Capture probe, detection probe, detection system and method for escherichia coli O157: H7

Abstract

The invention discloses a capture probe, a detection probe, a detection system and a detection method for escherichia coli O157: H7. The capture probe comprises a magnetic bead capture probe containing rich amino groups and a specific detection probe (nano V-MnO2 (at) ZIF-90 / Apt) with an escherichia coli O157: H7 aptamer, a detection system combining a capture probe and a detection probe is adopted to capture and recognize escherichia coli O157: H7 in a sample, a Fe3O4 (at) SiO2-NH2-bacteria-V-MnO2 (at) ZIF-90 / Apt compound is formed, reaction is started under specific conditions, a colorimetric signal value is determined according to absorbance at 417 nm, or a colorimetric card is adopted for colorimetry, or the temperature difference before and after 808 nm laser irradiation is adopted, quantitative analysis of escherichia coli O157: H7 is performed, and the detection result is accurate. The detection requirements of rapidity and field applicability are met, and the method has application value in the field of food safety detection.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and more specifically, the present invention relates to a capture probe, a detection probe and a detection system and method thereof for Escherichia coli O157:H7. Background Art

[0002] Food contamination caused by pathogens poses a great threat to human and animal health. Among the many foodborne pathogens, Staphylococcus aureus, Escherichia coli and Salmonella enterica are the most common. E. coli ) is a common bacterium in the human intestine and is the main cause of foodborne diarrhea. Its presence is often regarded as an indicator of environmental hygiene. Escherichia coli O157:H7 is one of the most dangerous foodborne pathogens. It is a highly pathogenic intestinal pathogen and produces Vero toxins that seriously threaten human health.

[0003] Accurate and rapid detection of E. coli O157:H7, as well as other sources of infection that can be transmitted through the food chain, is crucial for taking timely and appropriate countermeasures to prevent diseases and minimize economic losses caused by product recalls. Sea cucumber peptides have attracted much attention due to their safety, high biological activity, and strong specificity. In addition, sea cucumber peptides are expensive, and detecting whether E. coli O157:H7 exceeds the standard plays a key role in controlling their quality.

[0004] At present, the most commonly used methods for detecting E. coli are plate count and polymerase chain reaction (PCR). The plate count method is regarded as the standard technology for detecting bacteria, which has high sensitivity, good specificity and reliability. However, this method has a long detection cycle and cumbersome operation process, which cannot meet the needs of fast and convenient detection. The main disadvantage of PCR technology is that it is highly dependent on expensive reagents, complex and expensive and bulky equipment, requires delicate operation, professional and well-trained personnel and specific processing conditions. In summary, these existing methods still have great difficulties in meeting the requirements of on-site detection of E. coli O157:H7. Therefore, it is extremely necessary to develop a quantitative analysis method with high sensitivity, good selectivity and low cost. Summary of the invention

[0005] An object of the present invention is to address at least the above-mentioned disadvantages and to provide at least the advantages which will be described hereinafter.

[0006] The present invention provides a capture probe, a detection probe and a detection system and method for Escherichia coli O157:H7, aiming to solve the shortcomings of traditional detection methods in terms of accuracy, rapidity and field applicability. Through the technical solution of the present invention, it is expected to create the possibility of using a miniaturized, portable ultraviolet-visible spectrophotometer and / or a digital thermometer for field detection, which has important application value in food safety detection, especially in sea cucumber product quality monitoring, and provides new technical means and method support for ensuring food hygiene and safety.

[0007] The invention provides a detection probe for Escherichia coli O157:H7, whose chemical formula is nano V-MnO2@ZIF-90 / Apt.

[0008] Preferably, the detection probe for Escherichia coli O157:H7 is prepared by the following steps: Step 1, preparation of V-MnO2 nanozyme: dissolve KMnO4 and MnSO4·H2O in pure water to obtain a first solution; dissolve VOSO4·xH2O in pure water to prepare a VOSO4 solution, add the solution dropwise to the first solution with stirring, stir evenly, heat to react, wash the product with distilled water and ethanol, and dry to obtain V-MnO2 nanozyme; Step 2, preparation of V-MnO2@ZIF-90: add V-MnO2 solution to DMF solution of imidazole-2-carboxylic acid, disperse and stir, add DMF solution containing zinc acetate, and shake to react at room temperature; centrifuge the product to obtain V-MnO2@ZIF-90, wash with DMF and pure water, and dry to obtain V-MnO2@ZIF-90; Step 3, synthesis of V-MnO2@ZIF-90 / Apt: First, the Escherichia coli O157:H7 aptamer solution is mixed with 1-ethyl-(3-dimethylaminopropyl)carbodiimide solution and N-hydroxysuccinimide solution for reaction, and then V-MnO2@ZIF-90 is added to the reaction mixture and stirred; subsequently, the obtained nanoparticles are washed with PBS for multiple times and dispersed into a PBS solution to obtain V-MnO2@ZIF-90 / Apt; wherein the Escherichia coli O157:H7 aptamer is modified with an amino group at the 5' end of the aptamer nucleotide sequence, and the nucleotide sequence of the aptamer is shown in SEQ ID NO.1.

