Radiation-resistant adenovirus vector and construction method thereof

Abstract

The invention relates to a radiation-resistant adenovirus vector and a construction method thereof, and the construction method comprises the following steps: directionally cloning a radiation-resistant gene into a plasmid vector, co-transfecting the plasmid vector and an adenovirus skeleton plasmid into a host cell, and carrying out homologous recombination to obtain a recombinant adenovirus, namely the radiation-resistant adenovirus vector. And a new thought is provided for in-depth research on radiation damage resistance.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a radiation-resistant adenovirus vector and a construction method thereof. Background Art

[0002] Deinococcus radiodurans (DR) was first isolated by Anderson et al. in 1956 from canned beef that had deteriorated after being sterilized with 4 kGy of X-rays. It is one of the most radiation-resistant organisms on Earth to date and can withstand a range of environmental pressures. It not only produces antioxidants, including catalase, peroxidase, superoxide dismutase, carotenoids and manganese ion antioxidant complexes to cope with oxidative stress, but also has super DNA repair capabilities and is extremely resistant to some DNA damaging agents such as ionizing radiation, ultraviolet rays, desiccation and hydrogen peroxide. It can even withstand more than 15 kGy of γ rays and use homologous recombination to complete DNA repair in a short period of time. Therefore, the super radiation resistance of DR bacteria is the result of the synergistic effects of protection, tolerance and repair. Although radioresistant cocci have great potential in radiation resistance research and drought-resistant variety breeding, the current development of radioresistant cocci is extremely limited. Therefore, understanding the effect of radiation-resistant genes on radiation damage in animals and constructing radiation-resistant adenoviral vectors are of great significance for adenoviral vectors to achieve resistance to radiation damage in gene therapy.

[0003] Therefore, combining the advantages of adenovirus vectors with the advantages of the PprI gene in radioresistant cocci for application research in resistance to radiation damage has broad prospects. Summary of the invention

[0004] The purpose of the present invention is to overcome the defects in the prior art and provide a radiation-resistant adenovirus vector and a construction method, which successfully constructs a radiation-resistant adenovirus vector capable of expressing radiation-resistant protein, thereby achieving the expression of radiation-resistant protein.

[0005] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0006] A method for constructing a radiation-resistant adenovirus vector comprises directionally cloning a radiation-resistant gene into a plasmid vector, co-transfecting the gene with an adenovirus backbone plasmid into a host cell, and then performing homologous recombination to obtain a recombinant adenovirus, namely a radiation-resistant adenovirus vector.

[0007] As a further technical solution, the radiation-resistant gene adopts the PprI gene.

[0008] As a further technical solution, the protein encoding the PprI gene is related to the DNA damage response, and PprI is a switch that mediates the transcription of DDR genes.

[0009] As a further technical solution, the PprI gene is derived from Deinococcus radiodurans, and its sequence is shown in the sequence of the PprI gene published in GenBank (NCBI: DR-0167).

[0010] As a further technical solution, the synthetic primer of the PprI gene comprises:

[0011] PprI-F, nucleotide sequence as shown in SEN.ID: 1;

[0012] PprI-R, the nucleotide sequence is shown in SEN.ID:2.

[0013] As a further technical solution, the plasmid vector adopts the shuttle plasmid pADV-mCMV-MCS-3xFLAG.

[0014] As a further technical solution, the host cell is HEK293 cell.

[0015] The radiation-resistant adenovirus vector prepared by the construction method contains a radiation-resistant gene.

[0016] As a further technical solution, the radiation-resistant adenovirus vector is capable of expressing a radiation-resistant protein.

[0017] As a further technical solution, the radiation-resistant protein is immunogenic.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention adopts homologous recombination technology to co-transfect the plasmid carrying the radiation-resistant gene of radioresistant cocci and the adenovirus backbone plasmid into HEK293 cells to obtain a radiation-resistant adenovirus vector, which can solve the problem of radiation damage and provide a new idea for in-depth research on resistance to radiation damage.

