Engineered mitochondrial vaccine as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to an anti-fibrosis engineered mitochondrial vaccine as well as a preparation method and application thereof. In order to develop more drugs for preventing and treating fibrosis diseases, mitochondria is used as a fibrosis antigen delivery system to prepare an engineered mitochondrial vaccine targeting fibrosis-related antigens. According to the invention, WT1 is used as a model antigen, a stable expression cell strain for overexpressing WT1 on mitochondria is constructed, and transgenic mitochondria (Mito-WT1) in the cell strain is extracted and used for evaluating the efficacy of the cell strain as a pulmonary fibrosis vaccine. Animal experiments find that the Mito-WT1 vaccine has a treatment effect on bleomycin-induced mouse pulmonary fibrosis models during subcutaneous immunity and intranasal immunity, and the Mito-WT1 vaccine has a prevention effect on mouse pulmonary fibrosis during intranasal immunity and has good safety in vivo. Therefore, the engineered mitochondrial vaccine is expected to become a new hope for inhibiting fibrosis.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an anti-fibrosis engineered mitochondrial vaccine and a preparation method and application thereof. Background Art

[0002] Fibrosis affects approximately one-quarter of the world's population and is a common final pathological stage of many diseases. Pulmonary fibrosis, especially idiopathic pulmonary fibrosis (IPF), is the terminal manifestation of interstitial lung disease, characterized by fibroblast proliferation and massive deposition of extracellular matrix, which ultimately leads to destruction of lung tissue structure. The five-year survival rate of patients diagnosed with IPF is less than 30%, which is much lower than that of most types of cancer, and the median survival after acute exacerbation is only 2.2 months. Currently, the IPF treatment drugs approved by the US Food and Drug Administration, pirfenidone and nintedanib, can alleviate the progression of the disease and slow the decline of lung function to a certain extent, but these drugs still cannot achieve a complete cure for IPF. Therefore, there is an urgent need to develop new treatment strategies to effectively prevent and reverse the progression of pulmonary fibrosis.

[0003] The occurrence and development of pulmonary fibrosis involves the interaction of multiple cell types, secretory factors, and complex signaling pathways. How to accurately locate and effectively intervene in these key targets remains a major challenge in current research. In recent years, with the in-depth exploration of the pathological mechanism of pulmonary fibrosis, researchers have gradually revealed a variety of potential therapeutic targets. Among them, the abnormal activation of transcription factors is believed to play a key driving role in the early stages of pulmonary fibrosis. Specifically, in the mesenchymal cells of the subpleural area, multiple transcription factors such as snail family zinc finger protein 1 (Snail1), snail family zinc finger protein 2 (Snail2), kink family bHLH transcription factors, immediate early genes c-Jun and c-Fos were found to be significantly activated. These transcription factors promote the proliferation of fibroblasts and the deposition of extracellular matrix by regulating gene expression, thereby promoting the progression of the fibrosis process.

[0004] Vaccines can prevent diseases or reverse pathological processes by activating the immune system. As an important energy metabolism and signal transduction center in cells, mitochondria have unique biological characteristics that provide new ideas for vaccine development. According to the endosymbiotic theory, mitochondria have the characteristics of prokaryotes and are rich in cardiolipin, mitochondrial DNA (containing rich CpG repeat sequences), and mitochondrial damage-related molecular patterns. These components make mitochondria natural agonists of multiple Toll-like receptors, which can effectively activate the body's immune response. However, there are few reports on the use of mitochondria as a fibrosis antigen delivery system to prepare engineered mitochondrial vaccines targeting fibrosis-related antigens for the prevention and treatment of fibrosis. Summary of the invention

[0005] In order to develop more drugs for preventing and treating fibrotic diseases, the present invention uses mitochondria as a fibrosis antigen delivery system to prepare engineered mitochondrial vaccines targeting fibrosis-related antigens to enhance their immune activation ability while ensuring their antigen specificity and safety.

[0006] In order to achieve the above application purpose, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides an engineered mitochondrial vaccine comprising transgenic mitochondria directed to express fibrosis-related antigens.

[0008] Wherein, the fibrosis includes at least one of pulmonary fibrosis, liver fibrosis, pancreatic fibrosis, kidney fibrosis, cardiac fibrosis, endometrial fibrosis, eye fibrosis, splenic fibroproliferative disease, myelofibrosis or skin fibrosis.

[0009] Preferably, the pulmonary fibrosis comprises at least one of idiopathic pulmonary fibrosis (IPF), secondary pulmonary fibrosis, hereditary pulmonary fibrosis or interstitial lung disease with features of pulmonary fibrosis.

[0010] Among them, the fibrosis-related antigen is a pulmonary fibrosis-related antigen, which is selected from at least one of Wilms tumor 1 (WT1), snail family zinc finger protein 1 (Snail1), snail family zinc finger protein 2 (Snail2), kink family bHLH transcription factor, immediate early gene c-Jun or c-Fos.

[0011] Preferably, the pulmonary fibrosis antigen is WT1.

[0012] More preferably, the nucleotide sequence of WT1 is as shown in SEQ ID NO.1.

[0013] Wherein, the transgenic mitochondria are mitochondria expressing WT1, and the entire expression plasmid nucleotide sequence thereof is shown as SEQ ID NO. 2. Preferably, the target gene of the engineered mitochondrial vaccine is shown as SEQ ID NO.4.

[0014] Among them, the engineered mitochondrial vaccine uses mitochondria as a fibrosis antigen delivery system. The antigen delivery system is a plasmid and lentiviral transfection system with ornithine carbamoyltransferase (OTC) as the leading sequence, and a mitochondrial-targeted fibrosis-related antigen expression platform is established.

[0015] Preferably, the leading sequence OTC is shown as SEQ ID NO.3.

