceutical industry. Such techniques include the step of contacting the active ingredient with a pharmaceutical carrier or excipient. In general, the preparation is prepared by: contacting the active ingredient with a liquid carrier or a finely separated solid carrier or both uniformly and closely, and then molding the product if necessary. The composition of the present application can be formulated into any of many possible dosage forms, such as but not limited to tablets, capsules, gel capsules, liquid syrups, soft gels and suppositories. The composition of the present application can also be formulated as a suspension in an aqueous, non-aqueous or mixed medium. The aqueous suspension may further include a substance that increases the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension may also include a stabilizer. The compound of the present application may also be conjugated with an active pharmaceutical substance such as aspirin, ibuprofen, sulfonamides, antidiabetics, antibacterials or antibiotics.

[0091] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. An RNA, the nucleotide sequence of which is shown in SEQ ID NO: 1 and / or SEQ ID NO:

2.

2. A pharmaceutical composition comprising the RNA according to claim 1, a pharmaceutically acceptable salt, a diluent, a carrier or an adjuvant.

3. The pharmaceutical composition according to claim 2, wherein the pharmaceutically acceptable salt is a salt that has the desired biological activity of the RNA and exhibits minimal undesirable toxicological effects.

4. The pharmaceutical composition according to claim 3, wherein the RNA forms a base addition salt with an organic amino acid and with a metal cation or with a cation formed by ammonium, N,N-dibenzylethylenediamine, D-glucosamine, tetraethylammonium or ethylenediamine, wherein the metal cation is selected from zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, sodium or potassium.

5. A conjugate comprising the conjugate of claim 1. The conjugate according to claim 5 , further comprising a ligand conjugated to the 5′ / 3′ end of the RNA. The conjugate according to claim 5 , wherein the ligand is selected from a sugar group and a base.

8. The conjugate according to claim 5, wherein the ligand is selected from transferrin, polylysine, cholesterol, sterol or folic acid.

9. The use of the RNA according to claim 1, wherein the use is selected from at least one of the following: Preparation of drugs for preventing or treating retinal ischemia-reperfusion injury; Preparation of drugs for preventing or treating diabetic retinopathy; Preparation of drugs related to inhibiting the proliferation of retinal Müller cells; Preparation of drugs related to increasing changes in mitochondrial membrane potential of retinal Müller cells; Preparation of drugs related to promoting apoptosis of retinal Müller cells; Preparation of drugs related to reducing Müller cell glial activation; Preparation of drugs related to protecting ocular ganglia; Preparation of drugs for reducing inflammatory response to retinal ischemia-reperfusion injury.

Images