[0020] The successfully expressed radiation-resistant adenovirus vector constructed by using the PprI gene in the present invention can successfully express the PprI protein, and the protein has immunogenicity. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the electrophoresis diagram of PCR amplified ppri gene;

[0022] exist Figure 1 In the figure, 1: DL 15000; 2: PCR result of pMD18-T-ppri; 3: negative template

[0023] Figure 2 The electrophoresis diagram for pADV-mCMV-ppri restriction digestion and PCR identification;

[0024] exist Figure 2 In the figure, 1: PCR with pADV-mCMV-MCS-3xFLAG as negative template; 2: ppri gene amplified from pADV-mCMV-ppri; 3: pADV-mCMV-ppri digested with EcoR I and BamH I; 4: DL 15000

[0025] Figure 3 This is the result of ppri gene sequencing and identification;

[0026] Figure 4 This is a diagram showing the packaging results of the recombinant adenovirus pAdMax-ppri in HEK 293 cells;

[0027] exist Figure 4 middle, Figure 4 A and Figure 4 A control: 2 days after transfection; Figure 4 B and Figure 4 B control: 8 days after transfection; Figure 4 C and Figure 4 C control: 11 days after transfection

[0028] Figure 5 This is the electrophoresis diagram of PCR identification of ppri gene in the recombinant adenovirus pAdMax-ppri;

[0029] exist Figure 5 In the figure, 1: PCR was performed using HEK 293 cells as negative template; 2: CSFVE0 gene was amplified from pAdMax-ppri; 3: DL 15000;

[0030] Figure 6 This is the Western Blot identification band diagram of the recombinant adenovirus pAdMax-ppri;

[0031] In 6, 1. Normal HEK 293 cells; 2. HEK 293 cells infected with empty vector; 3. HEK 293 cells infected with pAdMax-ppri; 4. Protein molecular weight standard;

[0032] Figure 7 This is the predicted map of the signal peptide of PprI protein;

[0033] Figure 8 This is the predicted transmembrane structure of PprI protein;

[0034] exist Figure 8Among them, A: DeepTMHMM-most Likely Topology (Type: Globular); B: DeepTMHMM-Posterior Probabilities;

[0035] Fig. 9 This is the predicted map of the antigenic determinant cluster of the PprI protein;

[0036] Fig.10 It is the secondary structure analysis diagram of PprI protein;

[0037] Fig.11 This is the predicted tertiary structure of PprI protein. DETAILED DESCRIPTION

[0038] The technical solution of the present invention will be described clearly and completely below in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0039] Example 1

[0040] 1 Materials and methods

[0041] 1.1 Test materials

[0042] Adenovirus AdMax packaging system, Ecoli DH5α competent cells, HEK 293 cells. Restriction endonucleases EcoRI and BamH I (TakaRa), T4 DNA ligase (MBI);

[0043] TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.3.0 (Shanghai Huashun Bioengineering Co., Ltd.); LipofectamineTM2000, DMEM (Gibco); EndoFree Maxi Plasmid Kit (Beijing Tiangen), AxyPrep Plasmid DNA Mini Kit (Hangzhou Aisijin Biotechnology Co., Ltd.), Premix TagTM (TaKaRaTaqTM Version 2.0plus dye), PrimeSTAR HSDNA Polymerase.

[0044] 1.2 Test methods

[0045] 1.2.1 Construction of linearized expression vector

[0046] (1) Synthesis (amplification) of PprI gene

[0047] According to the sequence of PprI gene published in GenBank (NCBI: DR-0167), primers were designed and sequences were synthesized using Vector NT 1 software (987 bp, synthesized by Shanghai Biotechnology Co., Ltd.). The upstream 5' end contained EcoR I restriction enzyme site and start codon, and the downstream 5' end contained BamH I.

[0048] The sequences are as follows: PprI-F: AAAGGTACCATGGCGCCCATCACGGCCTA;

[0049] PprI-R:CCCCTAGATAGTGACGACCTCCA.