[0016] In a second aspect, the present invention also provides a method for preparing the above-mentioned mitochondrial vaccine, comprising the following steps:

[0017] A recombinant plasmid containing fibrosis-related antigens is constructed, packaged into lentivirus, and then cells are infected with the lentivirus system to screen out stable strains that stably express fibrosis-related antigens in mitochondria. Mitochondria of the stable strains are then extracted to obtain transgenic mitochondria that directionally express fibrosis-related antigens.

[0018] Among them, in the above method, the recombinant plasmid is prepared by synthesizing and connecting OTC with the template antigen using OTC as the mitochondrial localization peptide and the fibrosis-related antigen as the template antigen.

[0019] Preferably, the nucleotide sequence of the recombinant plasmid is as shown in SEQ ID NO.2; more preferably, the recombinant plasmid contains a nucleotide sequence consisting of OTC and a template antigen, as shown in SEQ ID NO.4.

[0020] Wherein, in the above method, the plasmid is selected from at least one of a mammalian cell expression vector, an insect baculovirus expression vector, an Escherichia coli expression vector, and a yeast expression vector.

[0021] Preferably, the plasmid is selected from any one of pLV-puro, pCDH-CMV, pCDH-EF1, pCDH-MSCV, and pCDH-RFP vectors.

[0022] More preferably, the method for preparing the mitochondrial vaccine comprises the following steps:

[0023] Using OTC as the mitochondrial localization peptide, OTC and the target gene WT1 were synthesized and connected on the pLV-puro vector to construct a recombinant plasmid, and then the recombinant plasmid was mixed with the auxiliary plasmid, and the lentiviral vector was packaged in HEK293T cells. The culture supernatant was collected, the lentivirus was concentrated by ultrahigh-speed centrifugation, and the lentivirus was used to infect K562 cells and stable strains were screened.

[0024] In a third aspect, the present invention provides a pharmaceutical composition comprising the engineered mitochondrial vaccine described above, and pharmaceutically acceptable excipients.

[0025] Wherein, the auxiliary material described in the above-mentioned pharmaceutical composition is at least one of a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an absorption promoter, a surfactant, a protective agent, an adsorption carrier or a lubricant.

[0026] In a fourth aspect, the present invention also provides a combination drug comprising the above-mentioned engineered mitochondrial vaccine and other drugs for preventing and / or treating fibrosis.

[0027] Wherein, the dosage form of the above-mentioned engineered mitochondrial vaccine, pharmaceutical composition or combination drug is injection, nasal drops, spray, inhalation or oral preparation.

[0028] Preferably, the injection route is at least one of intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intramyocardial injection or intraperitoneal injection.

[0029] More preferably, the dosage form is a subcutaneous injection preparation or a nasal drop preparation.

[0030] In a fifth aspect, the present invention provides the use of the above-mentioned engineered mitochondrial vaccine, pharmaceutical composition or combination drug in preventing and / or treating fibrotic diseases.

[0031] Wherein, the fibrotic disease includes at least one of pulmonary fibrosis, liver fibrosis, pancreatic fibrosis, kidney fibrosis, cardiac fibrosis, endometrial fibrosis, eye fibrosis, spleen fibroproliferative disease, myelofibrosis or skin fibrosis.

[0032] Preferably, the pulmonary fibrosis comprises at least one of idiopathic pulmonary fibrosis (IPF), secondary pulmonary fibrosis, hereditary pulmonary fibrosis or interstitial lung disease with features of pulmonary fibrosis.

[0033] Beneficial effects: The present invention uses OTC as a plasmid and lentiviral transfection system for the first time to establish a mitochondrial-targeted fibrosis-related antigen expression platform. The present invention further found that the WT1 antigen was used as a target for the pulmonary fibrosis vaccine, and WT1 was used as a model antigen to construct a stable expression cell line that overexpresses WT1 on mitochondria, and the transgenic mitochondria (Mito-WT1) therein were extracted to evaluate their efficacy as pulmonary fibrosis vaccines. Animal experiments found that the Mito-WT1 vaccine had therapeutic efficacy on the bleomycin-induced mouse pulmonary fibrosis model when immunized subcutaneously and intranasally, and the Mito-WT1 vaccine intranasally also had a preventive effect on mouse pulmonary fibrosis and had good safety in vivo. It can be seen that the engineered mitochondrial vaccine of the present invention is expected to become a new hope for inhibiting pulmonary fibrosis. This innovative treatment method not only brings new hope to patients with IPF and other types of pulmonary fibrosis, but also provides an important theoretical basis and practical guidance for research in related fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The results of WT1 antigen as a potential target for pulmonary fibrosis vaccine in Example 1. a is the immunohistochemistry of WT1 in normal human lung and IPF human lung, normal mouse lung tissue and fibrotic lung tissue, with a scale of 30 μm (human) and 50 μm (mouse); b, c are the expression levels of WT1 gene in normal lung tissue and fibrotic lung tissue of human and mouse; d is the single cell transcriptome data analysis of WT1 expression distribution in different types of cells in human and mouse lungs.

[0035] Figure 2The figure shows the preparation and characterization results of Mito-WT1 in Example 2. a shows the construction of Mito-WT1 plasmid, lentiviral packaging and transfection process of Mito-WT1, a mitochondrial-based profibrotic antigen delivery system; b shows the schematic diagram of the recombinant plasmid containing the mitochondrial localization signal peptide sequence and the WT1 sequence; c shows the transmission electron micrograph of the control mitochondria (Mito) and the mitochondria (Mito-WT1) with directional expression of WT1, and the scale bar represents 200nm; d shows the expression of WT1 protein in the mitochondria of the two cells detected by Western blot, VDAC is the multifunctional protein voltage-dependent anion channel 1, which can be used as a mitochondrial internal reference, and Vinculin is the focal adhesion protein, which can be used as a whole cell internal reference; e shows the co-localization of WT1 and mitochondria in the two cells detected by immunofluorescence, and the scale bar represents 2μm.

