C16orf45 gene targeting sgRNA and application thereof

Abstract

The invention discloses sgRNA (single guide ribonucleic acid) targeting a C16orf45 gene and application of the sgRNA, the sgRNA is C16orf45-sgRNA-1 or C16orf45-sgRNA-3, the nucleotide sequence of the C16orf45-sgRNA-1 is GGAGACAACCATGATGCCAG, and the nucleotide sequence of the C16orf45-sgRNA-3 is GGATGCATCAGCAGCTCTGCA. The invention further discloses a preparation method of the sgRNA targeting the C16orf45 gene and application of the sgRNA targeting the C16orf45 gene. The sgRNA can realize an efficient and specific gene knockout effect.

Description

Technical Field

[0001] The present invention relates to an sgRNA targeting a C16orf45 gene and an application thereof, and belongs to the technical field of sgRNA. Background Art

[0002] The C16orf45 gene is located on the short arm of chromosome 16 (16p13.11) and is considered an important locus closely related to neurodevelopmental diseases. However, research on the function of this gene is still relatively limited at home and abroad. Studies have shown that the loss of the C16orf45 gene can lead to decreased fertility in zebrafish; in patients with childhood malignant tumors and in situ recurrence, the mRNA level of the C16orf45 gene is significantly upregulated after radiotherapy. Despite this, the specific mechanism of action of the C16orf45 gene in tumor occurrence and development is still unclear, and there are currently no reports on the relationship between the C16orf45 gene and tumor radiosensitivity.

[0003] sgRNA (Small Guide RNA), or small guide RNA, is a key component in the CRISPR gene editing system, which can guide the Cas9 protein to recognize and cut specific DNA sequences. sgRNA usually consists of two parts: one is a single-stranded RNA molecule formed by the fusion of crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) in CRISPR. This structure enables sgRNA to bind to the Cas9 protein to form a Cas9-sgRNA complex, thereby accurately locating and identifying the target genomic sequence, and guiding the Cas9 protease to effectively cut specific DNA sites. sgRNA is widely used in the field of gene editing. It is not only used to explore gene functions in basic research, but also shows great application potential in gene therapy, agricultural biotechnology and other fields.

[0004] However, there is no relevant report on the sgRNA of the C16orf45 gene in the prior art. Summary of the invention

[0005] The present invention provides an sgRNA targeting the C16orf45 gene and an application thereof, which can effectively solve the above problems.

[0006] The present invention is achieved in that:

[0007] A sgRNA targeting the C16orf45 gene, wherein the sgRNA is C16orf45-sgRNA-1 or C16orf45-sgRNA-3,

[0008] Among them, the nucleotide sequence of C16orf45-sgRNA-1 is GGAGACAACCATGATGCCAG, and the nucleotide sequence of C16orf45-sgRNA-3 is GGATGACATCCAGCTCTGCA.

[0009] A cell in which the C16orf45 gene is knocked out, wherein the cell is a cell obtained by knocking out the C16orf45 gene using a CRISPR / Cas9 vector connected with the above-mentioned sgRNA.

[0010] A gene knockout reagent comprises the sgRNA.

[0011] A glioblastoma radiosensitizer, characterized by comprising the sgRNA.

[0012] A use of the sgRNA in knocking out the C16orf45 gene.

[0013] In some embodiments, a CRISPR / Cas9 vector is constructed using the sgRNA of claim 1, and then the CRISPR / Cas9 vector is used to knock out the C16orf45 gene.

[0014] A use of the sgRNA in preparing a drug for improving the radiosensitivity of glioblastoma cells.

[0015] An experimental method for improving the radiosensitivity of glioblastoma, using a CRISPR / Cas9 vector connected with the sgRNA to knock out the C16orf45 gene of glioblastoma cells.

[0016] The beneficial effects of the present invention are:

[0017] The present invention designs two specific sgRNA sequences for the C16orf45 gene. After rigorous experimental verification, the results show that these two sgRNAs can achieve efficient and specific gene knockout effects in the U251 cell line. This technological breakthrough provides solid technical support and experimental basis for in-depth exploration of the specific functions of the C16orf45 gene in cell biology.