[0009] Preferably, in step 1, the mass volume ratio of KMnO4:MnSO4·H2O:pure water in the first solution is 1.25g:0.53g:60mL; the mass volume ratio of VOSO4·xH2O:pure water is 8.2mg:5mL; In step 2, the concentration of the V-MnO2 solution is 200 mg / mL, the concentration of the DMF solution of imidazole-2-carboxylic acid is 0.2 M, and the concentration of the DMF solution containing zinc acetate is 0.05 M; the volume ratio of the V-MnO2 solution: the DMF solution of imidazole-2-carboxylic acid: the DMF solution containing zinc acetate is 1 mL: 3 mL: 4 mL; In step three, the concentration of the Escherichia coli O157:H7 aptamer solution is 100 μM, the concentration of the 1-ethyl-(3-dimethylaminopropyl)carbodiimide solution is 5 mg / mL, the concentration of the N-hydroxysuccinimide solution is 5 mg / mL, and the concentration of the PBS solution is 0.01 M; the mass volume ratio of the Escherichia coli O157:H7 aptamer solution: 1-ethyl-(3-dimethylaminopropyl)carbodiimide solution: N-hydroxysuccinimide solution: V-MnO2@ZIF-90: PBS solution is 100 μL: 125 μL: 125 μL: 10 mg: 1 mL.

[0010] The present invention provides a capture probe for Escherichia coli O157:H7, which is used to enrich the above-mentioned detection probe for Escherichia coli O157:H7; the chemical formula of the capture probe is magnetic bead Fe3O4@SiO2-NH2.

[0011] Preferably, the capture probe for Escherichia coli O157:H7 is prepared by the following steps: Step 1: Disperse Fe3O4 in a mixture of ethanol and pure water, disperse by ultrasonic, then add ammonia water and tetraethoxysilane in sequence, react the mixture under continuous shaking, and then separate by magnetic attraction to obtain Fe3O4@SiO2; Step 2: Take Fe3O4@SiO2 and add it to a reaction system containing ethanol, water and ammonia water, disperse it ultrasonically, add 3-aminopropyltriethoxysilane, and react at room temperature; after the reaction is completed, separate the black solid by magnetic attraction with a magnet, and wash it with water several times to remove impurities to obtain Fe3O4@SiO2-NH2. Among them, the mass volume ratio of Fe3O4: ammonia water: tetraethoxysilane in step 1 is 1.0g: 10mL: 4mL, and the mixture is reacted at 60℃ for 6h; the mass volume ratio of Fe3O4@SiO2: ethanol: water: ammonia water: 3-aminopropyltriethoxysilane in step 2 is 0.5g: 80mL: 16mL: 4mL: 1mL.

[0012] The present invention provides a detection system for Escherichia coli O157:H7, which comprises the above-mentioned detection probe and the above-mentioned capture probe, wherein the content ratio of the capture probe to the detection probe in the detection system is 200-1000 μg / mL: 3.7-10 μL / mL.

[0013] Preferably, the content ratio of the capture probe to the detection probe in the detection system is 800 μg / mL:3.7 μL / mL.

[0014] The present invention provides a detection method for Escherichia coli O157:H7, which adopts the above-mentioned detection system, including: enriching Escherichia coli O157:H7 in a sample with the capture probe, adding the detection probe to form a Fe3O4@SiO2-NH2-bacteria-V-MnO2@ZIF-90 / Apt complex after magnetic enrichment, discarding the supernatant containing the remaining V-MnO2@ZIF-90 / Apt, adding a buffer and ABTS to start the reaction, the pH of the reaction is 2.0-5.5, the final concentration of ABTS is 0.2-1.0 mM, the reaction temperature is 32.5°C, the reaction is carried out for 30-50 minutes, and the colorimetric signal value is determined by the absorbance at 417 nm or a colorimetric card is used for colorimetry to perform quantitative analysis of Escherichia coli O157:H7; Alternatively, the reaction was allowed to proceed for 15 to 25 minutes, and the temperature difference before and after 808 nm laser irradiation was used to perform quantitative analysis of E. coli O157:H7.

[0015] Preferably, the method for detecting Escherichia coli O157:H7 comprises the following steps: Step 1: Disperse the sample to be tested in a PBS solution containing the capture probe, incubate at 32-37°C and 100-150 rpm for 10-15 min, perform magnetic enrichment separation for 2-3 min, and discard the supernatant; Step 2: Add the detection probe, add PBS with pH 7.4 to adjust the concentration of the detection probe in the system, incubate at 32-37° C. for 10-20 min, perform magnetic separation, and discard the supernatant; Step 3: Add enzyme colorimetric substrate ABTS and acetic acid-sodium acetate buffer solution, pH 2.5, ABTS final concentration is 0.8 mM, reaction temperature is 32.5°C, and after reacting for 40 minutes, measure the ultraviolet absorption spectrum of the reaction system, determine the colorimetric signal value with the absorbance at 417 nm or use a colorimetric card for colorimetric analysis of Escherichia coli O157:H7.

[0016] Preferably, the method for detecting Escherichia coli O157:H7 comprises the following steps: Step 1: Disperse the sample to be tested in a PBS solution containing the capture probe, incubate at 32-37°C and 100-150 rpm for 10-15 min, perform magnetic enrichment separation for 2-3 min, and discard the supernatant; Step 2: Add the detection probe, add PBS with pH 7.4 to adjust the concentration of the detection probe in the system, incubate at 32-37° C. for 10-20 min, perform magnetic separation, and discard the supernatant; Step 3: Add enzyme colorimetric substrate ABTS and acetic acid-sodium acetate buffer solution, pH 2.5, ABTS final concentration is 0.8 mM, reaction temperature is 32.5°C, after reacting for 20 minutes, measure the temperature difference before and after 808 nm laser irradiation, and perform quantitative analysis of Escherichia coli O157:H7.

[0017] The present invention has at least the following beneficial effects: First, the capture probe provided by the present invention can enrich Escherichia coli O157:H7 in nature through electrostatic action, especially Escherichia coli O157:H7 in sea cucumber polypeptide samples, providing an efficient sample pretreatment method for subsequent detection and improving the accuracy and reliability of detection.

