SsDNA aptamer capable of specifically recognizing 2 '-fucosyllactose as well as construction method and application of ssDNA aptamer

Abstract

The invention relates to an ssDNA aptamer capable of specifically recognizing 2 '-fucosyllactose and a construction method and application of the ssDNA aptamer. The nucleotide sequence of the ssDNA aptamer is shown as SEQ ID NO.1 or 5. The ssDNA aptamer is used for preparing a fluorescent biosensor for detecting coupling of the ssDNA aptamer of the 2'-fucosyllactose and CRISPR / Cas12a. The sensing part comprises a magnetic bead, short-chain ssDNA and an ssDNA aptamer-dsDNA hybrid chain, the short-chain ssDNA is complementarily paired with the end part of an ssDNA aptamer and is provided with a marker, and the dsDNA is complementarily paired with the end part of the ssDNA aptamer; and the detection part comprises crRNA, a Cas12a protein and a fluorescent probe. Compared with the prior art, the ssDNA aptamer has high affinity with 2 '-fucosyllactose, and the fluorescent biosensor has the characteristics of high efficiency, rapidness and high throughput detection.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a ssDNA aptamer specifically recognizing 2'-fucosyllactose and a construction method and application thereof. Background Art

[0002] Human milk oligosaccharides (HMOs) are a general term for a large class of oligosaccharides with rich physiological activity in breast milk. They are also the third largest nutrient in breast milk after lactose and fat, and play an irreplaceable and important role in the growth and development of infants and young children. 2′-fucosyllactose (2′-FL) is the neutral oligosaccharide with the highest content among HMOs, accounting for about 30% of the HMOs content in breast milk. 2′-FL has been proven to have multiple physiological functions such as prebiotic activity, anti-adhesion and antibacterial properties, immune regulation and promotion of brain development. At present, 2′-FL has been officially approved by China, the United States, the European Union, Australia and New Zealand as a food nutrient fortifier or a new additive for infant formula milk powder, and has great application prospects in infant formula milk powder, modified milk powder (for children), and special medical baby food. As 2'-FL enters the market on a large scale as an emerging food nutritional fortifier, the technical development and factory construction of large-scale preparation of 2'-FL have become hot topics. Therefore, it is particularly urgent to establish a rapid and batchable detection method. In addition, due to the lack of specific genes in some mothers, their breast milk does not contain 2'-FL, which makes their children face a higher risk of Crohn's disease, sepsis and other diseases. However, hospitals have not yet carried out tests for polymorphism of breast milk components. Therefore, applying the detection method of 2'-FL to the analysis of breast milk components can help mothers provide timely dietary supplements for their babies according to the specific components of breast milk, thereby preventing adverse effects on the health of babies. In summary, the development of a method that can detect 2'-FL quickly and on a large scale has many practical application significances.

[0003] At present, the detection and quantitative analysis of 2′-FL are still limited to conventional instrumental analysis methods, including high performance liquid chromatography, reversed phase high performance liquid chromatography, ion chromatography, liquid chromatography-mass spectrometry, capillary electrophoresis, nuclear magnetic resonance, etc. However, no relevant standards for 2′-FL detection have been issued at home and abroad. In addition, due to the high price of analytical instruments, high experimental costs, high sample requirements, and overall long time consumption, it is difficult to meet the needs of large-scale detection, thus limiting the detection throughput of 2′-FL. Therefore, it is particularly urgent to develop a new method for rapid and high-throughput 2′-FL detection. Summary of the invention

[0004] The purpose of the present invention is to overcome the inability of the prior art to detect 2′-fucosyllactose quickly and with high throughput, thereby providing a ssDNA aptamer that specifically recognizes 2′-fucosyllactose and a construction method and application thereof.

[0005] The purpose of the present invention can be achieved by the following technical solutions:

[0006] One of the technical solutions of the present invention is to provide a ssDNA aptamer that specifically recognizes 2′-fucosyllactose, and the nucleotide sequence thereof is shown in SEQ ID NO.1 or 5.

[0007] SEQ ID NO.1(5′-3′):

[0008] ATAGGAGTCACGACGACCAG-TAGGTCGATAAAACAAGTACAGCTGGTG GA-TATGTGCGTCTACCTCTTGA

[0009] SEQ ID NO.5(5′-3′):

[0010] ATAGGAGTCACGACGACCAGGCCGTAGGACTGGGCATATCTGCCACGCGTTATGTGCGTCTACCTCTTGATTTTTTATTCCGACCTCATTAAGCAGC

[0011] The second technical solution of the present invention is to provide a method for constructing a ssDNA aptamer as described in one of the above technical solutions, comprising the following steps:

[0012] S1, mixing and incubating the initial single-stranded DNA library with the labeled complementary short chain P3 having a nucleotide sequence as shown in SEQ ID NO.2 to construct a hybridization library;

[0013] The nucleotide sequence in the initial single-stranded DNA library is a general formula as shown in SEQ ID NO.11, in which N represents any one of the bases A, T, G, and C, and N30 represents a random sequence region with a length of 30 nucleotides;

[0014] SEQ ID NO.2 (complementary short chain P3, 5′-3′): TCAAGAGGTAGAC

[0015] Preferably, the complementary short chain P3 is modified and labeled with biotin, that is:

[0016] 5′-biotin-TCAAGAGGTAGAC-3′.