[0018] The present invention can significantly improve the sensitivity of U251 cells to X-rays by knocking out the C16orf45 gene. This discovery not only reveals the important role of the C16orf45 gene in regulating cell radiosensitivity, but also lays a solid scientific foundation for further exploring the potential clinical application of the C16orf45 gene in improving the efficacy of radiotherapy in the future, and opens up a new research direction. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1 This is a diagram showing the difference in expression of the mRNA of the C16orf45 gene in Example 1 between the radioresistant (U251-RR) and wild-type (U251-WT) human glioblastoma cells U251.

[0021] Figure 2 This is a graph showing the changes in C16orf45 protein expression in human glioblastoma cells U251 of Example 1 after irradiation with 5 Gy X-rays.

[0022] Figure 3 This is a schematic diagram of the sgRNA of Example 2 targeting the second and third exons of the C16orf45 gene.

[0023] Figure 4 This is the pLVR-sgRNAs-CMV-Cas9 gene knockout vector map of Example 2.

[0024] Figure 5 This is an electrophoresis identification diagram of the colony PCR product after transformation with the C16orf45 gene knockout vector in Example 2.

[0025] Figure 6 This is a diagram of Western blot analysis of gene knockout efficiency in human glioblastoma cell U251 after C16orf45 gene knockout in Example 2.

[0026] Figure 7 This is a diagram showing the effect of knocking out the C16orf45 gene in Example 3 on the apoptosis of U251 cells under X-ray irradiation. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work belong to the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention provided in the drawings is not intended to limit the scope of the invention claimed for protection, but merely represents the selected embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work belong to the scope of protection of the present invention.

[0028] The embodiment of the present invention provides an sgRNA specifically targeting the C16orf45 gene. Specifically, the sgRNA can be of two types, C16orf45-sgRNA-1 or C16orf45-sgRNA-3. The nucleotide sequence of C16orf45-sgRNA-1 is specifically GGAGACAACCATGATGCCAG, while the nucleotide sequence of C16orf45-sgRNA-3 is GGATGACATCCAGCTCTGCA. Both sgRNAs have the ability to efficiently knock out the C16orf45 gene, laying a solid foundation for in-depth research on the various functions of the C16orf45 gene and promoting research progress in related fields.

[0029] A vector used in the CRISPR / Cas9 gene editing system, the vector is specially designed to contain a double-stranded DNA structure containing a specific sgRNA (i.e., single-stranded guide RNA). Specifically, the sgRNA can be two different targeting sequences for the C16orf45 gene, named C16orf45-sgRNA-1 or C16orf45-sgRNA-3. These two sgRNA sequences are specifically selected and designed to ensure that the Cas9 nuclease can be efficiently and specifically cut the target gene site.

[0030] The embodiment of the present invention aims to provide a cell treated with a specific gene editing technology, specifically, the cell is obtained by knocking out the C16orf45 gene. To achieve this goal, the researchers used the CRISPR / Cas9 gene editing system and used a specific CRISPR / Cas9 vector to accurately knock out the C16orf45 gene. The CRISPR / Cas9 vector is a specifically designed double-stranded DNA vector, the key feature of which is that it is connected to a specific sgRNA for the C16orf45 gene. These sgRNA molecules play a guiding role in the gene editing process, ensuring that the Cas9 enzyme can accurately identify and cut the target gene sequence. In the embodiment of the present invention, there are two types of sgRNA used, namely C16orf45-sgRNA-1 and C16orf45-sgRNA-3, both of which are optimized and designed to ensure efficient and specific knockout of the C16orf45 gene, thereby obtaining the desired gene-edited cells. Through this method, the researchers successfully constructed a cell with the C16orf45 gene knocked out, laying the foundation for subsequent functional research and application.

[0031] An embodiment of the present invention further provides a gene knockout reagent, comprising the above-mentioned sgRNA, namely C16orf45-sgRNA-1 or C16orf45-sgRNA-3.

[0032] A glioblastoma radiosensitizer comprises the above-mentioned sgRNA, namely C16orf45-sgRNA-1 or C16orf45-sgRNA-3.