[0018] Second, the detection probe prepared by the present invention can not only protect the activity of the nanozyme, but also realize the controllable release of the enzyme under specific conditions, thereby enhancing the detection signal. At the same time, it specifically binds Escherichia coli O157:H7 to it, thereby realizing the specific recognition and detection of the target bacteria.

[0019] Third, the detection system of the detection probe and capture probe provided by the present invention is amino-modified at the 5' end of the aptamer (Apt) nucleotide sequence, and the amino group of the aptamer (Apt) can bind to the carboxyl group on the surface of ZIF-90, thereby realizing specific recognition of target bacteria, and realizing controllable release of enzymes under specific conditions, realizing specific detection of target bacteria, and improving the sensitivity, linearity, linear range, specificity, stability, feasibility, reliability and accuracy of detection under the stable color development effect of the released V-MnO2 nanozyme. Through color development detection and / or temperature difference detection, the requirements of rapidity, accuracy and field applicability are met, and it has important application value in the fields of food safety detection and the like.

[0020] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the transmission electron microscope characterization image of MnO2; Figure 2 This is the transmission electron microscope characterization image of V-MnO2; Figure 3 Transmission electron microscopy characterization image of V-MnO2@ZIF-90; Figure 4 The Zeta potential comparison diagram of V-MnO2@ZIF-90 and V-MnO2@ZIF-90 / Apt; Figure 5This is the Fourier transform infrared spectrum of magnetic beads Fe3O4@SiO2-NH2; Figure 6 This is the Zeta potential diagram of the magnetic beads Fe3O4@SiO2-NH2 by Malvern particle size analyzer; Figure 7 is a schematic diagram of the oxidase-like activity provided by the present invention; Figure 8 It is a schematic diagram of the optimization of ABTS concentration provided by the present invention; Fig. 9 It is a schematic diagram of the optimization of pH provided by the present invention; Fig.10 It is a schematic diagram of the temperature optimization provided by the present invention; Fig.11 It is a schematic diagram of the optimization of time provided by the present invention; Fig.12 It is the standard curve in the actual colorimetric test process; Fig.13 This is the result of the specificity test of the sensor through colorimetry; Fig.14 This is the result of the stability test of the V-MnO2 nanozyme of this sensor by colorimetry; Fig.15 is the Fourier transform infrared spectra of V-MnO2@ZIF-90 and V-MnO2@ZIF-90 / Apt; Fig.16 It is a schematic diagram of the optimization of the irradiation power provided by the present invention; Fig.17 It is a schematic diagram of the optimization of the irradiation time provided by the present invention; Fig.18 It is the standard curve in the actual photothermal test process; Fig.19 This is the result of photothermal testing of the sensor's specific properties. DETAILED DESCRIPTION

[0022] The present invention is further described in detail below in conjunction with embodiments so that those skilled in the art can implement the invention with reference to the description.

[0023] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0024] Example 1 A detection probe for Escherichia coli O157:H7, whose chemical formula is nano V-MnO2@ZIF-90 / Apt.

[0025] It is prepared by the following steps: Step 1. Preparation of V-MnO2 nanozyme: Dissolve 1.25gKMnO4 and 0.53gMnSO4·H2O in 60mL pure water to obtain a first solution. Dissolve 8.2mgVOSO4·xH2O in 5mL pure water to prepare a VOSO4 solution, and add it dropwise to the first solution with stirring. After stirring for another 20 minutes to form a uniform solution, transfer it to a 100mL tetrafluoroethylene-lined stainless steel reactor, and then heat it at 140°C for 12h. Wash the product with distilled water and ethanol, and dry it at 60°C for 48h to obtain V-MnO2 nanozyme; Step 2, preparation of V-MnO2@ZIF-90: Add V-MnO2 solution (1mL, 200mg / mL) to DMF solution (3mL, 0.2M) of imidazole-2-carboxylic acid (2-ICA), and stir for 15min. Slowly add 4mL of DMF solution containing 0.05M zinc acetate (Zn(CH3COO)2). Shake the reaction at room temperature for 3h. The reaction product V-MnO2@ZIF-90 is obtained by centrifugation at 5000rpm for 5min, washed with DMF and pure water, and dried at 60℃ for 48h to obtain V-MnO2@ZIF-90; wherein, V-MnO2 solution is a suspension dispersed in pure water, and it can be shaken and absorbed each time it is used; Step 3, V-MnO2@ZIF-90 / Apt synthesis: First, 100 μL of Escherichia coli O157:H7 aptamer solution (100 μM) was mixed with 125 μL of 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDC) solution (5 mg / mL) and 125 μL of N-hydroxysuccinimide (NHS) solution (5 mg / mL) for 20 min. 10 mg of V-MnO2@ZIF-90 was added to the reaction mixture and stirred for 15 h. Subsequently, the obtained nanoparticles were washed 3 times with PBS (0.01 M, pH = 7.4) and dispersed in 1 mL of PBS solution to obtain V-MnO2@ZIF-90 / Apt; wherein the Escherichia coli O157:H7 aptamer is modified with an amino group at the 5' end of the aptamer nucleotide sequence, and the nucleotide sequence of the aptamer is shown in SEQ ID NO.1 as follows: GCAATGGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA.

[0026] The sequence of the Escherichia coli O157:H7 aptamer modified with an amino group at the 5' end of the aptamer nucleotide sequence is shown below: Sequence (from 5'-3'): 5'-NH2-GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA, wherein NH2- is a modification group connected to the 5' end.