[0017] SEQ ID NO.11 (initial single-stranded DNA library, 5′-3′):

[0018] 5′-ATAGGAGTCACGACGACCAG-N30-TATGTGCGTCTACCTCTTGA-3′.

[0019] S2, adding streptavidin magnetic beads to the hybridization library constructed in step S1 to construct an initial ssDNA library fixed on the surface of the magnetic beads;

[0020] S3, adding the target 2′-fucosyllactose to the ssDNA initial library fixed on the surface of the magnetic beads constructed in step S2 for incubation, collecting the supernatant after magnetic separation, obtaining a single-stranded ssDNA that can bind to 2′-fucosyllactose as a target-ssDNA complex, and using the target-ssDNA complex as a template, a forward primer P1 and a reverse primer P2 modified with a phosphate group at one end as a primer pair, amplifying to obtain dsDNA, wherein the nucleotide sequences of the forward primer P1 and the reverse primer P2 are shown in SEQ ID NO.3-4 respectively;

[0021] SEQ ID NO.3 (forward primer P1, 5′-3′): ATAGGAGTCACGACGACCAG;

[0022] SEQ ID NO. 4 (reverse primer P2, 5′-3′): TCAAGAGGTAGACGCACATA.

[0023] S4, preparing single strands by enzyme digestion of the phosphorylated strands of dsDNA in step S3 to obtain a secondary ssDNA library;

[0024] S5, repeating steps S1 to S4 for multiple times on the secondary ssDNA library obtained in step S4, determining the number of repeated rounds according to the qPCR melting curve, and sequencing after the last PCR amplification;

[0025] S6. Screening the sequencing results obtained in step S5 to obtain a ssDNA aptamer that specifically recognizes 2′-fucosyllactose based on sequence repeatability or stability, affinity, and specificity.

[0026] In some specific embodiments, in step S1, the molar ratio of the initial single-stranded DNA library to the labeled complementary short strand of the nucleotide sequence as shown in SEQ ID NO.2 is 1:1.5, and the incubation condition is 95° C. for 10 min and immediately placed in an ice bath.

[0027] In some specific embodiments, in step S2, the specific method for constructing the ssDNA initial library includes: mixing the hybridization library with streptavidin magnetic beads at a mass ratio of 1:300, and incubating them at 37°C and 160rpm for 4 hours, discarding the supernatant after magnetic separation, and obtaining the hybridization library fixed on the surface of the magnetic beads, which is the ssDNA initial library.

[0028] In some specific embodiments, in step S5, the number of repeated rounds is determined based on the qPCR melting curve as follows: when the melting temperature of the PCR product reaches a maximum during the qPCR reaction and the peak value does not rise any more, it is the last round of repetitions.

[0029] In some specific embodiments, in step S5, during the repetitive process, 3-fucosylated lactose and / or L-fucose and / or lactose are further added in step S3 as counter-screening targets, and are first incubated with the sequences in the ssDNA initial library immobilized on the surface of the magnetic beads, and the sequences bound to the counter-screening targets are discarded, and then incubated with the positive screening target 2'-fucosyllactose to obtain a target-ssDNA complex with improved specificity.

[0030] The third technical solution of the present invention is to provide an application of the above-mentioned ssDNA aptamer, wherein the ssDNA aptamer is used to prepare a biosensor for detecting 2′-fucosyllactose.

[0031] In some embodiments, the biosensor is a fluorescent biosensor coupled with ssDNA aptamer and CRISPR / Cas12a.

[0032] The sensing part of the fluorescent biosensor includes magnetic beads, short-chain ssDNA fixed on the surface of the magnetic beads and complementary to the ends of the ssDNA aptamer and carrying a label, and a ssDNA aptamer-dsDNA hybrid chain, wherein the dsDNA is complementary to the ends of the ssDNA aptamer;

[0033] The detection part of the fluorescent biosensor includes crRNA, Cas12a protein and a fluorescent probe.

[0034] In some specific embodiments, when the nucleotide sequence of the ssDNA adaptor is as shown in SEQ ID NO.5:

[0035] The nucleotide sequence of the short-chain ssDNA is shown in SEQ ID NO.6;

[0036] The nucleotide sequence of the crRNA is shown in SEQ ID NO.12, and the crRNA is obtained by polymerizing crRNA T7-F and crRNAT7-R into a template DNA and then transcribed, wherein the nucleotide sequences of crRNA T7-F and crRNA T7-R are shown in SEQ ID NO.9-10;

[0037] The nucleotide sequence of the fluorescent probe is shown as TTATT;

[0038] The ssDNA aptamer-dsRNA hybrid chain is prepared by the following steps:

[0039] The ssDNA aptamer, dsDNA-F, dsDNA-R, and buffer were mixed, incubated at 95°C for 5 min, and cooled to room temperature to obtain a ssDNA aptamer-dsRNA hybrid chain.

[0040] Among them, the nucleotide sequences of dsDNA-F and dsDNA-R are shown in SEQ ID NO.7-8.