[0033] The embodiment of the present invention aims to provide a method for using a specific sgRNA in the knockout process of the C16orf45 gene. Specifically, the sgRNA can be C16orf45-sgRNA-1 or C16orf45-sgRNA-3, both of which are optimized and screened to ensure their high efficiency and specificity in the knockout of the C16orf45 gene.

[0034] The embodiment of the present invention also provides a vector application method based on CRISPR / Cas9 technology, which is specifically used for knocking out the C16orf45 gene. The vector is a double-stranded DNA vector, which is characterized in that the specific sgRNA mentioned above has been connected. Specifically, the sgRNA carried by this vector can be C16orf45-sgRNA-1 or C16orf45-sgRNA-3. These two sgRNAs can accurately guide the Cas9 enzyme to cut the C16orf45 gene by binding to the Cas9 protein, thereby achieving effective knockout of the gene. Through the application of this vector system, the accuracy and efficiency of gene editing can be greatly improved, providing strong technical support for related research fields.

[0035] The embodiment of the present invention aims to provide an application of the sgRNA in the preparation of a sensitizer that can significantly improve the radiosensitivity of glioblastoma cells. Through this application, the response of glioblastoma to radiotherapy can be effectively enhanced, thereby improving the treatment effect.

[0036] The present invention also provides an application method based on CRISPR / Cas9 vector, which is also used to prepare a drug that can significantly improve the radiosensitivity of glioblastoma cells. By utilizing the precise gene editing capability of CRISPR / Cas9 technology, the radiosensitivity of glioblastoma can be effectively improved.

[0037] The embodiment of the present invention also describes in detail an experimental method for improving the radiosensitivity of glioblastoma cells. The core of the method is to use a CRISPR / Cas9 vector connected with the sgRNA to accurately knock out the C16orf45 gene in glioblastoma cells, thereby significantly improving the radiosensitivity of the cells.

[0038] Table 1 Main reagents involved in the present invention

[0039]

[0040]

[0041] Example 1 Screening of differentially expressed gene C16orf45 (GeneID: 89927) in human glioblastoma cells U251 after X-ray irradiation

[0042] 1. The analysis results of the GEO (Gene Expression Omnibus, number GSE206917) database showed that in the process of comparing with wild-type human glioblastoma cells U251-WT, it was found that the expression level of C16orf45 mRNA in radiation-resistant U251-RR cells showed a significant upward trend. Specifically, the expression level of C16orf45 mRNA in U251-RR cells significantly exceeded that in U251-WT cells, and the difference between the two was statistically significant (****P<0.0001). This significant difference was found in Figure 1 It was intuitively demonstrated in the literature, suggesting that the C16orf45 gene plays an important role in the biological characteristics of radiation-resistant glioblastoma cells.

[0043] 2. Changes of C16orf45 protein expression in human glioblastoma U251 cells irradiated with X-rays

[0044] U251 cells were irradiated using a Varian Clinac 600C linear accelerator (dose of 5 Gy, dose rate of 500 MU / min, the same below), total protein was extracted 48 hours later, and C16orf45 protein was quantitatively analyzed by Western blot. The specific steps are as follows:

[0045] 1) Use protein lysis buffer to extract total protein from cells and determine the protein concentration by BCA method to ensure the consistency of sample loading;

[0046] 2) heat denaturing the protein sample with SDS, followed by protein electrophoresis separation on polyacrylamide gel;

[0047] 3) Transfer the separated proteins from the gel to the NC membrane, and then block the nonspecific binding sites on the membrane with 5% skimmed milk powder;

[0048] 4) Incubate with primary antibody (specifically recognizing target protein C16orf45 or β-Tubulin) overnight, then incubate with secondary antibody at room temperature for 1 hour, and wash the membrane with TBST after each incubation;

[0049] 5) Add ECL chemiluminescent substrate to detect the target protein signal.

[0050] like Figure 2 As shown, 5Gy X-ray irradiation treatment significantly increased the expression level of C16orf45 protein in U251 cells, and the difference was statistically significant compared with the control group (Control) (n=3, **P<0.01).

[0051] In summary, X-ray irradiation can upregulate the expression of C16orf45 gene, suggesting that it may play an important role in regulating the radiosensitivity of human glioblastoma U251 cells.