[0036] Figure 3 It is a graph showing the results of subcutaneous injection of Mito-WT1 vaccine in Example 3 to treat pulmonary fibrosis in mice; wherein, a is a flow chart of subcutaneous immunotherapy of pulmonary fibrosis in mice with Mito-WT1 vaccine; b is mouse lung weight; c is H&E staining (top) and Masson staining (bottom) of mouse lung tissue, with the ruler representing 50 μm; d is Szapiel score; e is Ashcroft score; f is immunohistochemistry of Collagen 1 and α-SMA in mouse lung tissue, with the ruler representing 50 μm; g is the immunohistochemistry score of Collagen 1; and h is the immunohistochemistry score of α-SMA.

[0037] Figure 4 The figure is the result of intranasal immunotherapy of pulmonary fibrosis in mice with Mito-WT1 vaccine in Example 4. Wherein, a is a flow chart of intranasal immunotherapy of pulmonary fibrosis in mice with Mito-WT1 vaccine; b is the weight of mouse lung; c is the H&E staining (upper) and Masson staining (lower) of mouse lung tissue, the scale represents 50μm; d is the Szapiel score; e is the Ashcroft score; f is the immunohistochemical image of Collagen 1 and α-SMA in mouse lung tissue; g is the immunohistochemical score of Collagen 1, the scale represents 50μm; h is the immunohistochemical score of α-SMA; j is the protein expression level of COLA1 and α-SMA in mouse lung tissue detected by Western blot, VINCULIN is used as an internal reference; km is the relative expression of Col1α1, Fn1 and Acta2 genes in mouse lung tissue detected by real-time fluorescence quantitative PCR (qRT-PCR).

[0038] Figure 5The figure is the result of Mito-WT1 vaccine in Example 5 for preventing pulmonary fibrosis in mice by intranasal immunization. Among them, a is a flow chart of Mito-WT1 vaccine intranasal immunization for preventing pulmonary fibrosis in mice; b is mouse lung weight; c is H&E staining (upper) and Masson staining (lower) of mouse lung tissue, the scale represents 50μm; d is Szapiel score; e is Ashcroft score; f is immunohistochemistry of Collagen 1 and α-SMA in mouse lung tissue; g is immunohistochemistry score of Collagen 1, the scale represents 50μm; h is immunohistochemistry score of α-SMA; j is Western blot detection of protein expression levels of COLA1 and α-SMA in mouse lung tissue, VINCULIN as internal reference; km is qRT-PCR detection of relative expression of Col1α1, Fn1 and Acta2 genes in mouse lung tissue.

[0039] Figure 6 The figure is the result of the in vivo safety evaluation of the Mito-WT1 vaccine in Example 6. Among them, a is the complete blood cell count of mice, including white blood cells, neutrophils, lymphocytes, monocytes, eosinophils, basophils, red blood cells, hemoglobin, hematocrit, mean corpuscular volume, mean corpuscular hemoglobin content, mean corpuscular hemoglobin concentration, mean platelet volume and platelet count; b is the serum biochemical index detection of mice, including total bilirubin, alanine aminotransferase, aspartate aminotransferase, albumin, alkaline phosphatase, uric acid, creatinine, creatine kinase-MB isoenzyme, urea and amylase; c is H&E staining of mouse organs (including heart, liver, spleen, lung, kidney, skin, small intestine, skeletal muscle and nose). The scale represents 100μm. DETAILED DESCRIPTION

[0040] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clear, the present application is further described in detail below in combination with the implementation methods. Unless otherwise defined, all scientific and technological terms used herein have the same meanings as understood by ordinary technicians in the field.

[0041] The Wilms tumor 1 (WT1) gene is located on human chromosome 11p13. The WT1 it encodes has the dual functions of inhibiting tumor growth and activating oncogene transcription, and is a bidirectional transcription factor. The WT1 gene is highly expressed in various solid tumors and leukemias, especially acute myeloid leukemia (AML). As a star antigen in tumor immunotherapy, WT1 has been shown to have good safety and efficacy in many clinical trials. The applicant found that WT1 is highly expressed in mesothelial cells and mesenchymal cells in the early stages of pulmonary fibrosis, suggesting its important role in the fibrosis process. Therefore, WT1 not only shows potential in tumor treatment, but also becomes an emerging target for the treatment of pulmonary fibrosis.

[0042] The present invention uses OTC as a plasmid and lentiviral transfection system to establish a mitochondrial-targeted pulmonary fibrosis-related antigen expression platform. Using WT1 as a model antigen, a stable expression cell line overexpressing WT1 on mitochondria was constructed, and transgenic mitochondria (Mito-WT1) were extracted to evaluate their efficacy as pulmonary fibrosis vaccines. It was found that the Mito-WT1 vaccine had therapeutic efficacy on the bleomycin-induced mouse pulmonary fibrosis model when immunized subcutaneously and intranasally, and the Mito-WT1 vaccine intranasally also had a preventive effect on mouse pulmonary fibrosis, and had good safety in vivo.

[0043] SEQ ID NO.1: Nucleotide sequence of pulmonary fibrosis antigen WT1

[0044]

[0045] SEQ ID NO.2 is the nucleotide sequence of the entire expression plasmid, including the nucleotide sequences of the promoter, enhancer, OTC and WT1, etc. The target gene sequence of the Mito-WT1 vaccine is SEQ ID NO.4OTC+WT1.

[0046]

[0047] SEQ ID NO.3: OTC leader sequence (NCBI Reference Sequence: NM_000531.6)

[0048] ATGCTGTTTAATCTGAGGATCCTGTTAAACAATGCAGCTTTTAGAAATGGTCACAAC TTCATGGTTCGAAATTTTCGGTGTGGACAACCACTACAAAATAAAGTG。

[0049] SEQ ID NO.4: OTC + WT1 full-length sequence (NCBI Reference Sequence: NM_000378.6)

[0050] ATGCTGTTTAATCTGAGGATCCTGTTAAACAATGCAGCTTTTAGAAATGGTCACAAC

[0051] TTCATGGTTCGAAATTTTCGGTGTGGACAACCACTACAAAATAAAGTG

[0052]

[0053] Specific examples will be listed below to explain the scheme of the present invention. It will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the examples, the techniques or conditions described in the literature in this area or the product instructions are used. Reagents or instruments used that do not indicate manufacturers are all conventional products that can be obtained commercially.