[0041] SEQ ID NO.6 (short chain ssDNA, 5′-3′): GTCGTGACTCCTATTTTTTTTTTTT

[0042] Preferably, the short-chain ssDNA is biologically modified and labeled, namely:

[0043] 5′-GTCGTGACTCCTATTTTTTTTTTTT-biotin-3′

[0044] SEQ ID NO.7 (dsDNA-F, 5′-3′):

[0045] TGAGCCATGTATCCAGGTCATTTGTCCCTATCAGTGATAGAGAAGCTCT GACAGTTCCA

[0046] SEQ ID NO.8 (dsDNA-R, 5′-3′):

[0047] TGGAACTGTCAGAGCTTCTCTATCACTGATAGGGACAATGACCTGGATACATGGCTCAGCTGCTTAATGAGGTCGGAAT

[0048] Nucleotide sequence of fluorescent probe: TTATT

[0049] Preferably, the fluorescent probe is a FQ fluorescent probe, and the two ends respectively include a FAM fluorescent group and a BHQ-1 quenching group, that is: FAM-TTATT-BHQ-1

[0050] SEQ ID NO.12 (crRNA, 5'-3'): 5'-UCCCUAUCAGUGAUAGAG-3'

[0051] In some specific embodiments, the detection range of the fluorescent biosensor coupled with the ssDNA aptamer and CRISPR / Cas12a is 0.18-11.72 μmol / L and 0.93-3 mmol / L.

[0052] In some specific embodiments, when the detection range of the fluorescent biosensor coupled with the ssDNA aptamer and CRISPR / Cas12a is 0.18-11.72 μmol / L, the linear equation satisfies y=606.29ln(x)-727.09, wherein y represents the fluorescence intensity of the system, and x represents the concentration of 2′-fucosyllactose.

[0053] In some specific embodiments, when the detection range of the fluorescent biosensor coupled with the ssDNA adaptor and CRISPR / Cas12a is 0.93-3 mmol / L, the linear equation satisfies y=180.15ln(x)+4681.32, wherein y represents the fluorescence intensity of the system, and x represents the concentration of 2′-fucosyllactose.

[0054] The fluorescent biosensor coupled with CRISPR / Cas12a of the present invention can be used for the detection of 2′-fucosyllactose. After adding target 2′-fucosyllactose to the above-mentioned aptamer sensor system, 2′-fucosyllactose can be specifically bound to the ssDNA aptamer to form a stable secondary structure. Because the affinity of the aptamer combined with the target is greater than the binding force of the aptamer with the short-chain ssDNA, the aptamer is competitively separated from the short-chain ssDNA, so as to promote the aptamer-dsDNA after combining with the target to separate from the magnetic beads and enter the supernatant of the system. It is separated by a magnetic frame, and the supernatant is the aptamer-dsDNA combined with 2′-fucosyllactose, which is added to the Cas12a signal system for fluorescence detection. The trans-cleavage active cleavage site of Cas12a protein exists in the dsDNA sequence. When the aptamer-dsDNA in the above supernatant is added to the complex formed by Cas12a protein and crRNA, the Cas12a protein undergoes structural changes after targeted cleavage of dsDNA, thereby activating the trans-cleavage activity of Cas12a protein, and the single-stranded fluorescent probe free in the system is rapidly cut, and the fluorescent groups at both ends are separated from the quenching groups, and then the fluorescent groups restore their fluorescent signals for detection under the irradiation of excitation light, that is, the Cas12a signal system can convert the free aptamer-dsDNA in the supernatant into fluorescence intensity, thereby realizing the quantitative detection of aptamer-dsDNA, and further realizing the detection of 2′-fucosyllactose.

[0055] Compared with the prior art, the present invention has the following beneficial effects:

[0056] (1) The present invention uses the library immobilization Capture-SELEX technology to indirectly immobilize the initial screening library based on streptavidin magnetic beads. Compared with the steric hindrance effect that may be caused by the fixed target, the library immobilization technology ensures the full exposure of the target binding site, which is conducive to improving the affinity of the screened aptamer with the target, thereby improving the efficacy of the aptamer in subsequent applications.

[0057] (2) The present invention obtains ssDNA aptamers that specifically bind to 2′-fucosyllactose by screening, and uses it as a recognition element for 2′-fucosyllactose detection, couples it with the CRISPR / Cas12a system, and utilizes the trans-cleavage activity of the Cas12a protein to construct an aptamer-CRISPR / Cas12a fluorescent biosensor, which achieves rapid response and amplification of the signal. Compared with the traditional 2′-fucosyllactose detection method, this method has the characteristics of high efficiency, rapidity and high-throughput detection, which can meet the detection range of 2′-fucosyllactose dosage in infant formula milk powder and formula food, and also expands the range of linear detection, providing a new method for the rapid detection of 2′-fucosyllactose. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 Flow chart of screening ssDNA aptamers for 2′-fucosyllactose for Capture-SELEX technology and detection principle diagram of aptamer-CRISPR / Cas12a fluorescent biosensor;

[0059] Figure 2 This is the result of affinity verification of ssDNA aptamer;

[0060] Figure 3 This is the result of ssDNA aptamer specificity verification;

[0061] Figure 4 The standard curve is for 2′-fucosyllactose fluorescence detection. DETAILED DESCRIPTION

[0062] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments. This embodiment is implemented based on the technical solution of the present invention, and provides a detailed implementation method and specific operation process, but the protection scope of the present invention is not limited to the following embodiments.