[0050] (2) Preparation of linearized expression vector pADV-mCMV-MCS-3xFLAG

[0051] The expression vector pADV-mCMV-MCS-3xFLAG was digested with restriction endonucleases EcoR I and BamH I, and then incubated in a 37°C water bath for more than 2 hours; the digestion product was detected by agarose gel electrophoresis and gel recovery to obtain the linearized expression vector pADV-mCMV-MCS-3xFLAG.

[0052] (3) Construction of linearized expression vector pADV-mCMV-PprI

[0053] The correctly identified PprI gene fragment and the linearized vector pADV-mCMV-MCS-3xFLAG were added to the EP tube at a ratio of 2:1 for recombination reaction, and transformed into DH5α competent cells by heat shock method. The transformants grown on the plate were picked and resuspended in 10μL LB culture medium, and 1μL was taken as a template for colony PCR identification. The positive clones obtained by colony identification were sent to the sequencing company for sequencing verification. The sequencing results were compared and analyzed by software.

[0054] 1.2.2 Packaging of recombinant adenovirus pAdMax-PprI

[0055] The packaging of the recombinant adenovirus pAdMax-PprI includes the following steps:

[0056] Step (1), 1 day before transfection, HEK 293 cells were plated at 2.5×10 5 Cells / well were inoculated into a six-well plate, and the cell density during transfection was controlled to be 70-80%. The culture medium was high-glucose DMEM + 10% FBS, and the plate was kept at 37°C and 5% CO. 2 Incubate overnight in an incubator;

[0057] Step (2), 1 h before transfection, take out the cell culture plate, remove the original cell culture medium, add 1.5 mL of Opti-MEM culture medium, and return the cells to the incubator;

[0058] Step (3), dissolve 4 μg of the viral vector plasmid to be transfected (backbone plasmid: shuttle plasmid = 1:1) in Opti-MEM medium to a total volume of 250 μL, and mix gently;

[0059] Step (4), dissolving the transfection reagent in Opti-MEM medium to a total volume of 250 μL, and gently mixing; adding the transfection reagent dilution dropwise to the plasmid dilution, gently mixing while adding, and then leaving at room temperature for 20 minutes to allow the DNA and transfection reagent to fully combine to form a stable DNA-transfection reagent complex;

[0060] Step (5), take out the cell culture plate, add the prepared DNA-transfection reagent complex to the cell culture plate, mark it, and return it to the incubator; after 6 hours of culture, remove the culture medium, wash once with PBS, add 2mL of fresh complete culture medium (high glucose DMEM + 5% FBS) and continue to culture; then change the medium every 3 days, and virus plaques will appear in about 7 to 15 days, and collect the supernatant after complete lesions. At the same time, set the normally cultured HEK 293 cells as the control.

[0061] 1.2.3 Identification of recombinant adenovirus pAdMax-PprI

[0062] HEK 293 cells with good growth were inoculated into 24-well plates. After digestion, the cell concentration was adjusted to 1×10 5 / mL, add 500μL / well (to ensure that the cell confluence rate is between 30% and 50% when the virus is infected on the second day), the culture medium is high-glucose DMEM + 10% FBS, and culture in a 37°C, 5% CO2 incubator overnight; 1h before transfection, take out the cell culture plate, replace the cell culture medium (high-glucose DMEM + 5% FBS), and then take 50μL of the collected and preserved virus supernatant and inoculate it into the cells. Shake the culture plate once every 15-20min within the next 4h to increase the infection effect. Serum-free culture medium is used throughout the infection process. After 4h, the supernatant is discarded, and the culture medium with 5% serum is replaced and placed in a 37°C, 5% CO2 incubator for continued culture. After 48h, the cells and supernatant are collected for WB and PCR detection.