[0027] The prepared nanozymes were characterized by transmission electron microscopy (TEM). Figure 1 Transmission electron microscopy characterization of MnO2 is shown. Figure 2 Transmission electron microscopy characterization of V-MnO2 is shown. Figure 3 Transmission electron microscopy characterization of V-MnO2@ZIF-90 is shown. Figure 4 The Zeta potential of V-MnO2@ZIF-90 and the Zeta potential of V-MnO2@ZIF-90 / Apt are compared, and V-MnO2@ZIF-90 / Apt is characterized by Zeta potential. The Zeta potential of V-MnO2@ZIF-90 is -21.5mV, and after the E. coli aptamer is connected to V-MnO2@ZIF-90, the potential is -24.1mV. The change in Zeta potential verifies that the V-MnO2@ZIF-90 / Apt detection probe is successfully prepared. Fig.15 The Fourier transform infrared spectra of V-MnO2@ZIF-90 and V-MnO2@ZIF-90 / Apt are shown. The Fourier transform infrared spectra show that V-MnO2@ZIF-90 / Apt has a -1 There is a characteristic peak at , which is the stretching vibration peak of the phosphate group on the nucleic acid aptamer. V-MnO2@ZIF-90 does not have this peak at this wavenumber, indicating that the nucleic acid aptamer is successfully modified on V-MnO2@ZIF-90.

[0028] Example 2 A capture probe for enriching Escherichia coli O157:H7 for the above-mentioned detection probe; the chemical formula of the capture probe is magnetic bead Fe3O4@SiO2-NH2.

[0029] It is prepared by the following steps: Fe3O4 (1.0 g) was dispersed in a mixture of 150 mL ethanol and 30 mL pure water, ultrasonically treated for 15 min, and then 10 mL ammonia and 4 mL tetraethoxysilane (TEOS) were added in sequence. The mixture was reacted at 60 ° C for 6 h under continuous shaking. Fe3O4@SiO2 was obtained by magnetic separation. 0.5 g of Fe3O4@SiO2 was added to a reaction system containing 80 mL ethanol, 16 mL water and 4 mL ammonia. Ultrasonication was performed for 15 min to disperse it, and 1 mL 3-aminopropyltriethoxysilane (APTES) was added. The reaction was carried out at room temperature for 12 h. After the reaction, a black solid was obtained by magnetic separation, and Fe3O4@SiO2-NH2 was obtained after washing with water 3 times to remove impurities.

[0030] The magnetic beads Fe3O4@SiO2-NH2 were characterized by Fourier transform infrared spectrometer and Malvern particle size analyzer potential. Figure 5 and 6 shown.

[0031] Example 3 A detection system for Escherichia coli O157:H7 comprises the above-mentioned detection probe and capture probe, wherein the content ratio of the capture probe to the detection probe in the detection system is 200-1000 μg / mL: 3.7-10 μL / mL.

[0032] Preferably, the content ratio of the capture probe to the detection probe in the detection system is 800 μg / mL:3.7 μL / mL.

[0033] Example 4 A detection method for Escherichia coli O157:H7, which uses the detection system of Example 3, including: enriching Escherichia coli O157:H7 in a sample with a capture probe, adding a detection probe to form a Fe3O4@SiO2-NH2-bacteria-V-MnO2@ZIF-90 / Apt complex after magnetic enrichment, discarding the supernatant containing the remaining V-MnO2@ZIF-90 / Apt, adding a buffer and ABTS to start the reaction, the pH of the reaction is 2.0-5.5, the final concentration of ABTS is 0.2-1.0mM, the reaction temperature is 32.5°C, the reaction is 30-50min, and the colorimetric signal value is determined by the absorbance at 417nm or a colorimetric card is used for colorimetry. The specific steps include the following: Step 1: Disperse the sample to be tested in a 1 mL PBS solution containing 800 μg of magnetic beads, incubate at 37°C, 120 rpm for 15 min, perform magnetic enrichment separation for 3 min, and discard the supernatant; Step 2: Add 3.7 μL V-MnO2@ZIF-90 / Apt, add PBS (0.01 M, pH 7.4) to make up the solution to 1 mL, incubate for 20 min, perform magnetic separation, discard the supernatant, and transfer the remaining solution to a 10 mL centrifuge tube; Step 3. Add the enzyme colorimetric substrate ABTS (0.8 mM) and acetic acid-sodium acetate buffer solution (pH 2.5), make up the solution to 5 mL, the final ABTS concentration is 0.8 mM, the reaction temperature is 32.5°C, and after reacting for 40 minutes, measure the UV absorption spectrum of the reaction system (measured by UV-visible spectrophotometer). Determine the colorimetric signal value with the absorbance at 417 nm or use a colorimetric card for colorimetric analysis of Escherichia coli O157:H7.