[0054] The main materials used in the following examples are as follows:

[0055] Bleomycin (HY-108345) was purchased from MedChemExpress. Mitochondria isolation kit (MITOIS02) was purchased from Sigma-Aldrich. Rabbit polyclonal anti-Voltage-dependent anion channel (VDAC) (#4866), rabbit monoclonal anti-Wilms'Tumor 1 (WT1) (#83535) and HRP-conjugated anti-rabbit IgG (7074) were purchased from Cell Signaling Technology. Rabbit polyclonal anti-α-smooth muscle actin (α-SMA) (14395-1-A) was purchased from Wuhan Sanying Biotechnology. Rabbit polyclonal anti-Collagen Ialpha 1 (501352) was purchased from Chengdu Zhengneng Biotechnology. Fluorescent secondary antibody goat anti rabbit AF647 (A27040) was purchased from Invitrogen.

[0056] K562 cells and K562 WT1 Cells were cultured in 1640 medium (Gibco) containing 10% fetal bovine serum (Gibco), 100U / mL penicillin and 100mg / mL streptomycin. Human embryonic kidney 293T (HEK293T) cells were cultured in DMEM medium containing 4.5g / L D-glucose, 10% fetal bovine serum (Gibco), 100U / mL penicillin and 100mg / mL streptomycin. Male C57BL / 6 mice (weight 26-28g) were purchased from Weitong Lihua Company (Beijing, China). The experiment was carried out after one week of adaptive feeding of mice. Mice were raised in the SPF animal room of the State Key Laboratory of Biotherapy, Sichuan University. All experimental protocols were reviewed and approved by the Experimental Animal Management Committee of Sichuan University (Chengdu, Sichuan).

[0057] The main detection methods used in the following examples are as follows:

[0058] 1. Real-time fluorescence quantitative PCR (qRT-PCR) detection

[0059] Total RNA from tissues and cells was extracted using a total RNA isolation kit (FOREGENE, RE-03113) and RT Easy TM cDNA was synthesized using a reverse transcription kit (FOREGENE, RT-01031 / 01032). Real-time fluorescence quantitative PCR was performed using a Bio-Rad, CFX96 Touch TM ) for qRT-PCR detection. The PCR reaction system includes a front primer, a rear primer, Green Supermix (Bio-Rad, iTaq Universal SYBR Green), cDNA, ddH2O. 18sRNA present in all eukaryotic cells was selected as the internal reference gene. The primer sequences used for qRT-PCR are shown in Table 1:

[0060] Table 1. Primer sequences

[0061]

[0062] 2. Histopathology, hematoxylin & eosin (H&E) staining and Masson staining

[0063] (1) Sampling, dehydration, embedding, and sectioning

[0064] After fresh tissue sampling, each tissue organ is soaked in 4% paraformaldehyde for at least 2 days. The tissue is taken out of the fixative and the target part of the tissue is trimmed with a scalpel in the fume hood. The trimmed tissue and the corresponding label are placed in the dehydration box. After the tissue is washed with water, it can be dehydrated in a gradient manner, in the order of 70%, 80%, 90%, 95% and 100% alcohol (anhydrous ethanol), and the dehydration time for each level is 30 minutes. The wax-soaked tissue is placed in a paraffin embedding machine (Leica) for embedding, cooled on a fully automatic tissue embedding machine cold stage (Leica), and the wax block is removed from the embedding frame and trimmed after the wax solidifies. The trimmed wax block is placed on a paraffin slicer and sliced ​​with a thickness of 3μm. The slices are floated on the 40℃ warm water of the spreader to flatten the tissue, and the tissue is picked up with a slide and placed in a 60℃ oven for baking. After the water is dried and the wax is baked, take it out and store it at room temperature or 4℃ for later use.

[0065] (2) Dewaxing and hydration

[0066] First, place the slices in order on the slice copper rack and bake them at 65-70℃ in a slide spreader for 30 minutes to dissolve the wax layer. Then dewax with xylene 3 times, 10 minutes each time. Then hydrate in alcohol in a gradient, in the order of anhydrous ethanol, 95%, 85% and 75%, with a hydration time of 5 minutes for each level. After hydration, transfer the slices to a histochemical box and wash twice with ddH2O on a shaker for 5 minutes each. Immerse the slices in a histochemical box containing 200mL of 1× antigen repair solution, transfer them to a pressure cooker, and after the pressure cooker is boiled for 10-12 minutes, remove the histochemical box and cool naturally at room temperature. Wash twice with 1× PBS on a shaker for 5 minutes each time.

[0067] (3) H&E staining

[0068] After the paraffin sections are processed according to the above steps, they are stained with H&E staining kit (Biyuntian, C0105S). Generally, hematoxylin staining is performed for 5-10 minutes, and the excess stain is rinsed off with tap water, and then washed once with ddH2O. Eosin staining is performed for 3-30 seconds. The above steps can be adjusted according to the staining results and requirements. After drying at room temperature, the sections are sealed with neutral resin and scanned and analyzed on a pathology scanner.

[0069] (4) Masson staining

[0070] After the paraffin sections were processed according to the conventional method, Masson trichrome staining reagent (Biyuntian, C0189M) was used for tissue staining. First, the sections were stained with Weigert iron hematoxylin staining solution for 5-10 minutes. After the staining was completed, the sections were rinsed with tap water to remove excess staining solution and washed with distilled water once. Next, the sections were stained with acid fuchsin staining solution for 1-3 minutes and washed with water again. Subsequently, phosphotungstic acid-sapphire blue staining was performed, and the staining time was generally 5-10 minutes, which could be adjusted appropriately depending on the tissue type and staining effect. After staining, the sections were dehydrated to clean and transparent, and finally sealed with neutral resin and scanned and analyzed on a pathology scanning instrument.