[0063] 1.2.4 Amplification and purification of recombinant adenovirus

[0064] The amplification and purification of the recombinant adenovirus includes the following steps:

[0065] Step 1: Plate HEK293 cells in 30-40 25 cm 2In the cell culture flask, wait until the cells grow to 70-80%;

[0066] Step 2: Plate HEK293 cells in 30-40 25 cm 2 In the cell culture flask, when the cells grow to 70-80%, replace with fresh medium without serum, add virus of appropriate titer (20-50 μL) to infect the cells;

[0067] Step 3: After all cells have become diseased (3-5 days), add about 500 μL of 10% Nonidet P 40 (NP40) to each culture flask to lyse the cells;

[0068] Step 4: Purify the virus using CsCl density gradient method, collect the virus, and store it at -80°C;

[0069] 1.2.5 Bioinformatics analysis of recombinant proteins

[0070] The online database and analysis software were used to predict and analyze the physicochemical properties, transmembrane region, signal peptide, secondary and tertiary structures, and antigenic determinants of the PprI protein.

[0071] 2 Results

[0072] 2.1 Construction and identification of linearized expression vector pADV-mCMV-PprI

[0073] The pMD18-T-PprI synthesized and cloned into the T vector was used as a template to amplify the DNA fragment of the PprI gene of Radioresistant coccus, which was about 1 kb in size. The result was consistent with the expectation ( Figure 1 Since EcoR I and BamH I sites were added to the upstream and downstream of the PprI gene, respectively, after the recombinant shuttle plasmid pADV-mCMV-PprI was treated with the two shearing enzymes EcoR I and BamH I, we obtained two fragments, one of which was the target gene PprI band with a size of about 1000 bp, and the other was the shuttle vector pADV-mCMV-MCS-3xFLAG band with a size of about 4000 bp, which was consistent with the expected result ( Figure 2 ). Sequencing confirmed that the inserted fragment in the recombinant shuttle vector pADV-mCMV-PprI was consistent with the target gene ( Figure 3 ).

[0074] 2.2 Packaging and identification of recombinant adenovirus pAdMax-PprI

[0075] 2.2.1 Packaging of recombinant adenovirus pAdMax-PprI

[0076] After the adenovirus backbone plasmid and shuttle plasmid pADV-mCMV-PprI-3xFLAG were co-transfected into HEK293 cells, the cells showed characteristic cytopathic effect (CPE). On the 8th day after infection, the cells began to show obvious pathogenic effects such as swelling and shrinkage ( Figure 4 B); On the 11th day, typical CPE appeared in the infected cells, forming strings of beads or grapes, and most of them fell off ( Figure 4 C).

[0077] 2.2.2 PCR identification of recombinant adenovirus pAdMax-PprI

[0078] For HEK293 cells that showed obvious pathological effects after infection, the genome was extracted and amplified using PprI gene-specific primers. As a result, a target gene band of about 1000 bp was obtained, which was consistent with the expected target gene size. However, no band was amplified in the blank control HEK293 cells ( Figure 5 ).

[0079] 2.2.3 SDS-PAGE and Western Blot Identification of PprI Protein Expressed by Recombinant Adenovirus pAdMax-PprI

[0080] Western Blot analysis clearly showed that a protein band of approximately 45 kDa was expressed in the recombinant adenovirus pAdMax-PprI, which was consistent with expectations ( Figure 6 ).

[0081] 2.3 Bioinformatics analysis of PprI protein

[0082] 2.3.1 Analysis of physicochemical properties of proteins

[0083] The analysis results of ProtParam software showed that the relative molecular weight of PprI protein was 17335.42, the molecular formula was C753H1208N216O245S4, the theoretical isoelectric point was 5.38, and it was composed of 328 amino acids; the aliphatic amino acid index was 70.80, the instability index was 49.59, and the overall average hydrophilicity was -0.410, which was an unstable hydrophilic protein. The specific results are shown in Tables 1 and 2.