[0052] Example 2 Knockout of C16orf45 gene in human glioblastoma cells U251

[0053] Design of sgRNA targeting C16orf45 gene

[0054] The sgRNA target site must be adjacent to the PAM sequence (NGG), and the GC content should be maintained between 40% and 60%. The present invention embodiment designs three sgRNAs targeting the second and third exons of the C16orf45 gene (Gene ID: 89927), and their specific sequences are as follows:

[0055] C16orf45-sgRNA-1:GGAGACAACCATGATGCCAG (SEQ ID NO.1)

[0056] C16orf45-sgRNA-2: GGCAAAAATTCAGCGTCTCC (SEQ ID NO.2)

[0057] C16orf45-sgRNA-3:GGATGACATCCAGCTTCTGCA (SEQ ID NO.3)

[0058] Among them, C16orf45-sgRNA-1 and C16orf45-sgRNA-2 target exon 2, while C16orf45-sgRNA-3 targets exon 3. Schematic diagram of sgRNA targeting C16orf45 exon is shown in Figure 3 .

[0059] When constructing sgRNA, "ATCCg" needs to be added to its 5' end to generate a forward oligonucleotide sequence; based on the principle of base complementary pairing, the complementary chain of sgRNA is generated, and "aaac" is added to the 5' end of the complementary chain, and "c" is added to the 3' end to obtain the reverse oligonucleotide sequence, as shown in Table 2.

[0060] Table 2 Forward and reverse oligonucleotide sequences

[0061]

[0062]

[0063] 2. Construction of CRISPR / Cas9 gene knockout vector

[0064] 1) Oligonucleotide chain annealing

[0065] Dissolve the dry powder of the paired oligonucleotide sequences designed in Table 2 in nuclease-free water and dilute to 10 μM. Take 20 μL of the forward and reverse single-stranded oligonucleotides respectively, mix them evenly, heat them at 90°C for 10 minutes to denature the single strands, and then cool them naturally to room temperature to complete the annealing process. After annealing, small fragments of double-stranded DNA with sticky ends are formed.

[0066] 2) Vector linearization

[0067] In a specific embodiment of the present invention, the CRISPR / Cas9 gene knockout vector used is pLVR-sgRNAs-CMV-Cas9, which is constructed by conventional methods and contains a series of key functional elements to ensure its high efficiency and specificity in the gene editing process. Specifically, these main functional elements include: 5'-LTR and 3'-LTR long terminal repeat sequences located at both ends of the vector, which play a vital role in the stable integration and expression of the vector; U6 promoter and CMV promoter responsible for driving the expression of small guide RNA (sgRNA) and Cas9 nuclease respectively, these two promoters can ensure the effective transcription of sgRNA and Cas9 in host cells; Esp3I restriction site for inserting and connecting specific sgRNA sequences, which provides a convenient cloning method; Cas9 gene encoding the core nuclease in the CRISPR / Cas9 system, which is used to achieve The key components of the gene knockout function; the nuclear localization signal SV40, which ensures that the Cas9 protein can be correctly positioned in the cell nucleus, thereby improving the efficiency of gene editing; the reporter gene GFP (green fluorescent protein), which is used to visually monitor the transfection and expression of the vector; the internal ribosome entry site gene IRES, which allows the simultaneous translation of multiple proteins on the same mRNA molecule; the neomycin resistance gene Neo, which is used to screen successfully transfected cells; the ampicillin resistance gene Amp, which provides a selective marker in bacteria; the post-transcriptional regulatory element WPRE, which can enhance the expression level of the gene; and the plasmid replication initiation site pUC Ori, which ensures the stable replication of the vector in bacteria. The detailed structure and layout of the above functional elements are as follows: Figure 4 As shown, the figure provides an intuitive reference for the specific implementation of the present invention.

[0068] The above vector was digested with endonuclease Esp3I. The digestion system included: 1μL Esp3I enzyme, 2μL 10× buffer, 1μL plasmid DNA, 1μL 10mM DTT, and the total reaction volume was supplemented to 20μL with nuclease-free water. The mixed system was incubated at 37°C overnight, and a linearized vector with corresponding sticky ends was obtained after the digestion was completed.