[0071] 3. Immunohistochemistry

[0072] Immunohistochemical staining was performed according to the instructions of the Histonstain-SP kit (ZSGB-BIO, SPN-9002) and slightly adjusted. The specific steps are as follows: After the paraffin sections were dewaxed and rehydrated, antigen retrieval was performed. Subsequently, the sections were permeabilized with 0.2% Triton X-100 (Sigma Aldrich, 9036-19-5), and nonspecific binding sites were blocked with 10% goat serum (Solarbio, SL038). 100 μL of primary antibody was added and incubated at 37°C for 1 hour. After incubation, the sections were washed three times with PBS for 5 minutes each. Then, 100 μL of biotin-labeled goat anti-rabbit IgG was added and incubated at room temperature for 10-15 minutes. After washing three times with PBS again, 100 μL of horseradish peroxidase (HRP)-labeled streptavidin working solution was added and incubated at room temperature for 10-15 minutes. Freshly prepared diaminobenzidine (DAB) was used for color development (5-8 minutes at room temperature), followed by counterstaining the nuclei with hematoxylin for 30 seconds and rinsing with tap water for 5 minutes. After the sections were dried, they were sealed with neutral gum (Solarbio, G8590). The primary antibodies used in this experiment included: WT1 (Servicebio, GB11382, 1:300), α-SMA (Servicebio, GB111364, 1:1000) and Col1α1 (Servicebio, GB11022-3, 1:1000). All images were acquired using a PANNORAMIC digital slide scanner (3DHISTECH, PANNORAMIC MIDI II).

[0073] 4. Western blot

[0074] Western blot analysis was performed according to the established experimental protocol. For cell samples, after discarding the supernatant, the cell pellet was lysed using RIPA buffer (Beyotime, P0013B) with the addition of phosphatase inhibitors (MedChemExpress, HY-K0022) and protease inhibitors (MedChemExpress, HY-K0010). The lysate was sonicated and boiled at 98°C for 10 minutes to denature the protein. For tissue samples, 100 mg of lung tissue was homogenized in 1 mL of RIPA buffer containing 10 μL of phosphatase inhibitors and 10 μL of protease inhibitors and further ground using a high-speed tissue homogenizer (Servicebio, KZ-II). The homogenized tissue lysate was centrifuged at 13,000 rpm for 10 minutes, and the supernatant was collected. Subsequently, the tissue lysate was mixed with SDS-PAGE sample loading buffer (Beyotime, P0015L), boiled for 10 minutes, and stored at -80°C.

[0075] Protein electrophoresis and transfer were performed according to standard protocols. Protein electrophoresis was performed using 7.5% SDS-PAGE, and the membrane was transferred at 370 mA for 2 hours, and the PVDF membrane was collected. The PVDF membrane was blocked with 5% skim milk for 1 hour at room temperature. After blocking, the PVDF membrane was incubated with the primary antibody, washed with 1× TBST, and incubated with the secondary antibody. The primary antibodies used included rabbit polyclonal anti-Voltage-dependent anion channel (VDAC) (Cell Signaling Technology, #4866, 1:1000), rabbit monoclonal anti-Wilms'Tumor 1 (WT1) (Cell Signaling Technology, #83535, 1:1000), mouse monoclonal anti-Vinculin (Sigma-Aldrich, V9264, 1:1000), rabbit polyclonal anti-α-smooth muscle actin (α-SMA) (Proteintech, 14395-1-AP, 1:2000), rabbit polyclonal anti-Fibronectin (Proteintech, 15613-1-AP, 1:2000), rabbit polyclonal anti-Collagen I alpha 1 (Zenbio, 501352, 1:1000). VDAC and Vinculin were used as internal control proteins. The secondary antibodies were HRP-labeled anti-rabbit IgG (Cell Signaling Technology, 7074, 1:5000) and HRP-labeled anti-mouse IgG (Cell Signaling Technology, 7076, 1:5000). Chemiluminescence was performed using Clarity Western ECL Substrate (Bio-Rad, 1705061). Image data were collected by Western Blot Imaging System (e-BLOT).

[0076] 5. Immunofluorescence

[0077] The co-localization of WT1 protein and mitochondria was detected by immunofluorescence assay. WT1Cells were first gently washed 2-3 times with 1×PBS to remove the residual serum in the culture medium. Then they were resuspended in RPMI 1640 culture medium containing 50 μM Mitotracker Red CMXRos (Invitrogen, M7512) preheated at 37°C. The cells were incubated in a cell culture incubator at 37°C with 5% carbon dioxide in the dark for 30 minutes, then centrifuged and washed with prewarmed saline (37°C). Cell smears were prepared using 37°C warm saline. K562 cells, K562 were then separated using a cell spinner (Thermo Scientific, Cytospin 4). WT1 Cells (5×10 5 The cells were fixed and perforated using a commercial fixation and perforation kit (BD Biosciences, #554715). After washing, blocking, and primary antibody incubation (Rabbit antihuman WT1), Goat anti rabbit IgG-FITC secondary antibody and DAPI staining were added, and the slides were sealed with an anti-fluorescence quencher. Finally, the co-localization of mitochondria and WT1 in K562WT1 cells was observed on a Zeiss 880 confocal microscope.

