Multi-epitope VP1 fusion protein, virus-like particle and polyclonal antibody of O-type foot-and-mouth disease virus and application of multi-epitope VP1 fusion protein, virus-like particle and polyclonal antibody

Abstract

The invention relates to the related technical field of detection of O-type foot-and-mouth disease virus antibodies, and particularly discloses a multi-epitope VP1 fusion protein, a virus-like particle and a polyclonal antibody of O-type foot-and-mouth disease virus as well as application of the multi-epitope VP1 fusion protein, the virus-like particle and the polyclonal antibody. The method for detecting the O-type foot-and-mouth disease virus antibody is established on the basis of a competition method by taking the virus-like particle as a competitive antigen and the polyclonal antibody as a labeled antibody, so that the method is simple to operate and short in detection time, covers the main topology type of the O-type foot-and-mouth disease virus, avoids missing detection, and is high in detection accuracy. And the kit has the advantages of strong specificity, high sensitivity, good stability and the like.

Description

Technical Field

[0001] The present application relates to the technical field related to the detection of antibodies to type O foot-and-mouth disease virus (FMDV), and specifically to a multi-epitope VP1 fusion protein, virus-like particles and polyclonal antibodies of type O foot-and-mouth disease virus and their uses. Background Art

[0002] Foot-and-mouth disease (FMD) is listed as the first of the must-report animal diseases by the World Organization for Animal Health (WOAH). It is a Class I disease that must be inspected for international customs clearance of live animals and livestock products. my country also lists it as the first of the Class I animal diseases. Clinical symptoms include fever, blisters in the mouth, tongue, hoofs, etc., which gradually break and form scabs. The mortality rate of herpetic FMD in the mouth, nose, breast, etc. is less than 2.5%; if the course of the disease continues to develop, the mortality rate of secondary pneumonia animals is as high as (5-20)%, and the mortality rate of young animals and pregnant animals is higher than that of adult animals (45-60)%.

[0003] Among them, foot-and-mouth disease is a highly contagious, acute, and severe infectious disease caused by foot-and-mouth disease virus (FMDV). It can be transmitted not only between even-toed ungulates such as pigs, cattle, and sheep, but also through the air. FMDV can be transmitted by wind (50 to 100) kilometers.

[0004] FMDV belongs to the genus Aphthovirus of the family Picornaviridae. There are 7 different serotypes, namely O, A, C, Asia 1, SAT1, SAT2 and SAT3, and each serotype contains multiple subtypes. Among them, O is the most widely distributed and the most popular serotype in the world. The China National Reference Laboratory for Foot-and-Mouth Disease of the World Organization for Animal Health divides O-type foot-and-mouth disease virus into 10 topological types based on VP1 gene and endemic areas. Among them, 3 topological types are prevalent in my country, namely Cathay topological type, SEA topological type and ME-SA topological type (commonly known as pan-Asian type).

[0005] The methods for detecting O-type FMDV antibodies mainly include virus neutralization test, liquid phase blocking ELISA (LPB-ELISA) and solid phase competitive ELISA (SPC-ELISA). Among them, the virus neutralization test requires the preparation of a monolayer of cells, which is complicated, time-consuming and low in sensitivity; LPB-ELISA and SPC-ELISA are internationally recognized methods for detecting FMDV antibodies. However, the LPB-ELISA and SPC-ELISA test kits currently on the market have poor sensitivity, narrow detection spectrum, cumbersome operation steps, high requirements for test personnel, long reaction time, and cannot achieve fully automatic detection, making it difficult to achieve rapid detection of large quantities in a short time. Summary of the invention

[0006] In view of this, the present application provides a multi-epitope VP1 fusion protein of type O foot-and-mouth disease virus, virus-like particles and polyclonal antibodies and their uses. The present application uses virus-like particles as competitive antigens and polyclonal antibodies as labeled antibodies, and establishes a method for detecting antibodies to type O foot-and-mouth disease virus based on a competitive method, which is not only simple to operate and time-saving, but also covers the main topological types of type O foot-and-mouth disease virus, avoids missed detection, and has the advantages of strong specificity, high sensitivity, good stability, etc.

[0007] In a first aspect, the present application provides a multi-epitope VP1 fusion protein, wherein the multi-epitope VP1 fusion protein is selected from the structure shown in formula (I): ;

[0008] Wherein, AAS1 represents the amino acid sequence as shown in SEQ ID NO.1, and / or the amino acid sequence obtained by substituting, deleting or adding one or more bases of the amino acid sequence as shown in SEQ ID NO.1;

[0009] AAS2, AAS3, AAS4 and AAS5 each independently represent an amino acid sequence as shown in any one of SEQ ID NOs. 2 to 5, and AAS2, AAS3, AAS4 and AAS5 each represent a different amino acid sequence;

[0010] AAS6 represents the amino acid sequence as shown in SEQ ID NO.6, and / or the amino acid sequence obtained by substituting, deleting or adding one or more bases of the amino acid sequence as shown in SEQ ID NO.6;

[0011] L1, L2, L3, L4 and L5 each independently represent a flexible linking peptide.

[0012] In some specific embodiments, AAS1 represents the amino acid sequence shown in SEQ ID NO.1.

[0013] In some specific embodiments, AAS2 represents the amino acid sequence shown in SEQ ID NO.2, AAS3 represents the amino acid sequence shown in SEQ ID NO.3, AAS4 represents the amino acid sequence shown in SEQ ID NO.4, and AAS5 represents the amino acid sequence shown in SEQ ID NO.5.

[0014] In some specific embodiments, AAS6 represents the amino acid sequence shown in SEQ ID NO.6.

[0015] In some alternative embodiments, L1, L2, L3, L4, L5 and L6 each independently represent an amino acid sequence from the N-terminus to the C-terminus. , n is selected from an integer from 1 to 4 (eg, 1, 2, 3 or 4).

[0016] In some specific embodiments, L1 is selected from the amino acid sequence GGGGSGGGGS in the direction from N-terminus to C-terminus.

[0017] In some embodiments, L2 is selected from the amino acid sequence GGGGS in the direction from N-terminus to C-terminus.

[0018] In some embodiments, L3 is selected from the amino acid sequence GGGGS in the direction from N-terminus to C-terminus.

[0019] In some embodiments, L4 is selected from the amino acid sequence GGGGS in the direction from N-terminus to C-terminus.

[0020] In some specific embodiments, L5 is selected from the amino acid sequence GGGGSGGGGS in the direction from N-terminus to C-terminus.

[0021] In some optional embodiments, the multi-epitope VP1 fusion protein is selected from the amino acid sequence shown in SEQ ID NO.11.

[0022] In some specific embodiments, the multi-epitope VP1 fusion protein is selected from the amino acid sequence shown in SEQ ID NO.11.

[0023] In a second aspect, the present application provides a nucleic acid molecule, wherein the nucleic acid molecule comprises a structure shown in formula (II): ;

[0024] Wherein, NAS1 represents the nucleotide sequence as shown in SEQ ID NO.23, and / or the nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence as shown in SEQ ID NO.23;

[0025] NAS2, NAS3, NAS4 and NAS5 each independently represent a nucleotide sequence as shown in any one of SEQ ID NOs. 24 to 27, and NAS2, NAS3, NAS4 and NAS5 each represent a different nucleotide sequence;

[0026] NAS6 represents the nucleotide sequence shown in SEQ ID NO.28, and / or a nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in SEQ ID NO.28;

[0027] L1', L2', L3', L4' and L5' each independently represent a nucleotide sequence encoding a flexible connecting peptide.