[0063] In the following examples, unless otherwise specified, raw materials or processing techniques are conventional commercially available raw materials or conventional processing techniques in the art.

[0064] Example 1: Screening of ssDNA aptamers that specifically recognize 2′-fucosyllactose

[0065] like Figure 1 The Capture-SELEX technology shown is used to construct a process for screening ssDNA aptamers for 2′-fucosyllactose.

[0066] 1.1 Construction of initial ssDNA random library and its primers:

[0067] S1. Construct an initial ssDNA random library containing the following sequence (SEQ ID NO.11):

[0068] 5′-ATAGGAGTCACGACGACCAG-N30-TATGTGCGTCTACCTCTTGA-3′, wherein N represents any one of the bases A, T, G, and C, and N30 represents a random sequence region with a length of 30 nucleotides.

[0069] S2, synthesizing a biotin-modified complementary short-chain sequence P3 (SEQ ID NO. 2) comprising the following sequence: 5′-biotin-TCAAGAGGTAGAC-3′;

[0070] 1.2 In vitro screening of nucleic acid aptamers:

[0071] S1. The initial ssDNA random library was incubated with the biotin-modified complementary short chain P3 at a molar ratio of 1:1.5 in a binding buffer (Source Leaf Biotechnology, Binding buffer, pH 7.4) (incubated at 95° C. for 10 min and immediately placed in an ice bath) to form a hybridization library.

[0072] S2. Add streptavidin magnetic beads to the hybridization library in step S1 and mix and incubate to fix the hybridization library on the surface of the magnetic beads. Wash the magnetic beads 5 times with binding buffer to remove the unfixed library. The specific method is as follows:

[0073] Before fixation, the magnetic beads were first subjected to magnetic separation to remove the storage solution, and then washed three times with binding buffer; the hybridization library and magnetic beads were mixed at a mass ratio of 1:300, and incubated at 37°C, 160rpm for 4 hours. After magnetic separation, the supernatant was discarded, the precipitate was washed 5 times with binding buffer, and 300 μL binding buffer was added to disperse the magnetic beads therein, which was the hybridization library fixed on the surface of the magnetic beads.

[0074] S3. In a 1 mL screening system, add the target 2′-fucosyllactose to the hybridization library fixed on the surface of the magnetic beads in step S2, mix and incubate at 37°C and 160 rpm for 2 hours. The supernatant containing ssDNA is obtained by magnetic separation, which is the target-ssDNA complex.

[0075] S4. The supernatant obtained in step S3 is used as a template chain for PCR amplification to obtain a double-stranded dsDNA product and purify it.

[0076] Subsequently, the single-stranded ssDNA after the double-stranded PCR product is digested (step S5) can be subjected to PCR screening again, and repeated for multiple rounds. Each round of screening requires optimization of the PCR annealing temperature, template amount and cycle number;

[0077] The PCR amplification system and conditions are shown in Table 1:

[0078] Table 1 PCR amplification system and conditions

[0079]

[0080] Note: In this experiment, 15, 20, 25 and 30 cycles were performed respectively. When other conditions remained unchanged, the cycle number with the clearest band was selected as the final cycle number of the PCR process for PCR amplification.

[0081] Forward primer P1 (SEQ ID NO. 3): 5′-ATAGGAGTCACGACGACCAG-3′;

[0082] Reverse primer P2 (SEQ ID NO. 4): 5′-TCAAGAGGTAGACGCACATA-3′

[0083] One end of the reverse primer P2 is also modified with a phosphate group.

[0084] S5, digesting the purified double-stranded PCR amplification product dsDNA obtained in step S4 with Lambda exonuclease to prepare a single-stranded ssDNA secondary library for the next round of screening;

[0085] The enzyme digestion system is shown in Table 2:

[0086] Table 2 Enzyme digestion system

[0087]

[0088]

[0089] Enzyme digestion conditions: 37°C water bath for 30 min, heating at 75°C for 10 min to inactivate the enzyme and terminate the reaction;

[0090] S6. Repeat steps S1 to S5 for the secondary library obtained in step S5, and use 1 μL of the enriched library after each round of screening as a template for qPCR. The number of repeated rounds of the final screening is determined by the melting curve. The judgment is based on the following: the SYBR Green dye in qPCR can specifically bind to double-stranded DNA, resulting in a significant enhancement of the fluorescence signal. The shape and peak position of the melting curve of the adsorption force of SYBR Green dye on single-stranded DNA will change with the diversity of the library, and the melting temperature of the PCR product is affected by the stability of the double strands. During the screening process, ssDNA bound to the target is enriched, and the diversity of the secondary library is reduced. The number of stable double strands increases and the melting temperature increases. The melting curve has a peak near 83°C, and the peak gradually increases with the increase in the number of screening rounds. The melting temperature reaches the maximum in the 11th round and the peak no longer rises, indicating that the aptamer has been enriched in the 11th round. The purified product after the last round of PCR amplification is transformed by T vector ligation and sent for sequencing.