[0034] Example 5 A detection method for Escherichia coli O157:H7, which uses the detection system of Example 3, including: enriching Escherichia coli O157:H7 in a sample with a capture probe, adding a detection probe to form a Fe3O4@SiO2-NH2-bacteria-V-MnO2@ZIF-90 / Apt complex after magnetic enrichment, discarding the supernatant containing the remaining V-MnO2@ZIF-90 / Apt, adding a buffer and ABTS to start the reaction, the pH of the reaction is 2.0-5.5, the final concentration of ABTS is 0.2-1.0 mM, the reaction temperature is 32.5°C, the reverse reaction is 15-25 minutes, and the temperature difference before and after 808nm laser irradiation is used to perform quantitative analysis of Escherichia coli O157:H7. The specific steps include the following: Step 1: Disperse the sample to be tested in a 1 mL PBS solution containing 800 μg of magnetic beads, incubate at 37°C, 120 rpm for 15 min, perform magnetic enrichment separation for 3 min, and discard the supernatant; Step 2: Add 3.7 μL V-MnO2@ZIF-90-Apt, add PBS (0.01 M, pH 7.4) to make up the solution to 1 mL, incubate for 20 min, perform magnetic separation, discard the supernatant, and transfer the remaining solution to a 10 mL centrifuge tube; Step 3: Add enzyme colorimetric substrate ABTS and acetic acid-sodium acetate buffer solution (pH 2.5), make up the solution to 5 mL, the final ABTS concentration is 0.8 mM, the reaction temperature is 32.5 ° C, after reacting for 20 minutes, take 1 mL of the reaction solution into a 2 mL centrifuge tube, fix the centrifuge tube in an appropriate position (fixed upright, the laser can irradiate the center of the solution from above), and make the liquid surface 3 cm away from the end of the laser. Use a near-infrared thermal imager to measure the solution temperature at this time. This temperature is used as the initial temperature before irradiation, recorded as T before irradiation; the power used is 2 W / cm 2, a laser with a wavelength of 808nm, turn on the laser, make the beam vertically irradiate the center of the reaction solution, and start timing for 120s. After the irradiation is over, read the temperature immediately, and record the maximum temperature reading as the temperature after irradiation Tafter irradiation; use the relative value of the temperature difference before and after laser irradiation as the response signal, recorded as ΔT (ΔT=Tafter irradiation-Tbefore irradiation). Measure the temperature difference before and after 808nm laser irradiation to perform quantitative analysis of E. coli O157:H7.

[0035] Test 1 The oxidase activity assay was performed as follows: Common enzyme substrates TMB, ABTS, and OPD were used as the colorimetric substrates of the reaction system. 100 µL of enzyme substrates (0.5 mM TMB, 0.5 mM ABTS or 1.0 mM OPD) and 100 µL of nanoenzyme solution (V-MnO2, 1.0 mg / mL) were added to an acetic acid-sodium acetate buffer solution (0.2 M, pH 4.5) in sequence. The final volume of the mixed solution was 5 mL. The mixture was incubated at room temperature for 30 min and the absorption spectrum was measured using a UV-visible spectrophotometer. The measurement results are shown in Figure 2. Figure 7 As shown, the preferred enzyme substrate is ABTS.

[0036] Test 2 The ABTS concentration was optimized as follows: 100 µL of DMSO solution of ABTS of different concentrations (final concentrations 0.2 mM, 0.4 mM, 0.6 mM, 0.8 mM, 1.0 mM, 1.2 mM) and 25 µL of nanozyme solution (V-MnO2@ZIF-90, 1 mg / mL) were added to acetic acid-sodium acetate buffer solution (0.2 M, pH 4.5). The final volume of the mixed solution was 5 mL. The mixture was incubated at room temperature for 30 min and the absorption spectrum was measured by UV-visible spectrophotometer. The measurement results are shown in Figure 2. Figure 8 As indicated, the final concentration of the preferential enzyme substrate ABTS was 0.8 mM.

[0037] Test 3 The pH was optimized as follows: 40 µL of LABTS (final concentration 0.8 mM) and 25 µL of nanozyme solution (V-MnO2@ZIF-90, 1 mg / mL) were added to acetic acid-sodium acetate buffer solutions of different pH values ​​(pH 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0). The final volume of the mixed solution was 5 mL. The mixture was incubated at room temperature for 30 min and the absorption spectrum was measured using a UV-visible spectrophotometer. The measurement results are shown in Figure 2. Fig. 9 As shown, pH 2.5 is preferred.

[0038] Test 4 The reaction temperature was optimized as follows: 40 µL of LABTS (final concentration 0.8 mM) and 25 µL of V-MnO2@ZIF-90 solution (1.5 mg / mL) were added to an acetic acid-sodium acetate buffer solution (0.2 M, pH 2.5). The final volume of the mixed solution was 5 mL. The mixture was incubated at 25°C, 27.5°C, 30°C, 32.5°C, 35°C, 37.5°C, and 40°C for 30 min. The absorbance was measured using a UV-visible spectrophotometer. The measurement results are shown in Figure 2. Fig.10 As shown, the optimal temperature is 32.5°C.

[0039] Test 5 The reaction time is optimized as follows: 40 µL ABTS (final concentration 0.8 mM) and 25 µL nanozyme solution (V-MnO2@ZIF-90, 1.5 mg / mL) were added to the acetic acid-sodium acetate buffer solution (0.2 M, pH 2.5). The final volume of the mixed solution was 5 mL. The mixture was incubated at room temperature for 5 min, 10 min, 20 min, 30 min, 40 min, 50 min, and 60 min, respectively. The absorption spectrum was measured with a UV-visible spectrophotometer. The measurement results are shown in Figure 2. Fig.11 As shown, the optimal time is 40 minutes.

[0040] Test 6 The detection method of the present invention was established to investigate and measure actual samples, and the operation was carried out according to the following steps: The reliability of the method established in this experiment was investigated by using traditional methodological investigations including linearity, linear range, detection limit, specificity, and stability. Escherichia coli of different concentrations were dispersed in a total volume of 1 mL PBS solution containing 800 μg magnetic beads, incubated at 37°C and 120 rpm for 15 minutes, magnetic enrichment and separation for 3 minutes, the supernatant was discarded, 3.7 μL V-MnO2@ZIF-90-Apt was added, PBS was added to make the solution up to 1 mL, incubated at 37°C for 20 minutes, magnetic separation was performed, the supernatant was discarded, the remaining solution was transferred to a 10 mL centrifuge tube, the enzyme color substrate ABTS (0.8 mM) and acetic acid-sodium acetate buffer solution were added, the solution was made up to 5 mL, the pH was adjusted to 2.5, the final concentration of ABTS was 0.8 mM, the reaction temperature was 32.5°C, and the ultraviolet absorption spectrum of the reaction system was measured after 40 minutes of reaction.