[0069] 3) Ligation of vector and insert fragment

[0070] The recovered linearized CRISPR / Cas9 vector was ligated with the small double-stranded DNA fragment formed in step 1. The ligation system is shown in Table 3. Incubate at 16°C overnight. After the ligation is completed, the recombinant gene knockout vector can be obtained.

[0071] Table 3 Reaction system

[0072] Components Volume (μL) Linearized CRISPR / Cas9 vector DNA (100 ng / μL) 1 Small double-stranded DNA fragment 1 10×T4 buffer 1 T4 DNALigase 1 Nuclease-free water Make up to a total volume of 10 μL

[0073] 4) Transformation of vector into DH5α Escherichia coli

[0074] Add the recombinant vector DNA to the competent cells, incubate on ice for 90 seconds, and heat shock at 42°C for 120 seconds to promote transformation. After cooling, add LB liquid medium without antibiotics and recover for 1 hour. Then, spread the bacterial liquid on an LB plate containing 100 μg / mL Amp, culture at 37°C for 16 hours, and pick the growing single colony for verification.

[0075] 5) PCR identification of positive colonies

[0076] Pick a single colony into LB medium containing 100 μg / mL Amp. After 6 hours of amplification, take 2 μL of bacterial solution as a template for PCR identification. The upstream primers are the positive sequences of sgRNA: sgRNA-1-F (ATCCGGGAGACAACCATGATGCCAG, SEQ ID NO.4), sgRNA-2-F (ATCCGGGCAAAAATTCAGCGTCTCC, SEQ ID NO.6), sgRNA-3-F (ATCCGGGATGACATCCAGCTCTGCA, SEQ ID NO.8), and the downstream primer uses the plasmid consensus sequence (5'-CATCGCGAAGCAGCGCAAAAC-3', SEQ ID NO.10). The PCR amplification system is shown in Table 4.

[0077] Table 4 PCR amplification system

[0078]

[0079] The PCR procedure is as follows: first, pre-denaturation (95°C, 5 minutes); then, in each cycle, denaturation (95°C, 30 seconds), annealing (60°C, 30 seconds) and extension (72°C, about 1 minute per kilobase) are performed in sequence, for a total of 35 cycles; finally, the extension is terminated at 72°C, and the temperature is lowered to 4°C after 5 minutes to preserve the amplified product. After the PCR amplification is completed, the amplified product is detected by agarose gel electrophoresis to determine whether the target DNA is successfully inserted into the vector. The results show (see Figure 5), the positive clones showed an amplified band at the 167bp position. Subsequently, bacteria were selected from the initial screening positive clones for sequencing verification to ensure the accuracy of the inserted sequence.

[0080] 6) Positive colony amplification and plasmid extraction

[0081] According to the identification results, the positive bacterial solution was inoculated into LB liquid medium containing 100 μg / mL Amp at a volume ratio of 1:100, and cultured overnight at 180 rpm in a constant temperature shaker at 37°C. 15 mL of overnight culture solution was collected, and the gene knockout vector DNA was extracted and purified using an endotoxin-free plasmid extraction kit, and its concentration and purity were determined.

[0082] 3. Knockout of C16orf45 gene in human glioblastoma U251 cells

[0083] 1) Cell transfection

[0084] U251 cells were seeded in 6-well plates one day in advance. When the cell density reached about 70%, 1.5 μg of empty vector or CRISPR / Cas9 gene knockout vector was mixed with 9 μL TGfect transfection reagent to prepare transfection complexes, which were added to the cell culture medium for incubation. The culture medium was replaced after 12 hours, and 800 μg / mL Neomycin was used for screening after 48 hours. After 1 week, 100 μg / mL Neomycin was used to continue culture until the cells resumed normal growth and no longer died. The recovered cells were inoculated into 96-well plates by single cell dilution method. After 7 days of culture, monoclonal cells were screened and gradually expanded to 24-well plates and 6-well plates for subsequent experiments.