[0091] In order to improve the specificity of the aptamer, an analog of 2'-fucosyllactose (3-fucosylated lactose and / or L-fucose and / or lactose) was selected as a counter-screening target. Starting from the seventh round of repeated screening, the sequence was first incubated with the counter-screening target, the sequence bound to the counter-screening target was discarded, and then incubated with the positive screening target 2'-fucosyllactose to obtain a sequence with improved specificity.

[0092] S7. Perform sequence analysis and secondary structure prediction on the sequencing results obtained in step S6, and select the top five candidate aptamers Ap-3, Ap-5, Ap-7, Ap-9 and Ap-10 for synthesis according to the requirements of high sequence repeatability or high stability (ΔG).

[0093] S8. The five candidate aptamer sequences synthesized in step S7 were tested for affinity and specificity using the SYBR Green I (SG) fluorescence method to determine the final specific aptamer. The specific method and results are as follows:

[0094] The five aptamers Ap-3, Ap-5, Ap-7, Ap-9 and Ap-10 solutions with different final concentrations (20-1000 nmol / L) were incubated with SG dye at 37°C for 1 h. Then 2′-fucosyllactose at a concentration of 5 μmol / L was added and incubated at 37°C for 1 h. After the incubation, the fluorescence intensity of the solution was measured on a microplate reader (excitation wavelength 485 nm, emission wavelength 520 nm). The binding curves of the fluorescence difference to the aptamers of different concentrations were fitted by the equation y=B max [ssDNA] / (K d +[ssDNA]) were fitted by nonlinear fitting to obtain the dissociation constants K of the five aptamers. d Values, such as Figure 2 shown.

[0095] The final concentration of K was 100 nmol / L. d The sequences Ap-3, Ap-9, and Ap-10 with lower values ​​were mixed and incubated with SG dye for 1 h. The target 2′-fucosyllactose and the counter-screening products (3-fucosyllactose, L-fucose, and lactose) were added to the aptamer-SG complex solution at a concentration of 5 μmol / L, respectively, and incubated at 37 °C for 1 h. The fluorescence intensity of the solution was measured (excitation wavelength 485 nm, emission wavelength 520 nm). The characteristics of the aptamer were evaluated by calculating the relative fluorescence ratio. The relative fluorescence difference of the 2′-fucosyllactose group was taken as “1”, e.g. Figure 3 shown.

[0096] The final obtained 2′-fucosyllactose specific ssDNA aptamer Ap-3 (SEQ ID NO.1) contains the following partial sequence:

[0097] 5′-ATAGGAGTCACGACGACCAG-TAGGTCGATAAAACAAGTACAGCTGGT GGA-TATGTGCGTCTACCTCTTGA-3′.

[0098] Example 2: Construction of ssDNA aptamer-CRISPR / Cas12a fluorescent biosensor

[0099] The sensing part of the ssDNA aptamer-CRISPR / Cas12a fluorescent biosensor is composed of magnetic beads-ssDNA / aptamer-dsDNA. The magnetic beads-ssDNA is: ssDNA (Biotin-ssDNA) fixed on the surface of streptavidin magnetic beads and modified by biotin and complementary to the primer region of the aptamer (the primer region refers to the fixed sequence region at both ends of the aptamer); the aptamer-dsDNA is a ssDNA aptamer-dsDNA hybrid chain. The detection part is composed of crRNA, Cas12a protein, and FQ fluorescent probe.

[0100] The S1 detection part includes the following construction process:

[0101] S1-1. Expression and purification of Cas12a protein. The specific steps are as follows:

[0102] The Cas12a protein expression plasmid PET28TEV-LBCpf1 was transferred into competent cells E. coli BL21 (DE3) by heat transformation, and after recovery, it was spread on LB solid medium containing kanamycin, and after inverted culture at 37°C overnight, a single clone was picked to obtain a recombinant strain;

[0103] The recombinant strain was inoculated into LB medium containing kanamycin and cultured overnight at 37°C and 160-180rpm. Then the recombinant strain solution was transferred to LB liquid medium containing kanamycin at a 1% inoculation volume and cultured at 37°C until OD 600 When the OD is 0.4-0.6, transfer again and culture until the OD 600 The pH value was 0.6-0.8, and IPTG was added at a final concentration of 0.1 mM. Protein expression was continued to be induced at 16-18°C. The cells were collected by centrifugation at 5000 rpm for 10 min at 4°C, and the cells were resuspended in bacterial lysis buffer (50 mmol / L Tris-HCl [pH 7.4], 200 mmol / L NaCl, 2 mmol / L DTT, 5% glycerol, and PMSF was added at a final concentration of 1 mM when used). The cells were ultrasonically disrupted at 280 W (working 5 s, resting 5 s), and the soluble supernatant expression components were collected by centrifugation (12000 rpm, 10 min).