[0041] In the sea cucumber peptide samples, as E. coli O157:H7 increased from 1×10 1 Increase to 1×10 7 CFU / mL, the absorbance difference gradually increased. Thus, the linear equation of this method was obtained, which was the regression equation Y=0.42+0.1511X(R 2 =0.9857), such as Fig.12The results showed that this method has good linearity in detecting E. coli O157:H7, and its linear range is 1×10 1 -1×10 7 CFU / mL. The detection limit is 10 CFU / mL.

[0042] Test 7 In order to demonstrate the specificity of the detection method of the present invention for E. coli O157:H7, four non-target bacteria, namely Staphylococcus aureus, Pseudomonas aeruginosa, E. coli, and Bacillus subtilis, were detected in the same manner (colorimetric detection method of Example 4 of the present invention). There was no significant difference between the non-target bacteria, while E. coli O157:H7 or a mixture (including E. coli O157:H7 alone and other non-target bacteria) showed a strong colorimetric signal, as shown in FIG. Fig.13 These results indicate that the specificity of the method designed for E. coli O157:H7 is ensured by the aptamer modified on the surface of the detection probe, and the aptamer sensor has the specificity to detect E. coli O157:H7.

[0043] Test 8 The stability of the detection method of the present invention was evaluated. The colorimetric signals obtained from three batches of nanozyme detection probes prepared at different times showed no significant difference, and the relative standard deviation (RSD) was 6.28%. Fig.14 As shown, it indicates good stability.

[0044] Test 9 In order to further verify the practicality and reliability of the detection method of the present invention in actual food samples, an addition and recovery experiment was conducted, and the detection method of the present invention was used to detect Escherichia coli O157:H7 in spiked sea cucumber polypeptide samples. Escherichia coli O157:H7 was added to the supernatant of the homogenized food sample to obtain spiked food samples with different bacterial concentrations, and the samples were tested according to the detection method of the present invention. The recovery rate was calculated based on the test results, and the recovery rate was between 93% and 96%, successfully demonstrating the feasibility, reliability and accuracy of detecting Escherichia coli O157:H7 in sea cucumber polypeptide samples.

[0045] (The recovery rate is calculated by using the standard addition method to add a known concentration of the test substance to the actual sample, then using the method of the present invention to detect it, and dividing the calculated concentration by the known concentration added to obtain the recovery rate.) Test 10 40 µL ABTS (final concentration 0.8 mM) and 25 µL nanozyme solution (V-MnO2@ZIF-90, 1.5 mg / mL) were added to acetic acid-sodium acetate buffer solution (0.2 M, pH 2.5) to a final volume of 5 mL. The mixture was incubated at room temperature for 20 min, and 1 mL was taken and lysed using different powers (0.5, 1, and 2 W / cm 2 ) laser irradiation, measuring the temperature difference as Fig.16 As shown, the preferred power is 2W / cm 2 .

[0046] Test 11 40 µL ABTS (final concentration 0.8 mM) and 25 µL nanozyme solution (V-MnO2@ZIF-90, 1.5 mg / mL) were added to acetic acid-sodium acetate buffer solution (0.2 M, pH 2.5). The final volume of the mixed solution was 5 mL. The mixture was incubated at room temperature for 20 min. 1 mL was taken and used at 2 W / cm 2 The laser was irradiated for 60s, 120s, 180s, 240s, and 300s, and the temperature difference was measured. Fig.17 As shown, the preferred irradiation time is 120s.

[0047] Test 12 The detection method of the present invention was established to investigate and measure actual samples, and the operation was carried out according to the following steps: The reliability of the method established in this experiment was investigated by using traditional methodological investigations including linearity, linear range, detection limit, specificity, and stability. Escherichia coli of different concentrations were dispersed in a total volume of 1 mL PBS solution containing 800 μg magnetic beads, incubated at 37°C and 120 rpm for 15 minutes, magnetic enrichment and separation for 3 minutes, the supernatant was discarded, 3.7 μL V-MnO2@ZIF-90-Apt was added, PBS was added to make the solution up to 1 mL, incubated at 37°C for 20 minutes, magnetic separation was performed, the supernatant was discarded, the remaining solution was transferred to a 10 mL centrifuge tube, the enzyme color substrate ABTS and acetic acid-sodium acetate buffer solution (pH 2.5) were added, the final concentration of ABTS was 0.8 mM, the reaction temperature was 32.5°C, and after 20 minutes of reaction, 1 mL of the reaction solution was taken into a 2 mL centrifuge tube, and the centrifuge tube was fixed in an appropriate position (vertically fixed, the laser can irradiate the center of the solution from above), so that the liquid surface is 3 cm away from the end of the laser. The solution temperature at this time was measured using a near-infrared thermal imager. This temperature was taken as the initial temperature before irradiation and recorded as T before irradiation. The power used was 2 W / cm 2, a laser with a wavelength of 808nm, turn on the laser, make the beam vertically irradiate the center of the reaction solution, and start timing for 120s. After the irradiation is over, read the temperature immediately, and record the maximum temperature reading as the temperature after irradiation Tafter irradiation; use the relative value of the temperature difference before and after laser irradiation as the response signal, recorded as ΔT (ΔT=Tafter irradiation-Tbefore irradiation).