[0078] Example 1. WT1 antigen is a potential target for pulmonary fibrosis vaccine

[0079] To evaluate the potential of WT1 antigen as a target for pulmonary fibrosis vaccine, we performed immunohistochemistry on normal human lung, IPF human lung, normal mouse lung tissue, and bleomycin-induced pulmonary fibrosis mouse lung tissue, and found that WT1 antigen was not expressed or was limitedly expressed in normal human lung and mouse lung ( Figure 1 a), but highly expressed in IPF human lung and fibrotic mouse lung tissue ( Figure 1 a). The relative expression of WT1 gene in 4 normal human lungs and 5 IPF human lungs was detected by real-time fluorescence quantitative PCR (qRT-PCR), and it was found that the expression level of WT1 gene in IPF human lungs was significantly increased ( Figure 1 b), qRT-PCR of mouse lung tissue is consistent with that of human lung, and the expression level of WT1 gene in fibrotic mouse lung tissue is significantly increased ( Figure 1 c). We further used the human single-cell transcriptome database (GSE136831: including 26 normal human lungs and 32 IPF human lungs) to analyze which group of cells WT1 is highly expressed in fibrotic lungs. We found that in the lungs of IPF patients, WT1 is mainly expressed in mesenchymal cells. The results of mouse single-cell transcriptome sequencing are consistent with those of humans. The WT1 gene is mainly enriched in mesenchymal cells in the lungs of mice with bleomycin-induced pulmonary fibrosis ( Figure 1d). Based on the above results, we found that WT1 antigen was significantly highly expressed in human and mouse fibrotic lungs, suggesting that WT1 antigen could be used as a target for the development of pulmonary fibrosis vaccines.

[0080] Example 2. Preparation and characterization of Mito-WT1 vaccine

[0081] We obtained K562 cells that can stably express WT1 by constructing recombinant plasmids, packaging lentivirus, infecting human chronic myeloid leukemia cells (K562) with lentivirus, and selecting with puromycin. WT1 ). Mitochondria isolation kit (Sigma-Aldrich, MITOIS02) was used to extract wild-type K562 cells and K562 WT1 Mitochondria of cells ( Figure 2 a). First, we constructed the recombinant plasmid and packaged it with lentivirus: Specifically, we used OTC as the mitochondrial localization peptide, synthesized and ligated OTC and the target gene WT1 on the open reading frame region of the pLV-puro vector (OTC+WT1), and successfully constructed the pLV-EF1a-OTC-WT1-pGK-Puro (pLV-WT1) recombinant plasmid ( Figure 2 b). The pLV-WT1 plasmid contains a puromycin resistance gene, which can be used to screen stable tumor cell lines after transfection. Subsequently, the plasmid vector was transformed and expanded, and the plasmid DNA was extracted in large quantities using an endotoxin-free plasmid extraction kit (TIANGEN, #DP117). Lentivirus vectors are an effective tool for introducing exogenous genes. We used lentivirus transfection to direct the exogenous WT1 gene into the mitochondria of tumor cells. We mixed the pLV-WT1 recombinant plasmid with auxiliary plasmids (pSPAX2 and pMD2.G) in a volume ratio of 5:3:2, a total of 10μg, and packaged the lentivirus vector in large quantities in HEK293T cells. After 6-8 hours of transfection, the cell culture medium was carefully aspirated, and then 10mL of fresh cell culture medium was added to continue the culture. The viral supernatant was collected and the lentivirus was concentrated by ultrahigh-speed centrifugation at 4°C, 35,000rpm, and 90 minutes. Then, we infected K562 cells with lentivirus and screened stable strains. K562 cells in the logarithmic growth phase were co-cultured with different volumes of concentrated viruses, and polybrene dye was added to increase the virus transfection efficiency. The cells were incubated at 37°C for 8 hours and replaced with fresh 1640 double-stranded medium. After 3-4 days of infection, the cell state was observed and a stable strain was selected using a low-to-high puromycin gradient. The highest screening concentration of puromycin was 9 μg / mL.

[0082] Next, we isolated and identified mitochondria that overexpress WT1 (Mito-WT1). The specific steps are as follows: Sigma-Aldrich Mitochondria Isolation Kit (MITOIS02) was used to extract wild-type K562 cells, K562 WT1 First, cells in the logarithmic growth phase were collected and counted, and the cells were washed twice with sterile pre-cooled PBS and centrifuged at 4°C and 600g for 5 minutes to collect the cell pellet. The cell pellet was resuspended in diluted 1× Extraction Buffer A (EBA) (Sigma-Aldrich, #E2778) containing protease inhibitors (1-2.5 mL: 2-5×10 7 cells) and incubate on ice for 10-15 minutes. Use a syringe to repeatedly aspirate the cell suspension to destroy the cell structure until the microscopic results show that the proportion of broken cells exceeds 50%. Centrifuge at 4°C, 1000g for 10 minutes, carefully collect the supernatant, centrifuge the supernatant for 10 minutes (4°C, 3000g), and collect the mitochondrial precipitate. WT1 Control mitochondria (Mito) and mitochondria directed to express WT1 (Mito-WT1) were obtained from the cells.

[0083] Transmission electron microscopy results showed that Mito and Mito-WT1 had similar morphology and structure, suggesting that engineering modification of mitochondria would not affect the structure of mitochondria ( Figure 2 c). The mitochondria resuspended in RIPA were lysed by ultrasonication (ultrasonication for 5 seconds, interval of 5 seconds, power 30%), and SDS-PAGE protein loading buffer (5X) was added to prepare protein samples. We detected the expression of WT1 protein in mitochondria by Western blot and found that K562 WT1 The expression of WT1 protein in cell mitochondria was significantly higher than that in wild-type K562 cell mitochondria. When the expression of VDAC, the internal reference protein of mitochondria, was high and similar in both groups, the expression of Vinculin, the internal reference protein of whole cells, was low, indicating that the extracted mitochondria had high purity and less cytoplasmic impurities ( Figure 2 d) The co-localization of WT1 protein and cell mitochondria was detected by immunofluorescence experiment. The specific detection method is as described in the above detection method 5. We analyzed the expression location of WT1 protein by immunofluorescence experiment. Figure 2 As shown in e, despite the expression of WT1 in wild-type K562 cells, it did not colocalize with mitochondria. WT1In the cells, WT1 protein expression was enhanced, and the fluorescence distribution of WT1 antibody was consistent with that of mitochondrial tracer, indicating that WT1 protein co-localized with mitochondria in K562 cells. Based on the above results, we successfully constructed a K562 cell line with mitochondrial targeted expression of WT1 and constructed a Mito-WT1 pulmonary fibrosis vaccine production platform.