[0104] The soluble supernatant expression components after the above-mentioned crushing were purified using a His tag protein purification kit, and the Cas12a protein was obtained by ultrafiltration concentration. The obtained protein was concentrated and stored at -80°C for later use;

[0105] S1-2, crRNA preparation, the specific steps are as follows:

[0106] Dissolve two primers crRNA T7-R (SEQ ID NO.10) and crRNAT7-F (SEQ ID NO.9) used for synthesizing crRNA transcription template DNA in DEPC water and adjust the volume to 10 μmol / L;

[0107] Take 9 μL of crRNA T7-R and crRNA T7-F, 0.2 μL of 10× Taq DNA polymerase PCR buffer and mix well in a 0.2 mL PCR tube;

[0108] The PCR conditions were set as follows: denaturation at 94°C for 5 minutes, followed by a decrease of 2°C per minute to room temperature. After annealing, the crRNA transcription template DNA was obtained;

[0109] The transcription template DNA was transcribed using the T7 high-efficiency RNA synthesis transcription kit to obtain crRNA (SEQ ID NO.12);

[0110] The transcribed crRNA was purified by phenol / chloroform extraction, fixed to volume and stored at -80°C.

[0111] crRNA T7-F (SEQ ID NO.9): 5′-ATTAATACGACTCACTATAGGG-3′

[0112] crRNA T7-R (SEQ ID NO.10):

[0113] 5′-CTCTATCACTGATAGGGAATCTACAACAGTAGAAATTCCCTATAGTG AGTCGTATTAAT-3′

[0114] crRNA (SEQ ID NO.12): 5'-UCCCUAUCAGUGAUAGAG-3'

[0115] The S1-3 and FQ fluorescent probes include a FAM fluorescent group at one end and a BHQ-1 quenching group at the other end.

[0116] FQ fluorescent probe: FAM-TTATT-BHQ-1

[0117] S2, the sensing part includes the following construction process:

[0118] S2-1. Preparation of aptamer-dsDNA. The specific steps are as follows:

[0119] The synthesized modified aptamer Ap-3 (SEQ ID NO.5), the dsDNA forward primer dsDNA-F (SEQ ID NO.7) and the reverse primer dsDNA-R (SEQ ID NO.8) were dissolved separately, and added to the Taq buffer with a final concentration of 1× at a ratio of 1:1:1, and mixed evenly.

[0120] The above system was placed in a PCR instrument and incubated at 95°C for 5 minutes, and gradually cooled to room temperature at a rate of 2°C per minute to obtain a ssDNA aptamer-dsDNA hybrid chain, namely, aptamer-dsDNA.

[0121] The concentration of aptamer-dsDNA was determined and fixed to 5 μmol / L, and stored at -20°C.

[0122] S2-2, pre-treat the streptavidin magnetic beads using a magnetic stand, remove the storage solution, and wash with binding buffer;

[0123] Add 20 μL of 15 μmol / L Biotin-ssDNA (SEQ ID NO.6) to the magnetic beads, and add binding buffer to a total volume of 200 μL. Mix and incubate for 30 minutes to allow Biotin-ssDNA to fully bind to the magnetic beads and achieve fixation;

[0124] After fixation, use a magnetic stand for separation to remove the supernatant, i.e. Biotin-ssDNA that is not bound to the magnetic beads. Use binding buffer to repeatedly wash the magnetic beads fixed with Biotin-ssDNA 5 times;

[0125] After washing, add 20 μL of 5 μmol / L aptamer-dsDNA prepared in advance, and use binding buffer to make the volume to 200 μL. Mix thoroughly and incubate at 37°C for 30 min to allow the aptamer-dsDNA to fully bind to the Biotin-ssDNA.

[0126] After the incubation, the supernatant, i.e., the excess aptamer-dsDNA that is not bound to the magnetic beads-ssDNA, is removed by magnetic separation. The magnetic beads bound to the aptamer-dsDNA and immobilized with Biotin-ssDNA are repeatedly washed with binding buffer for multiple times;

[0127] After washing, 900 μL of binding buffer was added to resuspend the beads, and the magnetic beads-ssDNA / aptamer-dsDNA complex was dispersed in the buffer for subsequent detection.

[0128] SEQ ID NO.5 (modified aptamer Ap-3):

[0129] 5′-ATAGGAGTCACGACGACCAGGCCGTAGGACTGGGCATATCTGCCACG CGTTATGTGCGTCTACCTCTTGATTTTTTATTCCGACCTCATTAAGCAGC-3′;

[0130] SEQ ID NO.6 (Biotin-ssDNA, short chain ssDNA):

[0131] 5′-GTCGTGACTCCTATTTTTTTTTTTT-biotin-3′

[0132] SEQ ID NO.7 (dsDNA-F):

[0133] 5′-TGAGCCATGTATCCAGTCATTTGTCCCTATCAGTGATAGAGAAGCT CTGACAGTTCCA-3′

[0134] SEQ ID NO.8 (dsDNA-R):

[0135] 5′-TGGAACTGTCAGAGCTTCTCTATCACTGATAGGGACAAATGACCTGG ATACATGGCTCAGCTGCTTAATGAGGTCGGAAT-3′;

[0136] Example 3: Detection of 2′-fucosyllactose by ssDNA aptamer-CRISPR / Cas12a fluorescent biosensor

[0137] S1. Preparation of standard curve. The specific steps are as follows:

[0138] Take 2′-fucosyllactose standard to prepare 2′-fucosyllactose solution with standard gradient concentration;

[0139] Take 2 μL of each 2′-fucosyllactose solution standard with gradient concentrations into 18 μL of magnetic beads-ssDNA / aptamer-dsDNA complex solution, mix well, and incubate at 37°C for 30 min;

[0140] After incubation, magnetic separation was performed and the supernatant was transferred to a new 0.2 mL centrifuge tube to obtain aptamer-dsDNA of different concentrations.