[0028] In some specific embodiments, NAS1 represents the nucleotide sequence shown in SEQ ID NO.23.

[0029] In some specific embodiments, NAS2 represents the nucleotide sequence shown in SEQ ID NO.24, NAS3 represents the nucleotide sequence shown in SEQ ID NO.25, NAS4 represents the nucleotide sequence shown in SEQ ID NO.26, and NAS5 represents the nucleotide sequence shown in SEQ ID NO.27.

[0030] In some specific embodiments, NAS6 represents the nucleotide sequence shown in SEQ ID NO.28.

[0031] In some alternative embodiments, L1', L2', L3', L4' and L5' each independently represent a nucleotide sequence from the 5' end to the 3' end. , n' is selected from an integer from 1 to 4 (eg, 1, 2, 3 or 4).

[0032] In some specific embodiments, L1' represents the nucleotide sequence GGTGGTGGTGGTTCTGGTGGTGGTGGTTCT in the direction from the 5' end to the 3' end.

[0033] In some specific embodiments, L2' represents the nucleotide sequence GGTGGTGGTGGTTCT in the direction from the 5' end to the 3' end.

[0034] In some specific embodiments, L3' represents the nucleotide sequence GGTGGTGGTGGTTCT in the direction from the 5' end to the 3' end.

[0035] In some specific embodiments, L4' represents the nucleotide sequence GGTGGTGGTGGTTCT in the direction from the 5' end to the 3' end.

[0036] In some specific embodiments, L5' represents the nucleotide sequence GGTGGTGGTGGTTCTGGTGGTGGTGGTTCT in the direction from the 5' end to the 3' end.

[0037] In some optional embodiments, the nucleic acid molecule is selected from the nucleotide sequence shown in SEQ ID NO.33.

[0038] In some specific embodiments, the nucleic acid molecule is selected from the nucleotide sequence shown in SEQ ID NO.33.

[0039] In a third aspect, the present application provides a recombinant plasmid, wherein the recombinant plasmid comprises the nucleic acid molecule as described in the second aspect.

[0040] In a fourth aspect, the present application provides a gene expression vector, which comprises the nucleic acid molecule as described in the second aspect.

[0041] In a fifth aspect, the present application provides a virus-like particle of type O foot-and-mouth disease virus, wherein the virus-like particle comprises:

[0042] (I) a multi-epitope VP1 fusion protein, wherein the multi-epitope VP1 fusion protein is selected from the amino acid sequence shown in SEQ ID NO.11;

[0043] (II), VP0 protein, wherein the VP0 protein is selected from the amino acid sequence shown in SEQ ID NO.34;

[0044] (III) VP3 protein, wherein the VP3 protein is selected from the amino acid sequence shown in SEQ ID NO.37.

[0045] In a sixth aspect, the present application provides a polyclonal antibody, wherein the immunogen of the polyclonal antibody is selected from the virus-like particle described in the fourth aspect.

[0046] In a seventh aspect, the present application provides a nucleic acid molecule combination, the nucleic acid molecule combination comprising:

[0047] (I), a nucleic acid molecule expressing a multi-epitope VP1 fusion protein, which is selected from the nucleotide sequence shown in SEQ ID NO.33;

[0048] (II), a nucleic acid molecule expressing VP0 protein, which is selected from the nucleotide sequence shown in SEQ ID NO.36;

[0049] (III) A nucleic acid molecule expressing VP3 protein, which is selected from the nucleotide sequence shown in SEQ ID NO.39.

[0050] In an eighth aspect, the present application provides a recombinant plasmid combination, the recombinant plasmid combination comprising:

[0051] (I), a recombinant plasmid comprising the nucleotide sequence shown in SEQ ID NO.33 (for example, a recombinant plasmid comprising the nucleotide sequence shown in SEQ ID NO.33);

[0052] (II), a recombinant plasmid comprising the nucleotide sequence shown in SEQ ID NO.36;

[0053] (III) A recombinant plasmid comprising the nucleotide sequence shown in SEQ ID NO.39.

[0054] In a ninth aspect, the present application provides a gene expression vector combination, the gene expression vector combination comprising:

[0055] (I), a gene expression vector comprising the nucleotide sequence shown in SEQ ID NO.33;

[0056] (II), a gene expression vector comprising the nucleotide sequence shown in SEQ ID NO.36;

[0057] (III) A gene expression vector comprising the nucleotide sequence shown in SEQ ID NO.39.

[0058] In the tenth aspect, the present application provides a use of the multi-epitope VP1 fusion protein described in the first aspect, and / or the nucleic acid molecule described in the second aspect, and / or the recombinant plasmid described in the third aspect, and / or the gene expression vector described in the fourth aspect, and / or the virus-like particle described in the fifth aspect, and / or the polyclonal antibody described in the sixth aspect, and / or the nucleic acid molecule combination described in the seventh aspect, and / or the recombinant plasmid combination described in the eighth aspect, and / or the gene expression vector combination described in the ninth aspect in the preparation of an antibody product for detecting O-type foot-and-mouth disease virus, and / or a product for preventing diseases or conditions caused by O-type foot-and-mouth disease virus infection, and / or a product for treating diseases or conditions caused by O-type foot-and-mouth disease virus infection.

[0059] In the eleventh aspect, the present application provides a pharmaceutical composition, which comprises the multi-epitope VP1 fusion protein described in the first aspect, and / or the nucleic acid molecule described in the second aspect, and / or the recombinant plasmid described in the third aspect, and / or the gene expression vector described in the fourth aspect, and / or the virus-like particle described in the fifth aspect, and / or the polyclonal antibody described in the sixth aspect, and / or the nucleic acid molecule combination as described in the seventh aspect, and / or the recombinant plasmid combination as described in the eighth aspect, and / or the gene expression vector combination as described in the ninth aspect.

[0060] In the twelfth aspect, the present application provides a vaccine composition, which comprises the multi-epitope VP1 fusion protein described in the first aspect, and / or the nucleic acid molecule described in the second aspect, and / or the recombinant plasmid described in the third aspect, and / or the gene expression vector described in the fourth aspect, and / or the virus-like particle described in the fifth aspect, and / or the polyclonal antibody described in the sixth aspect, and / or the nucleic acid molecule combination as described in the seventh aspect, and / or the recombinant plasmid combination as described in the eighth aspect, and / or the gene expression vector combination as described in the ninth aspect.

[0061] In a thirteenth aspect, the present application provides a kit for detecting antibodies to type O foot-and-mouth disease virus based on an enzyme-linked immunosorbent assay, characterized in that it comprises a competing antigen and a labeled antibody;

[0062] The competing antigen is selected from the virus-like particle described in the fifth aspect;

[0063] The labeled antibody is selected from the polyclonal antibody described in the sixth aspect labeled with horseradish peroxidase.

[0064] In a fourteenth aspect, the present application provides a kit for detecting antibodies to type O foot-and-mouth disease virus based on a magnetic microparticle chemiluminescence method, characterized in that it comprises a competing antigen and a labeled antibody;

[0065] The competing antigen is selected from the biotin-labeled virus-like particle described in the fifth aspect;

[0066] The labeled antibody is selected from the polyclonal antibody described in the sixth aspect labeled with an acridinium ester.