[0084] Example 3. Subcutaneous immunization with Mito-WT1 vaccine has therapeutic efficacy in treating pulmonary fibrosis in mice

[0085] To evaluate the ability of Mito-WT1 vaccine to treat pulmonary fibrosis in mice after subcutaneous immunization. Figure 3 a, We injected mice with 100 μL of different drugs (normal saline, 50 μg Mito, 5 μg WT1 protein and 50 μg Mito-WT1) subcutaneously on days 0, 7 and 14, respectively. On day 1, we established a mouse pulmonary fibrosis model by instilling 50 μL of bleomycin (3 mg / kg) behind the tongue. We collected the mouse lung tissues on day 28 after modeling to observe the therapeutic efficacy of the vaccine. We found that although subcutaneous immunization with Mito-WT1 could not significantly reduce the lung weight of fibrotic mice ( Figure 3 b), however, the pathological section results showed that the lung inflammation in the Mito-WT1 group was significantly alleviated, and the Szapiel score was reduced, indicating that the area of ​​damage and fibrotic alveolitis was reduced ( Figure 3 cH&E, 3d), decreased lung collagen deposition and reduced Ashcroft score, indicating a decrease in fibrosis area ( Figure 3 c-Masson, 3e). Type I collagen (Collagen 1) and α-smooth muscle actin (α-SMA) are markers of pulmonary fibrosis and their expression increases in fibrotic lungs. Furthermore, we observed by immunohistochemistry that subcutaneous immunization with Mito-WT1 could reduce the deposition and expression of Collagen 1 and α-SMA ( Figure 3 fh). Based on the above results, subcutaneous immunization of Mito-WT1 vaccine can effectively treat pulmonary fibrosis in the bleomycin-induced mouse pulmonary fibrosis model.

[0086] Example 4. Mito-WT1 vaccine nasal immunization has the efficacy of treating pulmonary fibrosis in mice

[0087] To evaluate the ability of Mito-WT1 vaccine to treat pulmonary fibrosis in mice via intranasal immunization. Figure 4a, We immunized mice with 25 μL (normal saline, 50 μg Mito and 50 μg Mito-WT1) intranasally on days 0, 7 and 14, respectively. On day 1, we established a mouse pulmonary fibrosis model by instilling 50 μL bleomycin (3 mg / kg) behind the tongue. We collected the mouse lung tissues 28 days after modeling to observe whether the Mito-WT1 vaccine intranasal immunization has therapeutic vaccine efficacy. Therapeutic intranasal immunization with Mito-WT1 can significantly reduce the lung weight of fibrotic mice ( Figure 4 b). H&E staining and Masson staining results showed that therapeutic intranasal immunization with Mito-WT1 significantly alleviated lung inflammation and collagen deposition in fibrotic mice ( Figure 4 ce). Immunohistochemistry results showed that Mito-WT1 nasal immunization could significantly reduce the expression of pulmonary fibrosis markers Collagen 1 and α-SMA ( Figure 4 fh). Western blot results showed that Mito-WT1 nasal immunization could significantly reduce the protein expression levels of COL1A1 and α-SMA ( Figure 4 j). In addition, fibronectin (Fn) is also a marker of pulmonary fibrosis. qRT-PCR results showed that Mito-WT1 nasal immunization could significantly reduce the relative gene expression of pulmonary fibrosis markers, including Col1α1, Fn1 and Acta2 ( Figure 4 km). Based on the above results, intranasal immunization with Mito-WT1 vaccine can also effectively treat pulmonary fibrosis in the bleomycin-induced mouse pulmonary fibrosis model.

[0088] Example 5. Mito-WT1 vaccine nasal immunization has the effect of preventing pulmonary fibrosis in mice

[0089] To evaluate the ability of Mito-WT1 vaccine to prevent pulmonary fibrosis in mice. Figure 5 a, We immunized mice with 25 μL (normal saline, 50 μg Mito and 50 μg Mito-WT1) intranasally on days 0, 14 and 21, respectively. On day 22, we established a mouse pulmonary fibrosis model by instilling 50 μL bleomycin (3 mg / kg) behind the tongue. We collected the mouse lung tissues on day 50 of the experiment to observe whether Mito-WT1 vaccine intranasal immunization has preventive vaccine efficacy. Preventive intranasal immunization with Mito-WT1 can significantly reduce the lung weight of fibrotic mice ( Figure 5 b). H&E staining and Masson staining results showed that preventive intranasal immunization with Mito-WT1 significantly alleviated lung inflammation and collagen deposition in fibrotic mice ( Figure 5 ce). Immunohistochemistry results showed that Mito-WT1 nasal immunization could significantly reduce the expression of pulmonary fibrosis markers Collagen 1 and α-SMA ( Figure 5 fh). Western blot results showed that Mito-WT1 nasal immunization could significantly reduce the protein expression levels of COL1A1 and α-SMA ( Figure 5 j). qRT-PCR results showed that Mito-WT1 nasal immunization could significantly reduce the relative expression levels of Col1α1, Fn1 and Acta2 genes ( Figure 5 km). Based on the above results, intranasal immunization with Mito-WT1 vaccine has the efficacy of preventing pulmonary fibrosis in the bleomycin-induced mouse pulmonary fibrosis model.