[0141] Prepare the detection system in a 0.2 mL PCR tube by adding 10 μL DEPC water, 2.5 μL 2 μmol / L crRNA, 0.5 μL 10 μmol / L Cas12a protein, 5 μL 10 μmol / L FQ fluorescent probe, and add ultrapure water to 100 μL.

[0142] The detection system reaction solution was dispensed into 5 wells to be detected in a 384-well microplate, with 18 μL in each well.

[0143] Take 10 μL of the supernatant after the reaction of the aptamer-dsDNA complex solution and add 2 μL to each well at the bottom of the microplate.

[0144] Use a microplate centrifuge to centrifuge the detection system reaction solution to the bottom.

[0145] The fluorescence intensity was detected using a multifunctional microplate reader, which was set to detect once every 1.5 min for a total of 60 min. The excitation wavelength used was 495 nm and the emission wavelength was 520 nm.

[0146] S2. Draw a corresponding linear relationship curve based on the relationship between the fluorescence intensity value of the system measured in step S1 and the concentration of 2′-fucosyllactose solution in two ranges.

[0147] like Figure 4 As shown, the fluorescence intensity of the system increases with the increase of the concentration of 2′-fucosyllactose solution. In the concentration range of 0.18 to 11.72 μmol / L of 2′-fucosyllactose, there is a linear relationship between the fluorescence intensity and the logarithm of the concentration, y=606.29ln(x)-727.09, and the correlation coefficient R 2=0.991, the detection limit is 1.34nmol / L; in the concentration range of 0.93-3mmol / L, the linear relationship between the fluorescence intensity and the logarithm of the 2′-fucosyllactose concentration is y=180.15ln(x)+4681.32, and the correlation coefficient R 2 =0.994, and the detection limit is 2.70 μmol / L. Where y represents the fluorescence intensity of the system, and x represents the concentration of 2′-fucosyllactose.

[0148] 2′-fucosyllactose has been approved as a new food additive in infant and older infant formula foods by many countries and regions, as shown in Table 3. The amount of 2′-fucosyllactose used in infant formula milk powder, infant formula and special medical purpose infant formula in my country is 0.7-2.4 g / L (i.e. 4.9-1.4 mmol / L, in pure form). Within the above-mentioned dosage range, the high-range detection of the 2′-fucosyllactose aptamer-CRISPR / Cas12a biosensor constructed by the present invention can better meet the detection needs to a certain extent.

[0149] Table 3 Regulatory approval status of 2′-fucosyllactose

[0150]

[0151] FDA stands for the U.S. Food and Drug Administration, and EFSA stands for the European Food Safety Authority;

[0152] The 2′-fucosyllactose aptamer-CRISPR / Cas12a biosensor is compared with the latest reported 2′-fucosyllactose detection method, as shown in Table 4. In the detection of the amount of 2′-fucosyllactose added in infant formula milk powder, the high detection range of the present invention is more in line with the dosage requirements of 2′-fucosyllactose, and the detection range of the sensor at low concentrations makes the detection range of 2′-fucosyllactose widened to a certain extent. In terms of detection time, the aptamer-dsDNA can stabilize the fluorescence intensity of the Cas12a system in about 15 minutes, complete the detection, and is conducive to shortening the detection time of 2′-fucosyllactose.

[0153] Table 4 Comparison of the latest detection methods for 2′-fucosyllactose

[0154]

[0155] [1] Yu Binbin, Ye Wenhui, Liu Biao. Determination of 2'-fucosyllactose in milk powder by anion exchange chromatography[J]. Food Industry, 2022, 43(2): 304-307.

[0157] [2] Zhan Shengqun, Ge Cheng, Yan Li, et al. Simultaneous determination of 2'-fucosyllactose and lactose-N-neotetraose in infant formula based on ultra performance liquid chromatography-tandem mass spectrometry [J / OL]. Food and Fermentation Industries, 2024: 1-13.

[0158] [3] Lu Xin, Zhu Guifang. Determination of 2'-fucosyllactose in infant formula by ion chromatography[J]. Laboratory Testing, 2023, 1(06): 1-7.

[0160] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A ssDNA aptamer that specifically recognizes 2′-fucosyllactose, characterized in that: Its nucleotide sequence is shown as SEQ ID NO.1 or 5.