[0067] This application has the following beneficial effects:

[0068] First, the present application fuses the four VP1 dominant antigenic epitopes of O-type foot-and-mouth disease virus into the VP1 protein of O-type foot-and-mouth disease virus Mya-98 strain, and uses amino acid point mutation technology to mutate the amino acid sites that affect the thermal stability and acid stability of the protein, thereby obtaining a VP1 fusion protein with good thermal stability and strong acid resistance. Then, based on the VP1 fusion protein, VP0 protein, and VP3 protein of O-type foot-and-mouth disease virus Mya-98 strain, the virus-like particles are self-assembled into virus-like particles, which have good specificity for three common topological types of O-type foot-and-mouth disease virus antibodies.

[0069] Second, the present application uses the virus-like particles described in the fourth aspect as competitive antigens and the polyclonal antibodies described in the fifth aspect as labeled antibodies, and establishes a method for detecting antibodies to type O foot-and-mouth disease virus based on the competition method. The method is not only simple to operate and time-saving, but also covers the main topological types of type O foot-and-mouth disease virus, avoiding missed detection, and has the advantages of strong specificity, high sensitivity, and good stability. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 This is the agarose gel electrophoresis diagram of the DNA in Example 4.

[0071] Figure 2 This is the SDS-PAGE electrophoresis diagram in Example 5. DETAILED DESCRIPTION

[0072] The present application discloses a multi-epitope VP1 fusion protein of type O foot-and-mouth disease virus, virus-like particles and polyclonal antibodies and their uses. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters for implementation. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all deemed to be included in this application. The methods and applications of this application have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of this application to implement and apply the technology of this application.

[0073] In order to make the purpose, technical solutions and advantages of the present application clearer, the implementation scheme of the present application will be further described in detail below in conjunction with examples.

[0074] Example 1, VP1 recombinant gene and VP1 fusion protein:

[0075] A typical FMDV-O type strain that has been published on the DNA sequence database GenBank and was once widely prevalent in my country was selected: O / GX / 09-7 strain (Cathay topology), and antigenic epitope prediction analysis was performed using the online tools Immunomedicine Group and SVMTriP. The results of antigenic epitope prediction analysis were compared with those of O / GX / 09-7 strain and O / MYA98 / BY / 2010 strain (GenBank: JN998085.1) for homology analysis, and amino acid fragments SEQ ID NO.2 and SEQ ID NO.3 with concentrated antigenic epitopes and obvious differences from the backbone strains were selected.

[0076] The VP1 amino acid sequence of the typical FMDV-O type strain O / PanAsia / TZ / 2011 (ME-SA topology-Pan-Asian lineage), which has been published on the DNA sequence database GenBank and was once widely prevalent in my country, was selected, and the antigenic epitope prediction analysis was performed using the online tools Immunomedicine Group and SVMTriP. The epitope prediction analysis results were compared with those of O / PanAsia / TZ / 2011 and O / MYA98 / BY / 2010 for homology analysis, and the amino acid fragments SEQ ID NO.4 and SEQ ID NO.5, which have concentrated antigenic epitopes and are significantly different from the backbone strains, were selected.

[0077] Among them, the amino acid sequence SEQ ID NO.2 corresponds to the nucleotide sequence SEQ ID NO.13;

[0078] The amino acid sequence SEQ ID NO.3 corresponds to the nucleotide sequence SEQ ID NO.14;

[0079] The amino acid sequence SEQ ID NO.4 corresponds to the nucleotide sequence SEQ ID NO.15;

[0080] The amino acid sequence SEQ ID NO.5 corresponds to the nucleotide sequence SEQ ID NO.16.

[0081] Gene recombination is performed based on the nucleotide sequences SEQ ID NO.13-16. The gene recombination methods include:

[0082] (1), SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, respectively;

[0083] (2), SEQ ID NO.12, SEQ ID NO.14, SEQ ID NO.15, respectively;

[0084] (3), SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.15, respectively;

[0085] (4), SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, respectively;

[0086] (5), SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, and SEQ ID NO.15, respectively.

[0087] The recombinant nucleotide sequence was inserted into the VP1 gene of the O / MYA98 / BY / 2010 strain between the 146th nucleotide and the 147th nucleotide starting from the 5' end (i.e., between the nucleotide sequence SEQ ID NO.12 and the nucleotide sequence SEQ ID NO.17); wherein, the two adjacent nucleotide fragments were connected by inserting a nucleotide fragment encoding a flexible connecting peptide ( , wherein n' can be selected from 1, 2, 3 or 4, etc.); and the obtained nucleotide sequence is subjected to A13T mutation and N17Y mutation to obtain VP1 recombinant gene SEQ ID NO.18-22.

[0088] Among them, the amino acid sequence SEQ ID NO.1 corresponds to the nucleotide sequence SEQ ID NO.12;

[0089] The amino acid sequence SEQ ID NO.6 corresponds to the nucleotide sequence SEQ ID NO.17.

[0090] The VP1 recombinant genes SEQ ID NOs. 18 to 22 were optimized according to the preferred codons of Escherichia coli to obtain codon-optimized VP1 recombinant genes SEQ ID NOs. 29 to 33.

[0091] Table 1. Sequence information of amino acid sequence:

[0092] Table 2. Sequence information of nucleotide sequences: , ,

[0093] Table 3. Sequence information of codon-optimized nucleotide sequences: , ,

[0094] Example 2, VP0 gene and VP0 protein:

[0095] The VP0 protein SEQ ID NO.34 of the FMDV-O type strain: O / MYA98 / BY / 2010 strain (GenBank: JN998085.1) was selected. Among them, the VP0 protein SEQ ID NO.34 corresponds to the VP0 gene SEQ ID NO.35. The VP0 gene SEQ ID NO.35 was optimized according to the preferred codons of Escherichia coli to obtain the codon-optimized VP0 gene SEQ ID NO.36.

[0096] Table 4. Sequence information of amino acid sequence:

[0097] Table 5. Sequence information of nucleotide sequence:

[0098] Example 3, VP3 gene and VP3 protein:

[0099] The VP3 protein SEQ ID NO. 37 of the FMDV-O type strain: O / MYA98 / BY / 2010 strain was selected. Among them, the VP3 protein SEQ ID NO. 37 corresponds to the VP3 gene SEQ ID NO. 38. The VP3 gene SEQ ID NO. 38 was optimized according to the preferred codons of Escherichia coli to obtain the codon-optimized VP3 gene SEQ ID NO. 39.

[0100] Table 6. Sequence information of amino acid sequence:

[0101] Table 7. Sequence information of nucleotide sequence:

[0102] Among them, this application takes VP1 recombinant gene SEQ ID NO. 29-33 as an example for the following experiments.

[0103] Restriction sites BamHI and XhoI were inserted into the two ends of the VP1 recombinant gene SEQ ID NO.29~33, VP0 gene SEQ ID NO.36 and VP3 gene SEQ ID NO.39 respectively; and the products were synthesized by General Biotechnology (Anhui) Co., Ltd. to obtain the recombinant plasmids pUC57-VP1(29), pUC57-VP1(30), pUC57-VP1(31), pUC57-VP1(32), pUC57-VP1(33), pUC57-VP0 and pUC57-VP3.