[0085] 2) Western blot to identify the knockout efficiency of C16orf45 gene

[0086] When the U251 cells in the 6-well plate grew to completely cover the bottom of the well, they were digested with trypsin and then centrifuged to collect the precipitated cells. One-third of the collected cell precipitate was taken out for protein extraction. The extracted protein was detected by Western blot technology to evaluate the knockout effect of the C16orf45 gene (for specific results, see Figure 6). In this experiment, wild-type U251 cells transfected with an empty vector were labeled as the WT group, while cloned cells transfected with three different knockout vectors were named sg1, sg2, and sg3 groups. The experimental results showed that the expression of C16orf45 protein was not detected in the sg1 and sg3 groups, while the presence of C16orf45 protein was detected in the sg2 group. This result indicates that the two knockout vectors, C16orf45-sgRNA-1 and C16orf45-sgRNA-3, have the ability to efficiently knock out the C16orf45 gene. Based on this, the sg1 and sg3 groups of cells were selected for subsequent in-depth research.

[0087] Example 3 Effect of C16orf45 gene knockout on the radiosensitivity of human glioblastoma cells U251

[0088] In order to deeply evaluate the specific role of the C16orf45 gene in the radiosensitivity of U251 cells, the research team first evenly seeded U251 cells in the logarithmic growth phase into a 6-well culture plate. Then, the researchers waited patiently until the cell density steadily increased to the appropriate range of 70-80%. At this time, the cells were immediately irradiated with a 5Gy dose of X-rays to simulate the radiotherapy environment. After a 48-hour incubation and observation period, the researchers carefully collected cell samples from each group and marked the cells with AnnexinV-APC staining for accurate apoptosis detection by flow cytometry. The experimental results are as follows Figure 7 As shown, after 5 Gy of X-ray irradiation, the cell apoptosis rate (using the proportion of Annexin V-positive cells as an evaluation index) of the C16orf45 gene knockout group (including two subgroups, sg1 and sg3, which were knocked out according to the method of Example 2) was significantly higher than that of the wild-type WT group without gene knockout, and the difference was statistically significant, which fully demonstrated that the C16orf45 gene plays an important role in regulating the radiosensitivity of U251 cells.

[0089] In summary, the present invention discloses in detail two sgRNAs for the C16orf45 gene with high efficiency and targeting, which lays a solid foundation for the subsequent construction of a knockout model for the C16orf45 gene. By gene editing the human glioblastoma cell line U251 in an in vitro experiment, the C16orf45 gene was specifically knocked out, and combined with X-ray irradiation treatment, the experimental results clearly showed that the cells after gene knockout showed a significant increase in apoptosis. This result strongly suggests that the loss of the C16orf45 gene can effectively improve the radiosensitivity of U251 cells. The experimental data and implementation cases of the present invention not only provide key experimental basis for in-depth research on the specific mechanism of action of the C16orf45 gene in the regulation of glioblastoma radiosensitivity, but also provide important scientific basis and technical support for using this gene as a potential therapeutic target and developing new radiosensitization strategies or targeted treatment methods. The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and changes. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A sgRNA targeting the C16orf45 gene, characterized in that: The sgRNA is C16orf45-sgRNA-1 or C16orf45-sgRNA-3, Among them, the nucleotide sequence of C16orf45-sgRNA-1 is GGAGACAACCATGATGCCAG, and the nucleotide sequence of C16orf45-sgRNA-3 is GGATGACATCCAGCTCTGCA.

2. A cell with C16orf45 gene knocked out, characterized in that: The cell is a cell obtained by knocking out the C16orf45 gene using a CRISPR / Cas9 vector connected with the sgRNA of claim 1.

3. A gene knockout reagent, characterized in that: Comprising the sgRNA of claim 1.

4. A glioblastoma radiosensitizer, characterized in that: Comprising the sgRNA of claim 1.

5. Use of the sgRNA according to claim 1 in knocking out the C16orf45 gene.

6. The use according to claim 5, characterized in that: The sgRNA of claim 1 is connected to construct a CRISPR / Cas9 vector, and then the CRISPR / Cas9 vector is used to knock out the C16orf45 gene.

7. Use of the sgRNA according to claim 1 in preparing a glioblastoma radiosensitizer.

8. An experimental method for improving the radiosensitivity of glioblastoma, characterized in that: The CRISPR / Cas9 vector constructed using the sgRNA according to claim 1 is used to knock out the C16orf45 gene of glioblastoma cells.

Images