[0090] Example 6. Safety evaluation of Mito-WT1 in mice

[0091] To evaluate the safety of Mito-WT1 vaccine, we immunized mice with different vaccines (normal saline, 50μg Mito and 50μg Mito-WT1) by intranasal drops three times according to the preventive vaccine immunization process. One week after the third immunization, fresh anticoagulated whole blood and serum were collected. Complete blood cell count and serum biochemical test were performed, and there was no statistically significant difference among the blank group, Mito group and Mito-WT1 group ( Figure 6 a, 6b). H&E staining results of pathological sections showed that no obvious pathological changes were observed in the heart, liver, spleen, lung, kidney, skin, small intestine, skeletal muscle and nasal mucosa of immunized mice ( Figure 6 c).

Claims

1. An engineered mitochondrial vaccine, characterized in that: Contains transgenic mitochondria directed to express fibrosis-related antigens.

2. The engineered mitochondrial vaccine according to claim 1, characterized in that: The fibrosis includes at least one of pulmonary fibrosis, liver fibrosis, pancreatic fibrosis, kidney fibrosis, cardiac fibrosis, endometrial fibrosis, eye fibrosis, spleen fibroproliferative disease, myelofibrosis or skin fibrosis; Preferably, the pulmonary fibrosis includes at least one of idiopathic pulmonary fibrosis, secondary pulmonary fibrosis, hereditary pulmonary fibrosis or interstitial lung disease with characteristics of pulmonary fibrosis.

3. The engineered mitochondrial vaccine according to claim 1 or 2, characterized in that: The fibrosis-related antigen is a pulmonary fibrosis-related antigen, which is selected from at least one of nephroblastoma 1, snail family zinc finger protein 1, snail family zinc finger protein 2, kink family bHLH transcription factor, and immediate early gene c-Jun or c-Fos; Preferably, the pulmonary fibrosis antigen is WT1; More preferably, the nucleotide sequence of WT1 is as shown in SEQ ID NO.

1.

4. The engineered mitochondrial vaccine according to any one of claims 1 to 3, characterized in that: The transgenic mitochondria are mitochondria expressing WT1, and the entire expression plasmid nucleotide sequence thereof is shown as SEQ ID NO.2; preferably, the target gene of the engineered mitochondrial vaccine is shown as SEQ ID NO.

4.

5. The engineered mitochondrial vaccine according to any one of claims 1 to 4, characterized in that: The engineered mitochondrial vaccine uses mitochondria as a fibrosis antigen delivery system, which is a plasmid and lentiviral transfection system with ornithine carbamoyl transferase as a leader sequence, and establishes a mitochondrial-targeted fibrosis-related antigen expression platform; Preferably, the leading sequence is shown as SEQ ID NO.

3.

6. The method for preparing a mitochondrial vaccine according to any one of claims 1 to 5, characterized in that: The following steps are involved: A recombinant plasmid containing fibrosis-related antigens is constructed, packaged into lentivirus, and then cells are infected with the lentivirus system to screen out stable strains that stably express fibrosis-related antigens in mitochondria. Mitochondria of the stable strains are then extracted to obtain transgenic mitochondria that directionally express fibrosis-related antigens.

7. The preparation method according to claim 6, characterized in that: The recombinant plasmid is prepared by using OTC as a mitochondrial localization peptide and a fibrosis-related antigen as a template antigen, and synthesizing and connecting OTC and the template antigen; Preferably, the nucleotide sequence of the recombinant plasmid is as shown in SEQ ID NO.2; more preferably, the recombinant plasmid contains a nucleotide sequence consisting of OTC and a template antigen, as shown in SEQ ID NO.

4.

8. The preparation method according to claim 6 or 7, characterized in that: The plasmid is selected from at least one of a mammalian cell expression vector, an insect baculovirus expression vector, an Escherichia coli expression vector, and a yeast expression vector; Preferably, the plasmid is selected from any one of pLV-puro, pCDH-CMV, pCDH-EF1, pCDH-MSCV, and pCDH-RFP vectors.

9. The preparation method according to any one of claims 6 to 8, characterized in that: The method for preparing the mitochondrial vaccine comprises the following steps: Using OTC as the mitochondrial localization peptide, OTC and the target gene WT1 were synthesized and connected on the pLV-puro vector to construct a recombinant plasmid, and then the recombinant plasmid was mixed with the auxiliary plasmid, and the lentiviral vector was packaged in HEK293T cells. The culture supernatant was collected, the lentivirus was concentrated by ultrahigh-speed centrifugation, and the lentivirus was used to infect K562 cells and stable strains were screened.

10. A pharmaceutical composition, characterized in that: The invention comprises the engineered mitochondrial vaccine according to any one of claims 1 to 5, and pharmaceutically acceptable excipients.

11. The pharmaceutical composition according to claim 10, characterized in that: The auxiliary material is at least one of a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an absorption promoter, a surfactant, a protective agent, an adsorption carrier or a lubricant.

12. A combined drug, characterized in that: Contains the engineered mitochondrial vaccine according to any one of claims 1 to 5 and other drugs for preventing and / or treating fibrosis.

13. The engineered mitochondrial vaccine according to any one of claims 1 to 5, the pharmaceutical composition according to claim 10 or 11, or the combined drug according to claim 12 is in the form of injection, nasal drops, spray, inhalation, or oral preparation; Preferably, the injection route is at least one of intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intramyocardial injection or intraperitoneal injection; More preferably, the dosage form is a subcutaneous injection preparation or a nasal drop preparation.

14. Use of the engineered mitochondrial vaccine according to any one of claims 1 to 5, the pharmaceutical composition according to claim 10 or 11, or the combined drug according to claim 12 in preventing and / or treating fibrotic diseases.

15. The use according to claim 14, characterized in that: The fibrotic disease includes at least one of pulmonary fibrosis, liver fibrosis, pancreatic fibrosis, kidney fibrosis, cardiac fibrosis, endometrial fibrosis, eye fibrosis, spleen fibroproliferative disease, myelofibrosis or skin fibrosis; Preferably, the pulmonary fibrosis includes at least one of idiopathic pulmonary fibrosis, secondary pulmonary fibrosis, hereditary pulmonary fibrosis or interstitial lung disease with characteristics of pulmonary fibrosis.

Images