[0104] Table 8, nucleotide sequence information of BamHI and XhoI restriction sites:

[0105] Example 4, construction of recombinant plasmid:

[0106] The recombinant plasmids pUC57-VP1 (29), pUC57-VP1 (30), pUC57-VP1 (31), pUC57-VP1 (32), pUC57-VP1 (33), pUC57-VP0, and pUC57-VP3 were respectively connected to the SUMO expression vector pET28a-SUMO using double restriction enzyme digestion vector construction technology. Specifically, the following steps are included:

[0107] (4-1) According to the instructions of the restriction enzymes (purchased from Quanshijin Biotechnology Co., Ltd.), the recombinant plasmids pUC57-VP1(29), pUC57-VP1(30), pUC57-VP1(31), pUC57-VP1(32), pUC57-VP1(33), pUC57-VP0, and pUC57-VP3 were double-digested with BamHI / XhoI and the pET28a-SUMO expression vector.

[0108] (4-2) The products were subjected to agarose gel electrophoresis (120 v for 30 min) and the linearized recombinant plasmids pUC57-VP1(29), pUC57-VP1(30), pUC57-VP1(31), pUC57-VP1(32), pUC57-VP1(33), pUC57-VP0, pUC57-VP3 and pET28a-SUMO expression vector plasmid were recovered according to the agarose gel DNA recovery kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0109] (4-3) According to the instruction manual of T4 DNA ligase (purchased from Quanshijin Biotechnology Co., Ltd.), the linearized recombinant plasmids pUC57-VP1(29), pUC57-VP1(30), pUC57-VP1(31), pUC57-VP1(32), and pUC57-VP1(33) were ligated with the pET28a-SUMO expression vector, and the ligated products were named pET28a-SUMO-VP1(29), pET28a-SUMO-VP1(30), pET28a-SUMO-VP1(31), pET28a-SUMO-VP1(32), pET28a-SUMO-VP1(33), pET28a-SUMO-VP0, and pET28a-SUMO-VP3, respectively.

[0110] (4-4) The seven recombinant expression plasmids pET28a-SUMO-VP1(29), pET28a-SUMO-VP1(30), pET28a-SUMO-VP1(31), pET28a-SUMO-VP1(32), pET28a-SUMO-VP1(33), pET28a-SUMO-VP0 and pET28a-SUMO-VP3 were respectively transferred into BL21 (DE3) competent cells (purchased from Quanshijin Biotechnology Co., Ltd.) and cultured at 37°C and 200 rpm for 1 hour.

[0111] (4-5) Spread the culture evenly on LB agar plates (Kanamycin+) and culture at 37°C overnight.

[0112] (4-6) Select a monoclonal bacterium as a template, use the universal primers T7P / T7T of the pET28a-SUMO vector as primers, perform PCR amplification, and perform DNA agarose gel electrophoresis (120v 30min) on the amplified product.

[0113] Among them, DNA agarose gel electrophoresis diagram is as follows Figure 1 shown. Figure 1 In the figure, 1 represents the Marker lane, 2 represents the lane of the pET28a-SUMO vector, 3 represents the lane of the recombinant plasmid pET28a-SUMO-VP1(95), 4 represents the lane of the recombinant plasmid pET28a-SUMO-VP1(30), 5 represents the lane of the recombinant plasmid pET28a-SUMO-VP1(31), 6 represents the lane of the recombinant plasmid pET28a-SUMO-VP1(33), 7 represents the lane of the recombinant plasmid pET28a-SUMO-VP1(33), 8 represents the lane of the recombinant plasmid pET28a-SUMO-VP0, and 9 represents the lane of the recombinant plasmid pET28a-SUMO-VP3.

[0114] from Figure 1 It can be seen that the pET28a-SUMO vector showed a band of about 582 bp, the recombinant plasmid pET28a-SUMO-VP1 (29) showed a band of about 1486 bp, the recombinant plasmid pET28a-SUMO-VP1 (30) showed a band of about 1501 bp, the recombinant plasmid pET28a-SUMO-VP1 (31) showed a band of about 1486 bp, the recombinant plasmid pET28a-SUMO-VP1 (32) showed a band of about 1501 bp, the recombinant plasmid pET28a-SUMO-VP1 (33) showed a band of about 1561 bp, the recombinant plasmid pET28a-SUMO-VP0 showed a band of about 1177 bp, and the recombinant plasmid pET28a-SUMO-VP3 showed a band of about 1206 bp; thus confirming that the product fragment size was in line with expectations.

[0115] Table 9, sequence information of universal primers T7P / T7T:

[0116] Example 5, virus-like particles of O-type foot-and-mouth disease virus:

[0117] (5-1) Single colonies containing seven recombinant plasmids, namely pET28a-SUMO-VP1(29), pET28a-SUMO-VP1(30), pET28a-SUMO-VP1(31), pET28a-SUMO-VP1(32), pET28a-SUMO-VP1(33), pET28a-SUMO-VP0, and pET28a-SUMO-VP3, were picked out and added to 1 mL of LB liquid culture medium (Kanamycin+), and cultured at 37°C, 220 rpm for 1 hour for activation.

[0118] (5-2) Transfer the activated bacterial suspension into 100 mL of fresh LB liquid medium (Kanamycin+) and culture it in a constant temperature shaker at 220 rpm and 37°C overnight.

[0119] (5-3) OD measurement by spectrophotometer 600nm , when OD 600nm =0.6-0.8, add isopropyl-beta-D-thiogalactoside (CAS No. 367-93-1, abbreviated as IPTG) with a final concentration of 0.5 mM to induce expression, and express overnight at 16°C and 120 rpm.

[0120] (5-4) The bacterial solution was centrifuged at 8000 rpm for 5 min at 4°C, and the precipitate was collected and resuspended in 10 mL of PBS buffer (pH = 8.0). Lysozyme (CAS No. 9001-63-2) at a final concentration of 1 mg / mL was added and placed on ice for 30 min. The bacteria were then disrupted by low-temperature ultrasonication (ultrasonication time 6 s, 4 s interval, until the bacterial solution is clear, about 30 min).

[0121] (5-5) After disruption, centrifuge at 4°C and 12,000 rpm for 30 min, collect the supernatant, and take 100 μl of the supernatant for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

[0122] Among them, SDS-PAGE electrophoresis diagram is as follows Figure 2 shown.

[0123] Figure 2In the figure, 1 represents the lane of the protein expressed by the recombinant plasmid pET28a-SUMO-VP1 (29), 2 represents the lane of the protein expressed by the recombinant plasmid pET28a-SUMO-VP1 (30), 3 represents the lane of the protein expressed by the recombinant plasmid pET28a-SUMO-VP1 (31), 5 represents the lane of the protein expressed by the recombinant plasmid pET28a-SUMO-VP1 (32), 6 represents the lane of the protein expressed by the recombinant plasmid pET28a-SUMO-VP1 (33), 9 represents the lane of the Marker protein, 10 represents the lane of the protein expressed by the recombinant plasmid pET28a-SUMO-VP0, and 12 represents the lane of the protein expressed by the recombinant plasmid pET28a-SUMO-VP3.