[0048] In the sea cucumber peptide samples, as E. coli O157:H7 increased from 1×10 1 Increase to 1×10 7 CFU / mL, the temperature difference gradually increases. Thus, the linear equation of this method is obtained, which is the regression equation Y=1.684X+9.764(R 2 =0.9959), such as Fig.18 The results showed that this method has good linearity in detecting E. coli O157:H7, and its linear range is 1×10 1 -1×10 7 CFU / mL. The detection limit is 10 CFU / mL.

[0049] Test 13 In order to demonstrate the specificity of the detection method of the present invention for E. coli O157:H7, four non-target bacteria, namely Staphylococcus aureus, Pseudomonas aeruginosa, E. coli, and Bacillus subtilis, were detected in the same manner (detection method of Example 5 of the present invention). There was no significant difference between the non-target bacteria, while E. coli O157:H7 or a mixture (including E. coli O157:H7 alone and other non-target bacteria) showed a strong temperature difference signal, such as Fig.19 As shown, it has the detection specificity for Escherichia coli O157:H7.

[0050] Test 14 In order to further verify the practicality and reliability of the detection method of the present invention (the detection method of Example 5 of the present invention) in actual food samples, an addition and recovery experiment was carried out, and the Escherichia coli O157:H7 in the spiked sea cucumber polypeptide sample was detected using the detection method of the present invention. Escherichia coli O157:H7 was added to the supernatant of the homogenized food sample to obtain spiked food samples with different bacterial concentrations, and the samples were detected according to the detection method of the present invention. The recovery rate was calculated based on the test results, and the recovery rate was between 87% and 112%, which successfully demonstrated the feasibility, reliability and accuracy of detecting Escherichia coli O157:H7 in sea cucumber polypeptide samples.

[0051] (The recovery rate is calculated by using the standard addition method to add a known concentration of the test substance to the actual sample, then using the method of the present invention to detect it, and dividing the calculated concentration by the known concentration added to obtain the recovery rate.) The colorimetric detection and photothermal detection based on the detection system of the present invention both show good linear relationships when detecting Escherichia coli O157:H7 in sea cucumber polypeptide samples. The linear equation of colorimetric detection is, Y=0.42+0.1511X(R 2 =0.9857) The linear equation of photothermal detection is Y=1.684X+9.764 (R 2 =0.9959), and the linear range is 1×10 1 -1×10 7 CFU / mL. This enables accurate quantitative analysis of E. coli O157:H7 through the corresponding signal (absorbance difference or temperature difference) within this concentration range, providing a reliable quantitative basis for actual detection. And the detection limit of both methods is 10CFU / mL, which is low, indicating that both methods have high sensitivity and can detect low concentrations of E. coli O157:H7 in sea cucumber polypeptide samples, which helps to timely discover potential food safety hazards. In the specific detection of E. coli O157:H7, both methods used 4 non-target bacteria (Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Bacillus subtilis) as controls. The results showed that there was no significant difference between non-target bacteria, while E. coli O157:H7 or its mixture with non-target bacteria could produce strong specific signals (colorimetric signals or temperature difference signals), indicating that the two detection methods are highly specific for E. coli O157:H7, can accurately identify target bacteria in complex sample environments, and effectively avoid false detection. The feasibility, reliability and accuracy of the two detection methods in the detection of actual food samples were verified by performing spike recovery experiments in sea cucumber polypeptide samples. The colorimetric detection recovery rate was between 93% and 96%, and the photothermal detection recovery rate was between 87% and 112%. Both methods can accurately detect the added E. coli O157:H7, indicating that the two methods have practical value in actual food detection scenarios.

[0052] The colorimetric detection and photothermal detection of the detection system of the present invention use different detection principles, but obtain similar results in multiple key performance indicators, such as linear range, detection limit, specificity and reliability in practical applications. These two methods confirm each other, making the conclusion that "the detection method has good detection performance for E. coli O157:H7" more convincing, reducing the impact of possible errors or limitations of a single method on the conclusion, and further improving the comprehensiveness and effectiveness of the detection.

[0053] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and the embodiments. They can be applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily realized.

Claims

1. A detection probe for Escherichia coli O157:H7, characterized in that: The chemical formula of the detection probe is nano V-MnO2@ZIF-90 / Apt.

2. The detection probe for Escherichia coli O157:H7 according to claim 1, characterized in that: The method comprises the following steps: Step 1, preparation of V-MnO2 nanozyme: dissolve KMnO4 and MnSO4·H2O in pure water to obtain a first solution; dissolve VOSO4·xH2O in pure water to prepare a VOSO4 solution, add the solution dropwise to the first solution with stirring, stir evenly, heat to react, wash the product with distilled water and ethanol, and dry to obtain V-MnO2 nanozyme; Step 2, preparation of V-MnO2@ZIF-90: add V-MnO2 solution to DMF solution of imidazole-2-carboxylic acid, disperse and stir, add DMF solution containing zinc acetate, and shake to react at room temperature; centrifuge the product to obtain V-MnO2@ZIF-90, wash with DMF and pure water, and dry to obtain V-MnO2@ZIF-90; Step 3, V-MnO2@ZIF-90 / Apt synthesis: First, the E. coli O157:H7 aptamer solution was mixed with 1-ethyl-(3-dimethylaminopropyl)carbodiimide solution and N-hydroxysuccinimide solution for reaction, and then V-MnO2@ZIF-90 was added to the reaction mixture and stirred; Subsequently, the obtained nanoparticles were washed with PBS for multiple times and dispersed in a PBS solution to obtain V-MnO2@ZIF-90 / Apt; wherein the Escherichia coli O157:H7 aptamer is modified with an amino group at the 5' end of the aptamer nucleotide sequence, and the nucleotide sequence of the aptamer is shown in SEQ ID NO.