[0084] Table 1 Analysis of physicochemical properties of PprI protein

[0085]

[0086] Table 2 Amino acid composition of PprI protein

[0087]

[0088] 2.3.2 Transmembrane structure and signal peptide analysis

[0089] The analysis of SignalP 5.0Server and TMHMM Server online software showed that PprI protein had no signal peptide ( Figure 7 ) and transmembrane domains, all located within the membrane ( Figure 8 ), and predicted that PprI protein was a non-transmembrane and non-secreted protein.

[0090] 2.3.3 Antigenic determinant prediction

[0091] The results of the prediction of Predicting Antigenic Peptides showed that the PprI protein sequence was 328 amino acids long, with an average antigenic determinant tendency of 1.0263, and there were 13 antigenic determinants in the predicted sequence (see Table 3 and Fig. 9 ).

[0092] Table 3 Predicted sequences of antigenic determinants

[0093] 0 StartPosition Sequence EndPosition 1 4 ANVSPPCPS 12 2 27 ASKPHPQIPVKLPFVTAPDALAA 49 3 56 DLAAAYVAAL 65 4 71 HSLMAGVPGVDLKF 84 5 96 PEHNVILINS 105 6 113 RFTLAHEIGHAILLGD 128 7 131 LLSD IHD 137 8 143 RLEQVETLCNVAAAAILMPEPVA 167 9 185 KRAEVSASSALYALTEQTPVPVYAVCAP 213 10 230 STEKVLTVRA 239 11 244 RGVKYTLASGTPVPADHPAALAL 266 12 274 EESYVPF 280 13 294 PSRGIVAVSFE 304

[0094] 2.3.4 Protein secondary structure prediction

[0095] The results of protein secondary structure analysis by SOPMA online software showed that the secondary structure of PprI protein included three forms: random coil, α-helix and β-fold, with random coil (76, accounting for 46.73%) and α-helix (47, accounting for 28.83%) being the main forms. The specific results are shown in Table 4 and Fig.10 .

[0096] Table 4 PprI protein secondary structure analysis results

[0097]

[0098] 2.3.5 Prediction of protein tertiary structure

[0099] The tertiary structure of PprI protein was predicted by Phyre2 online analysis and contains random coils, α-helices and β-folds. Fig.11 .

[0100] The above-described embodiments are only preferred embodiments of the present invention, and are not exhaustive of the feasible implementations of the present invention. For those skilled in the art, any obvious changes made thereto without departing from the principles and spirit of the present invention should be considered to be included in the scope of protection of the claims of the present invention.

Claims

1. A method for constructing a radiation-resistant adenovirus vector, characterized in that: The radiation-resistant gene is directionally cloned into a plasmid vector, and then co-transfected into a host cell with an adenovirus backbone plasmid, and then homologous recombination is performed to obtain a recombinant adenovirus, namely a radiation-resistant adenovirus vector.

2. The method for constructing a radiation-resistant adenovirus vector according to claim 1, characterized in that: The radiation-resistant gene is the PprI gene.

3. The method for constructing a radiation-resistant adenovirus vector according to claim 1, characterized in that: The PprI gene is derived from Radiodurans deinococcus.

4. The method for constructing a radiation-resistant adenovirus vector according to claim 3, characterized in that: The synthetic primer of the PprI gene comprises: PprI-F, nucleotide sequence as shown in SEN.ID: 1; PprI-R, the nucleotide sequence is shown in SEN.ID:

2.

5. The method for constructing a radiation-resistant adenovirus vector according to claim 1, characterized in that: The plasmid vector adopts the shuttle plasmid pADV-mCMV-MCS-3xFLAG.

6. The method for constructing a radiation-resistant adenovirus vector according to claim 1, characterized in that: The host cells used are HEK293 cells.

7. A radiation-resistant adenovirus vector prepared by the construction method according to any one of claims 1 to 6, characterized in that: Contains radiation-resistant genes.

8. The radiation-resistant adenoviral vector according to claim 7, characterized in that The radiation-resistant adenoviral vector is capable of expressing a radiation-resistant protein.

9. The radiation-resistant adenoviral vector according to claim 7, characterized in that The radioresistant protein is immunogenic.

Images