[0124] from Figure 2 It can be seen that a protein band of about 66 KDa appeared in the supernatant of the bacterial solution of the recombinant plasmids pET28a-SUMO-VP1(29), pET28a-SUMO-VP1(30), pET28a-SUMO-VP1(31), pET28a-SUMO-VP1(32), and pET28a-SUMO-VP1(33), and the expected protein band size was 58 KDa; a protein band of about 50 KDa appeared in the supernatant of the recombinant plasmid pET28a-SUMO-VP0, and the expected protein band size was 43 KDa; a protein band of about 50 KDa appeared in the supernatant of the recombinant plasmid pET28a-SUMO-VP3, and the expected protein band size was 44 KDa. This is because the His tag has a strong positive charge, so the protein bands appearing in the SDS-PAGE electrophoresis are slightly larger than the expected protein bands.

[0125] Among them, the VP1 fusion protein expressed by the recombinant plasmid pET28a-SUMO-VP1(29) was named FMDV-O-VP1(29)-SUMO (its amino acid sequence is shown in SEQ ID NO.7);

[0126] The VP1 fusion protein expressed by the recombinant plasmid pET28a-SUMO-VP1(30) was named FMDV-O-VP1(30)-SUMO (its amino acid sequence is shown in SEQ ID NO. 8);

[0127] The VP1 fusion protein expressed by the recombinant plasmid pET28a-SUMO-VP1(31) was named FMDV-O-VP1(31)-SUMO (its amino acid sequence is shown in SEQ ID NO.9);

[0128] The VP1 fusion protein expressed by the recombinant plasmid pET28a-SUMO-VP1(32) was named FMDV-O-VP1(32)-SUMO (its amino acid sequence is shown in SEQ ID NO.10);

[0129] The VP1 fusion protein expressed by the recombinant plasmid pET28a-SUMO-VP1(33) was named FMDV-O-VP1(33)-SUMO (its amino acid sequence is shown in SEQ ID NO.11);

[0130] The VP0 protein expressed by the recombinant plasmid pET28a-SUMO-VP0 was named FMDV-O-VP0-SUMO (its amino acid sequence is shown in SEQ ID NO. 34);

[0131] The VP3 protein expressed by the recombinant plasmid pET28a-SUMO-VP3 was named FMDV-O-VP3-SUMO (its amino acid sequence is shown in SEQ ID NO.37).

[0132] (5-6) The bacterial supernatant is purified by nickel ion metal chelate affinity chromatography to collect the target protein.

[0133] (5-7) Self-assembly of virus-like particles of foot-and-mouth disease virus type O:

[0134] The purified protein was mixed in an equal volume ratio, SUMO protease was added, and the reaction was carried out at 25°C for 1 hour to separate the His tag and SUMO tag from the target protein; then, the protein solution was transferred to a 20KD ultrafiltration tube, centrifuged at 4°C and 3000rpm for 5 minutes, and centrifuged multiple times until about 4 mL of liquid remained in the 20KD ultrafiltration tube; the pH value of the ultrafiltration purified protein solution was adjusted to 8.0, and it was allowed to stand at 4°C for 2 hours, and the protein self-assembled into virus-like particles of type O foot-and-mouth disease virus.

[0135] Among them, three proteins, FMDV-O-VP1(29)-SUMO, FMDV-O-VP0-SUMO, and FMDV-O-VP3-SUMO, self-assembled into virus-like particles I of type O foot-and-mouth disease virus;

[0136] The three proteins FMDV-O-VP1(31)-SUMO, FMDV-O-VP0-SUMO, and FMDV-O-VP3-SUMO automatically assembled into virus-like particles II of type O foot-and-mouth disease virus;

[0137] The three proteins FMDV-O-VP1(32)-SUMO, FMDV-O-VP0-SUMO, and FMDV-O-VP3-SUMO automatically assembled into virus-like particles III of type O foot-and-mouth disease virus;

[0138] The three proteins FMDV-O-VP1(33)-SUMO, FMDV-O-VP0-SUMO and FMDV-O-VP3-SUMO automatically assembled into virus-like particles IV of type O foot-and-mouth disease virus.

[0139] Example 6, Preparation of polyclonal antibodies:

[0140] Two-month-old female New Zealand rabbits were immunized with virus-like particles of type O foot-and-mouth disease virus as immunogens. For the first immunization, 1 mg of virus-like particles was emulsified with an equal amount of Freund's complete adjuvant and injected subcutaneously at multiple points on the back; booster immunization was performed every two weeks, with 1 mg of fusion protein emulsified with an equal amount of Freund's incomplete adjuvant and injected subcutaneously at multiple points on the back; one week after the third booster immunization, blood was collected from the ear vein of the rabbit and centrifuged at 12000r / min for 5 minutes to obtain serum containing polyclonal antibodies.

[0141] The virus-like particles of type O foot-and-mouth disease virus are used as the coating source, the serum containing polyclonal antibodies is used as the antibody to be tested, and the goat anti-rabbit antibody labeled with horseradish peroxidase is used as the secondary antibody; when the titer of the serum containing the polyclonal antibody is measured to be greater than 1:10000, blood is collected from the heart, left to stand at room temperature overnight, centrifuged at 12000r / min for 20min, the serum is retained, and the serum is treated with ammonium sulfate precipitation method to obtain the polyclonal antibody.

[0142] Among them, virus-like particles I of type O foot-and-mouth disease virus automatically assembled by FMDV-O-VP1(29)-SUMO, FMDV-O-VP0-SUMO and FMDV-O-VP3-SUMO were used as immunogens to obtain polyclonal antibodies I;

[0143] Using virus-like particles II of type O foot-and-mouth disease virus that are automatically assembled by FMDV-O-VP1(31)-SUMO, FMDV-O-VP0-SUMO and FMDV-O-VP3-SUMO as immunogens, polyclonal antibodies II were obtained;

[0144] Using virus-like particles III of type O foot-and-mouth disease virus that are automatically assembled from FMDV-O-VP1(32)-SUMO, FMDV-O-VP0-SUMO and FMDV-O-VP3-SUMO as immunogens, polyclonal antibodies III were obtained;

[0145] The virus-like particle IV of type O foot-and-mouth disease virus, which was automatically assembled by FMDV-O-VP1(33)-SUMO, FMDV-O-VP0-SUMO and FMDV-O-VP3-SUMO, was used as an immunogen to obtain polyclonal antibody IV.

[0146] Example 7, kit for detecting antibodies to type O foot-and-mouth disease virus based on enzyme-linked immunosorbent assay:

[0147] In this embodiment, the main components of the kit for detecting antibodies to type O foot-and-mouth disease virus based on enzyme-linked immunosorbent assay are: virus-like particle antigen-coated plate of type O foot-and-mouth disease virus (referred to as antigen-coated plate), horseradish peroxidase (HRP)-labeled polyclonal antibody (referred to as enzyme-labeled antibody), positive quality control product, negative quality control product, sample diluent, washing solution, chromogenic substrate solution A, chromogenic substrate solution B, and stop solution.

[0148] Among them, the preparation process of the antigen-coated plate is as follows: use CBS buffer (pH=9.6) to dilute the virus-like particles of type O foot-and-mouth disease virus into a coating solution with a final concentration of 1μg / mL, add the coating solution to the ELISA plate, 100μL / well, coat at 4°C for 16h, and discard the solution in the wells of the ELISA plate; add PBST buffer (0.05% Tween-20, pH=7.4) for washing, 300μL / well, wash 5 times, 3min / time; add OVA blocking solution to the ELISA plate, 200μL / well, block at 37°C for 2h, discard the solution in the wells of the ELISA plate; add PBST buffer (0.05% Tween-20, pH=7.4) for washing, 300μL / well, wash 5 times, 3min / time; obtain the antigen-coated plate.