1.

3. The detection probe for Escherichia coli O157:H7 according to claim 2, characterized in that: In step 1, the mass volume ratio of KMnO4:MnSO4·H2O:pure water in the first solution is 1.25 g:0.53 g:60 mL; the mass volume ratio of VOSO4·xH2O:pure water is 8.2 mg:5 mL; In step 2, the concentration of the V-MnO2 solution is 200 mg / mL, the concentration of the DMF solution of imidazole-2-carboxylic acid is 0.2 M, and the concentration of the DMF solution containing zinc acetate is 0.05 M; the volume ratio of the V-MnO2 solution: the DMF solution of imidazole-2-carboxylic acid: the DMF solution containing zinc acetate is 1 mL: 3 mL: 4 mL; In step three, the concentration of the Escherichia coli O157:H7 aptamer solution is 100 μM, the concentration of the 1-ethyl-(3-dimethylaminopropyl)carbodiimide solution is 5 mg / mL, the concentration of the N-hydroxysuccinimide solution is 5 mg / mL, and the concentration of the PBS solution is 0.01 M; the mass volume ratio of the Escherichia coli O157:H7 aptamer solution: 1-ethyl-(3-dimethylaminopropyl)carbodiimide solution: N-hydroxysuccinimide solution: V-MnO2@ZIF-90: PBS solution is 100 μL: 125 μL: 125 μL: 10 mg: 1 mL.

4. A capture probe for Escherichia coli O157:H7, characterized in that The capture probe is used to enrich Escherichia coli O157:H7 for the detection probe of claim 1; the chemical formula of the capture probe is magnetic bead Fe3O4@SiO2-NH2.

5. The capture probe for Escherichia coli O157:H7 according to claim 4, characterized in that The method comprises the following steps: Step 1: Disperse Fe3O4 in a mixture of ethanol and pure water, disperse by ultrasonic, then add ammonia water and tetraethoxysilane in sequence, react the mixture under continuous shaking, and then separate by magnetic attraction to obtain Fe3O4@SiO2; Step 2: Take Fe3O4@SiO2 and add it to a reaction system containing ethanol, water and ammonia water, disperse it by ultrasonic, add 3-aminopropyltriethoxysilane, and react at room temperature; after the reaction, separate it by magnetic attraction with a magnet to obtain a black solid, and wash it with water several times to remove impurities to obtain Fe3O4@SiO2-NH2.

6. A detection system for Escherichia coli O157:H7, characterized in that: The method comprises the detection probe of claim 1 and the capture probe of claim 2, wherein the content ratio of the capture probe to the detection probe in the detection system is 200-1000 μg / mL: 3.7-10 μL / mL.

7. The detection system for Escherichia coli O157:H7 according to claim 6, characterized in that: The content ratio of the capture probe and the detection probe in the detection system is 800 μg / mL:3.7 μL / mL.

8. A method for detecting Escherichia coli O157:H7, characterized in that: The detection system as described in claim 6 includes: enriching Escherichia coli O157:H7 in the sample with the capture probe, adding the detection probe after magnetic enrichment to form a Fe3O4@SiO2-NH2-bacteria-V-MnO2@ZIF-90 / Apt complex, discarding the supernatant containing residual V-MnO2@ZIF-90 / Apt, adding buffer and ABTS to start the reaction, the pH of the reaction is 2.0~5.5, the final concentration of ABTS is 0.2~1.0mM, the reaction temperature is 32.5℃, the reaction time is 30~50min, the colorimetric signal value is determined by the absorbance at 417nm or a colorimetric card is used for colorimetric analysis of Escherichia coli O157:H7; or the reaction time is 15~25min, and the temperature difference before and after 808nm laser irradiation is used for quantitative analysis of Escherichia coli O157:H7.

9. The method for detecting Escherichia coli O157:H7 according to claim 8, characterized in that: The steps include: Step 1: Disperse the sample to be tested in a PBS solution containing the capture probe, incubate at 32-37°C and 100-150 rpm for 10-15 min, perform magnetic enrichment separation for 2-3 min, and discard the supernatant; Step 2: Add the detection probe, add PBS with pH 7.4 to adjust the concentration of the detection probe in the system, incubate at 32-37° C. for 10-20 min, perform magnetic separation, and discard the supernatant; Step 3: Add enzyme colorimetric substrate ABTS and acetic acid-sodium acetate buffer solution, pH 2.5, ABTS final concentration is 0.8 mM, reaction temperature is 32.5°C, and after reacting for 40 minutes, measure the ultraviolet absorption spectrum of the reaction system, determine the colorimetric signal value with the absorbance at 417 nm or use a colorimetric card for colorimetric analysis of Escherichia coli O157:H7.

10. The method for detecting Escherichia coli O157:H7 according to claim 8, characterized in that: The steps include: Step 1: Disperse the sample to be tested in a PBS solution containing the capture probe, incubate at 32-37°C and 100-150 rpm for 10-15 min, perform magnetic enrichment separation for 2-3 min, and discard the supernatant; Step 2: Add the detection probe, add PBS with pH 7.4 to adjust the concentration of the detection probe in the system, incubate at 32-37° C. for 10-20 min, perform magnetic separation, and discard the supernatant; Step 3: Add enzyme colorimetric substrate ABTS and acetic acid-sodium acetate buffer solution, pH 2.5, ABTS final concentration is 0.8 mM, reaction temperature is 32.5°C, after reacting for 20 minutes, measure the temperature difference before and after 808 nm laser irradiation, and perform quantitative analysis of Escherichia coli O157:H7.

Images