2. A method for constructing a ssDNA aptamer according to claim 1, characterized in that: The steps include: S1, mixing and incubating the initial single-stranded DNA library with the labeled complementary short chain P3 having a nucleotide sequence as shown in SEQ ID NO.2 to construct a hybridization library; The nucleotide sequence in the initial single-stranded DNA library is a general formula as shown in SEQ ID NO.11, in which N represents any one of the bases A, T, G, and C, and N30 represents a random sequence region with a length of 30 nucleotides; S2, adding streptavidin magnetic beads to the hybridization library constructed in step S1 to construct an initial ssDNA library fixed on the surface of the magnetic beads; S3, adding the target 2′-fucosyllactose to the ssDNA initial library fixed on the surface of the magnetic beads constructed in step S2 for incubation, collecting the supernatant after magnetic separation, obtaining a single-stranded ssDNA that can bind to 2′-fucosyllactose as a target-ssDNA complex, and using the target-ssDNA complex as a template, a forward primer P1 and a reverse primer P2 modified with a phosphate group at one end as a primer pair, amplifying to obtain dsDNA, wherein the nucleotide sequences of the forward primer P1 and the reverse primer P2 are shown in SEQ ID NO.3-4 respectively; S4, preparing single strands by enzyme digestion of the phosphorylated strands of dsDNA in step S3 to obtain a secondary ssDNA library; S5, repeating steps S1 to S4 for multiple times on the secondary ssDNA library obtained in step S4, determining the number of repeated rounds according to the qPCR melting curve, and sequencing after the last PCR amplification; S6. Screening the sequencing results obtained in step S5 to obtain a ssDNA aptamer that specifically recognizes 2′-fucosyllactose based on sequence repeatability or stability, affinity, and specificity.

3. The construction method according to claim 2, characterized in that: In step S1, the molar ratio of the initial single-stranded DNA library to the labeled complementary short strand of the nucleotide sequence shown in SEQ ID NO. 2 is 1:1.5, and the incubation conditions are: incubate at 95° C. for 10 min and immediately place in an ice bath.

4. The construction method according to claim 2, characterized in that: In step S2, the specific method for constructing the ssDNA initial library includes: mixing the hybridization library with streptavidin magnetic beads at a mass ratio of 1:300, and incubating them at 37°C and 160 rpm for 4 hours, discarding the supernatant after magnetic separation, and obtaining the hybridization library fixed on the surface of the magnetic beads, which is the ssDNA initial library; In step S3, the target 2′-fucosyllactose is added to the ssDNA initial library fixed on the surface of the magnetic beads for incubation. The incubation conditions and time are: incubation at 37° C. and 160 rpm for 2 hours.

5. The construction method according to claim 2, characterized in that: In step S5, the number of repeated rounds is determined based on the qPCR melting curve: when the melting temperature of the product reaches the maximum during the qPCR reaction and the peak of the melting curve near 83°C no longer rises, it is the last round of repetition.

6. The construction method according to claim 2, characterized in that: In step S5, during the repetitive process, 3-fucosylated lactose and / or L-fucose and / or lactose are further added as counter-screening targets in step S3, and are first incubated with the sequences in the ssDNA initial library immobilized on the surface of the magnetic beads, and the sequences bound to the counter-screening targets are discarded, and then incubated with the positive screening target 2'-fucosyllactose to obtain a target-ssDNA complex with improved specificity.

7. A use of the ssDNA aptamer according to claim 1, characterized in that: The ssDNA aptamer is used for preparing a biosensor for detecting 2′-fucosyllactose.

8. The use according to claim 7, characterized in that: The biosensor is a fluorescent biosensor coupled with ssDNA aptamer and CRISPR / Cas12a. The sensing part of the fluorescent biosensor includes magnetic beads, short-chain ssDNA fixed on the surface of the magnetic beads and complementary to a part of the ssDNA aptamer and carrying a label, and a ssDNA aptamer-dsDNA hybrid chain, wherein the dsDNA is complementary to another part of the ssDNA aptamer; The detection part of the fluorescent biosensor includes crRNA, Cas12a protein and a fluorescent probe.

9. The use according to claim 8, characterized in that: When the nucleotide sequence of the ssDNA adaptor is as shown in SEQ ID NO.5: The nucleotide sequence of the short-chain ssDNA is shown in SEQ ID NO.6; The nucleotide sequence of the crRNA is shown in SEQ ID NO.12; The nucleotide sequence of the fluorescent probe is shown as TTATT; The ssDNA aptamer-dsRNA hybrid chain is prepared by the following steps: The ssDNA aptamer, dsDNA-F, dsDNA-R, and buffer were mixed, incubated at 95°C for 5 min, and cooled to room temperature to obtain a ssDNA aptamer-dsRNA hybrid chain. Among them, the nucleotide sequences of dsDNA-F and dsDNA-R are shown in SEQ ID NO.7-8.

10. The use according to claim 9, characterized in that: The detection range of the fluorescent biosensor coupled with the ssDNA aptamer and CRISPR / Cas12a is 0.18-11.72 μmol / L and 0.93-3 mmol / L; When the detection range of the fluorescent biosensor coupled with the ssDNA aptamer and CRISPR / Cas12a is 0.18-11.72 μmol / L, the linear equation satisfies y=606.29ln(x)-727.09, When the detection range of the fluorescent biosensor coupled with the ssDNA aptamer and CRISPR / Cas12a is 0.93-3 mmol / L, the linear equation satisfies y=180.15ln(x)+4681.32, wherein y represents the fluorescence intensity of the system, and x represents the concentration of 2′-fucosyllactose.

Images