[0149] OVA blocking solution: Chicken ovalbumin (OVA) was diluted with PBS buffer (pH=7.4), and the concentration of OVA blocking solution was 2% (mass-to-volume ratio w / v).

[0150] Colorimetric substrate solution A: 13.6 g sodium acetate, 1.6 g citric acid, 0.3 mL 30% (wt) hydrogen peroxide, add distilled water to make up to 500 mL.

[0151] Colorimetric substrate solution B: 0.2 g of disodium ethylenediaminetetraacetate, 0.95 g of citric acid, 50 mL of glycerol, 3,3',5,5'-tetramethylbenzidine (0.15 g) in DMSO (3 mL), add distilled water to make up to 500 mL.

[0152] Stop solution: H2SO4.

[0153] In this embodiment, the working principle of the kit for detecting O-type foot-and-mouth disease virus antibodies based on enzyme-linked immunosorbent assay is as follows: a competitive method is used to determine whether the sample to be tested contains O-type foot-and-mouth disease virus antibodies. The virus-like particles of the O-type foot-and-mouth disease virus are used as antigens and coated in the wells of the enzyme-labeled plate to make an antigen-coated plate. The sample to be tested and the enzyme-labeled antibody are added to the antigen-coated plate, and the O-type foot-and-mouth disease virus antibodies and the enzyme-labeled antibody in the sample to be tested competitively bind to the virus-like particles of the O-type foot-and-mouth disease virus on the antigen-coated plate, and form antigen-enzyme-labeled antibody complexes respectively. After washing, the O-type foot-and-mouth disease virus antibodies and the enzyme-labeled antibody complexes in the sample to be tested are washed away, and the antigen and enzyme-labeled antibody complexes bound to the antigen-coated plate are retained; then a color developing solution is added, and 3,3',5,5'-tetramethylbenzidine is converted into blue under the catalytic action of HRP, and finally converted into yellow under the action of the stop solution. The depth of color is negatively correlated with the content of O-type foot-and-mouth disease virus antibodies in the sample to be tested; the absorbance (OD value) is measured at a wavelength of 450nm using an enzyme marker, and the OD value is used to calculate whether the sample to be tested contains O-type foot-and-mouth disease virus antibodies.

[0154] The working process of the kit for detecting antibodies to type O foot-and-mouth disease virus based on enzyme-linked immunosorbent assay specifically includes the following steps:

[0155] (7-1) Preparation of the sample to be tested: dilute the sample to be tested 10 times with PBST buffer (0.05% by volume Tween-20, pH = 7.4); specifically: 20 μL of serum sample to be tested, 180 μL of PBST buffer;

[0156] (7-2) Incubation: Add negative control, positive control and sample to be tested to the antigen-coated plate, 10 μL / well, then add ELISA antibody, 90 μL / well, and mix well; seal the ELISA plate with a sealing film and incubate at 37°C for 30 min;

[0157] The enzyme-labeled antibody was prepared by diluting the HRP-labeled polyclonal antibody with PBST buffer (0.05% by volume Tween-20, pH = 7.4) at a dilution ratio of 1:8000 (mass to volume ratio w / v);

[0158] (7-3) Washing: Discard the solution in the antigen-coated plate wells and add PBST buffer (0.05% Tween-20, pH = 7.4) for washing, 300 μL / well, wash 5 times, 3 min / time;

[0159] (7-4) Color development and termination: Add TMB color development solution (prepared with color development substrate solution A and color development substrate solution B in a volume ratio of 1:1) to the antigen-coated plate, 100 μL / well, mix well, and develop color at 37°C in the dark for 15 min; then add 2M concentrated sulfuric acid, 50 μL / well, and gently shake the plate until the color is evenly developed;

[0160] (7-5) Reading: Place the antigen-coated plate in the microplate reader, and read the absorbance OD value at a dual wavelength of 450 nm for the test wavelength and 630 nm for the reference wavelength. The OD value of the negative control is recorded as the ODN value, the OD value of the positive control is recorded as the ODP value, and the OD value of the sample to be tested is recorded as the ODS value.

[0161] Test establishment conditions: ODN value>0.5 and ODP value<0.2, the test result is valid; otherwise, retest.

[0162] Result determination: if the OD value of the sample to be tested / ODN value of the negative control is ≤ 0.20, the result is considered positive;

[0163] If the OD value of the sample to be tested / ODN value of the negative control is greater than 0.3, the result is considered negative;

[0164] If 0.2<OD value of the sample to be tested / ODN value of the negative control ≤0.30, the result is judged as suspicious; if the OD value of the sample to be tested is retested and the retested OD value / ODN value of the negative control ≤0.20, the result is judged as positive; if the retested OD value / ODN value of the negative control is>0.30, it is judged as negative.

[0165] Example 8, a kit for detecting antibodies to type O foot-and-mouth disease virus based on magnetic microparticle chemiluminescence method:

[0166] In this embodiment, the working principle of the kit for detecting O-type foot-and-mouth disease virus antibodies based on magnetic particle chemiluminescence is as follows: the competitive immunological principle is combined with the magnetic particle separation technology, the sample to be tested is mixed and incubated with the biotin-labeled O-type foot-and-mouth disease virus virus-like particles, the acridinium ester-labeled polyclonal antibodies and the streptavidin magnetic beads, the O-type foot-and-mouth disease virus antibodies and the polyclonal antibodies in the sample to be tested are competitively combined with the biotin-labeled O-type foot-and-mouth disease virus virus-like particles to form immune complexes, respectively, and the immune complexes are formed. After washing to remove unbound impurities, an excitation solution is added to induce the immune complexes to emit light, and the relative luminescence intensity (RLU) is measured. Within a certain range, RLU is inversely proportional to the titer of O-type foot-and-mouth disease virus antibodies, and RLU and the corresponding O-type foot-and-mouth disease virus antibody titer are output through the built-in standard curve of the instrument.

[0167] In this embodiment, the main components of the kit for detecting O-type foot-and-mouth disease virus antibodies based on the magnetic particle chemiluminescence method are: magnetic bead working solution, antigen working solution, acridinium ester marker working solution, pre-excitation solution, excitation solution, calibrator, positive quality control product, and negative quality control product.

[0168] Magnetic bead working solution: prepared from 225uL of streptavidin affinity magnetic beads and 4275μL of PBS-BSA solution (pH=7.4).

[0169] Antigen working solution: prepared from 100ug of biotin-labeled virus-like particles of type O foot-and-mouth disease virus and 9900μL of PBS-BSA solution (pH=7.4).

[0170] Acridinium ester label working solution: prepared by 1.5ug of acridinium ester labeled polyclonal antibody and 10mL of PBS-BSA solution (pH=7.4).

[0171] Pre-stimulation solution: 0.1 mol / L nitric acid, 0.13 mol / L urea peroxide, and normal saline.

[0172] Exciting solution: 0.4 mol / L sodium hydroxide, 0.02 mol / L Triton X-100 (English name: Tritonx-100, CAS number: 9002-93-1), and normal saline.

[0173] The working process of detecting foot-and-mouth disease-O virus antibodies based on magnetic particle chemiluminescence method specifically includes the following steps:

[0174] 10 μL of the sample to be tested, 50 μL of antigen working solution, 20 μL of magnetic bead working solution and 50 μL of acridinium ester marker working solution were mixed evenly, reacted at 37°C for 15 min, washed with 0.1 mol / L PBST buffer solution, 100 μL of pre-excitation solution and 100 μL of excitation solution were added, and the RLU value was detected.

[0175] Establishment of standard curve: The neutralizing antibody titer of O-type foot-and-mouth disease virus antibody-positive serum detected by the antibody neutralization experimental method in GB / T 18935-2018 "Foot-and-mouth disease diagnostic technology" was 1:8192, and the O-type foot-and-mouth disease virus antibody-positive serum was diluted 2-fold using specific pathogen-free (SPF) pig serum as a diluent to obtain positive sera with neutralizing antibody titers of 1:4096, 1:2048, 1:1024, 1:512, 1:256, 1:128, 1:64, 1:32, 1:16, and 1:8, respectively.

[0176] Positive sera with neutralizing antibody titers of 1:512, 1:256, 1:128, 1:64, 1:32, and 1:16 were selected as calibrators, which were respectively recorded as calibrator 1, calibrator 2, calibrator 3, calibrator 4, calibrator 5, and calibrator 6. During the test, they were added in sequence, and the instrument automatically recognized the test to generate a standard curve.

[0177] Conditions for the test to be established: the titer of the antibody of the positive control product is between 1:512 and 1:2048, and the titer of the antibody of the negative control product is less than 1:8.

[0178] Quantitative result determination: The instrument automatically enters the standard curve for calculation, and the displayed result is the neutralizing antibody titer of the sample to be tested.

[0179] Qualitative result determination: When the neutralizing antibody titer is ≥1:128, it is determined to be positive for type O foot-and-mouth disease virus antibody;

[0180] When the neutralizing antibody titer is ≤1:64, it is determined to be negative for type O foot-and-mouth disease virus antibody;

[0181] When the neutralizing antibody titer is 1:64≤≤≤1:128, it is judged as suspicious; re-test the neutralizing antibody titer of the sample to be tested. When the re-tested neutralizing antibody titer is ≥1:128, it is judged as positive; when the re-tested neutralizing antibody titer is <1:128, it is judged as negative.

[0182] Efficacy test of the kit:

[0183] Sensitivity testing:

[0184] The kit for detecting O-type foot-and-mouth disease virus antibodies based on enzyme-linked immunosorbent assay, the kit for detecting O-type foot-and-mouth disease virus antibodies based on magnetic microparticle chemiluminescence immunoassay and the liquid phase blocking ELISA detection kit for O-type foot-and-mouth disease virus antibodies were used to detect the sensitivity control products respectively. Among them, the sensitivity control products were prepared by 2-fold gradient dilution of O-type foot-and-mouth disease virus antibody positive serum with known neutralizing antibody titer, and the neutralizing antibody titers of the sensitivity control products were 1:8192, 1:4096, 1:2048, 1:1024, 1:512, 1:256, 1:128, 1:64, 1:32, 1:16, and 1:8 respectively.

[0185] Among them, the sensitivity test results of the kit for detecting O-type foot-and-mouth disease virus antibodies based on enzyme-linked immunosorbent assay in this application are shown in Table 10.

[0186] Table 10, sensitivity test results of the kit for detecting O-type foot-and-mouth disease virus antibodies based on enzyme-linked immunosorbent assay in this application:

[0187] Among them, the sensitivity test results of the kit for detecting O-type foot-and-mouth disease virus antibodies based on the magnetic particle chemiluminescence immunoassay of the present application are shown in Table 11.

[0188] Table 11, sensitivity test results of the kit for detecting O-type foot-and-mouth disease virus antibodies based on magnetic microparticle chemiluminescence immunoassay of the present application:

[0189] Among them, the sensitivity test results of a certain foot-and-mouth disease type O antibody liquid phase blocking ELISA detection kit are shown in Table 12.

[0190] Table 12, Sensitivity test results of a certain foot-and-mouth disease O-type antibody liquid phase blocking ELISA test kit:

[0191] From Tables 10 to 12, it can be seen that the sensitivity of the kit for detecting O-type foot-and-mouth disease virus antibodies based on enzyme-linked immunosorbent assay and the kit for detecting O-type foot-and-mouth disease virus antibodies based on magnetic particle chemiluminescence immunoassay are significantly better than the sensitivity of the liquid phase blocking ELISA detection kit for foot-and-mouth disease virus O-type antibodies.

[0192] Specificity (cross-reactivity) tests:

[0193] Using virus-like particles IV as competitive antigens and polyclonal antibodies IV as labeled antibodies, the kit for detecting antibodies to type O foot-and-mouth disease virus based on enzyme-linked immunosorbent assay and the kit for detecting antibodies to type O foot-and-mouth disease virus based on magnetic microparticle chemiluminescent immunoassay were used to detect antibody-positive serum of type A foot-and-mouth disease virus, type Asia I foot-and-mouth disease virus, swine fever virus, porcine reproductive and respiratory syndrome virus, and canine parvovirus, respectively. The specific detection results are shown in Table 13.

[0194] Table 13, specificity test results:

[0195] It can be seen from Table 13 that the kit for detecting O-type foot-and-mouth disease virus antibodies based on enzyme-linked immunosorbent assay and the kit for detecting O-type foot-and-mouth disease virus antibodies based on magnetic particle chemiluminescence immunoassay have no cross-reaction with antibodies of other susceptible animal viruses.

[0196] Compliance test:

[0197] Using virus-like particles IV as competing antigens and polyclonal antibodies IV as labeled antibodies, the kit for detecting O-type foot-and-mouth disease virus antibodies based on enzyme-linked immunosorbent assay of the present application, the kit for detecting O-type foot-and-mouth disease virus antibodies based on magnetic particle chemiluminescence immunoassay of the present application, and the foot-and-mouth disease O-type antibody liquid phase blocking ELISA detection kit were used to simultaneously detect 326 clinical samples of foot-and-mouth disease.

[0198] Among them, the compliance test results of the kit for detecting O-type foot-and-mouth disease virus antibodies based on enzyme-linked immunosorbent assay in this application are shown in Table 14.

[0199] Table 14, specific detection results of the kit for detecting O-type foot-and-mouth disease virus antibodies based on enzyme-linked immunosorbent assay in this application:

[0200] Among them, the specific detection results of the kit for detecting O-type foot-and-mouth disease virus antibodies based on magnetic particle chemiluminescence immunoassay in this application are shown in Table 15.

[0201] Table 15. Test results of the compliance rate of the kit for detecting type O foot-and-mouth disease virus antibodies based on the magnetic microparticle chemiluminescence immunoassay of the present application:

[0202] Combining Table 14 and Table 15, it can be seen that compared with the standard method for detecting foot-and-mouth disease virus antibodies recommended by the World Organization for Animal Health (WOAH) and the international trade designated method - liquid blocking ELISA method, the compliance rate of the kit for detecting O-type foot-and-mouth disease virus antibodies based on enzyme-linked immunosorbent assay in this application is 97.46%, and the compliance rate of the kit for detecting O-type foot-and-mouth disease virus antibodies based on magnetic particle chemiluminescence immunoassay in this application is 98.10%.

[0203] The above is a detailed introduction to a multi-epitope VP1 fusion protein of type O foot-and-mouth disease virus, virus-like particles and polyclonal antibodies and their uses provided by the present application. This article uses specific examples to illustrate the principles and implementation methods of the present application. The description of the above embodiments is only used to help understand the method of the present application and its core idea. It should be pointed out that for those skilled in the art, without departing from the principles of the present application, several improvements and modifications can be made to the present application, and these improvements and modifications also fall within the scope of protection of the claims of the present application.

Claims

1. A multi-epitope VP1 fusion protein of O-type foot-and-mouth disease virus, characterized in that: The multi-epitope VP1 fusion protein is selected from the structure shown in formula (I): ； Wherein, AAS1 represents the amino acid sequence as shown in SEQ ID NO.1, and / or the amino acid sequence obtained by substituting, deleting or adding one or more bases of the amino acid sequence as shown in SEQ ID NO.1; AAS2, AAS3, AAS4 and AAS5 each independently represent an amino acid sequence as shown in any one of SEQ ID NOs. 2 to 5, and AAS2, AAS3, AAS4 and AAS5 each represent a different amino acid sequence; AAS6 represents the amino acid sequence as shown in SEQ ID NO.6, and / or the amino acid sequence obtained by substituting, deleting or adding one or more bases of the amino acid sequence as shown in SEQ ID NO.6; L1, L2, L3, L4 and L5 each independently represent a flexible linking peptide.

2. The multi-epitope VP1 fusion protein according to claim 1, characterized in that: L1, L2, L3, L4, L5 and L6 each independently represent the amino acid sequence from the N-terminus to the C-terminus , n is selected from an integer from 1 to 4.

3. The multi-epitope VP1 fusion protein according to claim 1 or 2, characterized in that: The multi-epitope VP1 fusion protein is selected from the amino acid sequence shown in SEQ ID NO.

11.

4. A nucleic acid molecule, characterized in that The nucleic acid molecule comprises the structure shown in formula (II): ； Wherein, NAS1 represents the nucleotide sequence as shown in SEQ ID NO.23, and / or the nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence as shown in SEQ ID NO.23; NAS2, NAS3, NAS4 and NAS5 each independently represent a nucleotide sequence as shown in any one of SEQ ID NOs. 24 to 27, and NAS2, NAS3, NAS4 and NAS5 each represent a different nucleotide sequence; NAS6 represents the nucleotide sequence shown in SEQ ID NO.28, and / or a nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in SEQ ID NO.28; L1', L2', L3', L4' and L5' each independently represent a nucleotide sequence encoding a flexible connecting peptide.

5. The nucleic acid molecule according to claim 4, characterized in that L1', L2', L3', L4' and L5' each independently represent the nucleotide sequence from the 5' end to the 3' end , n' is selected from an integer from 1 to 4.

6. The nucleic acid molecule according to claim 4 or 5, characterized in that The coding gene is selected from the nucleotide sequence shown in SEQ ID NO.

33.

7. A recombinant plasmid, characterized in that: The recombinant plasmid comprises the nucleic acid molecule according to any one of claims 4 to 6.

8. A gene expression vector, characterized in that: The gene expression vector comprises the nucleic acid molecule according to any one of claims 4 to 6.

9. A virus-like particle of O-type foot-and-mouth disease virus, characterized in that: The virus-like particle comprises: (I) a multi-epitope VP1 fusion protein, wherein the multi-epitope VP1 fusion protein is selected from the amino acid sequence shown in SEQ ID NO.11; (II), VP0 protein, wherein the VP0 protein is selected from the amino acid sequence shown in SEQ ID NO.34; (III) VP3 protein, wherein the VP3 protein is selected from the amino acid sequence shown in SEQ ID NO.

37.

10. A polyclonal antibody against type O foot-and-mouth disease virus, characterized in that: The immunogen of the polyclonal antibody is selected from the virus-like particle according to claim 9.

11. A nucleic acid molecule combination, characterized in that: The nucleic acid molecule combination comprises: (I), a nucleic acid molecule expressing a multi-epitope VP1 fusion protein, which is selected from the nucleotide sequence shown in SEQ ID NO.33; (II), a nucleic acid molecule expressing VP0 protein, which is selected from the nucleotide sequence shown in SEQ ID NO.36; (III) A nucleic acid molecule expressing VP3 protein, which is selected from the nucleotide sequence shown in SEQ ID NO.

39.

12. A recombinant plasmid combination, characterized in that: The recombinant plasmid combination comprises: (I), a recombinant plasmid comprising the nucleotide sequence shown in SEQ ID NO.33; (II), a recombinant plasmid comprising the nucleotide sequence shown in SEQ ID NO.36; (III) A recombinant plasmid comprising the nucleotide sequence shown in SEQ ID NO.

39.

13. A gene expression vector combination, characterized in that: The gene expression vector combination comprises: (I), a gene expression vector comprising the nucleotide sequence shown in SEQ ID NO.33; (II), a gene expression vector comprising the nucleotide sequence shown in SEQ ID NO.36; (III) A gene expression vector comprising the nucleotide sequence shown in SEQ ID NO.

39.

14. Use of the multi-epitope VP1 fusion protein as described in any one of claims 1 to 3, and / or the nucleic acid molecule as described in any one of claims 4 to 6, and / or the recombinant plasmid as described in claim 7, and / or the gene expression vector as described in claim 8, and / or the virus-like particle as described in claim 9, and / or the polyclonal antibody as described in claim 10, and / or the nucleic acid molecule combination as described in claim 11, and / or the recombinant plasmid combination as described in claim 12, and / or the gene expression vector combination as described in claim 13 in the preparation of an antibody product for detecting O-type foot-and-mouth disease virus, and / or a product for preventing diseases or conditions caused by O-type foot-and-mouth disease virus infection, and / or a product for treating diseases or conditions caused by O-type foot-and-mouth disease virus infection.

15. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the multi-epitope VP1 fusion protein as described in any one of claims 1 to 3, and / or the nucleic acid molecule as described in any one of claims 4 to 6, and / or the recombinant plasmid as described in claim 7, and / or the gene expression vector as described in claim 8, and / or the virus-like particle as described in claim 9, and / or the polyclonal antibody as described in claim 10, and / or the nucleic acid molecule combination as described in claim 11, and / or the recombinant plasmid combination as described in claim 12, and / or the gene expression vector combination as described in claim 13.

16. A vaccine composition, characterized in that The vaccine composition comprises the multi-epitope VP1 fusion protein as described in any one of claims 1 to 3, and / or the nucleic acid molecule as described in any one of claims 4 to 6, and / or the recombinant plasmid as described in claim 7, and / or the gene expression vector as described in claim 8, and / or the virus-like particle as described in claim 9, and / or the polyclonal antibody as described in claim 10, and / or the nucleic acid molecule combination as described in claim 11, and / or the recombinant plasmid combination as described in claim 12, and / or the gene expression vector combination as described in claim 13.

17. A kit for detecting antibodies to type O foot-and-mouth disease virus based on enzyme-linked immunosorbent assay, characterized in that: It includes a competing antigen and a labeled antibody; The competing antigen is selected from the virus-like particle according to claim 9; The labeled antibody is selected from the polyclonal antibody as claimed in claim 10 labeled with horseradish peroxidase.

18. A kit for detecting antibodies to type O foot-and-mouth disease virus based on magnetic particle chemiluminescence, characterized in that: It includes a competing antigen and a labeled antibody; The competing antigen is selected from the biotin-labeled virus-like particle of claim 9; The labeled antibody is selected from the polyclonal antibody of claim 10 labeled with an acridinium ester.

Images