Schizochytrium genetic engineering strain that reshapes the FAS pathway, construction method and application

Abstract

The present invention discloses a Schizochytrium genetic engineering strain that reshapes the FAS pathway, a construction method and an application. The Schizochytrium genetic engineering strain of the present invention is obtained by heterologously expressing the C16 elongase gene E16, the C18 elongase gene E18, the Δ9 desaturase gene D9, the Δ5 desaturase gene D5, the Δ6 desaturase gene D6, and the Δ15 desaturase gene D15 in the wild-type Schizochytrium. The recombinant Schizochytrium described in the present invention can produce EPA accounting for 2.08% of the total fatty acids, and can also produce at least DHA accounting for more than 41% of the total fatty acids. In addition, the present invention claims a method for producing unsaturated fatty acids through the dual-pathway channels of PKS and FAS, which is beneficial to promoting the popularization and application of the technology for Schizochytrium to produce EPA and DHA.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology. More specifically, the present invention relates to a Schizochytrium genetic engineering strain that remodels the FAS pathway, a construction method, and applications thereof. Background Art

[0002] Microbial oil, also known as single cell oil (SCO), refers to the process by which microorganisms synthesize oil through metabolic pathways and enzymatic catalytic reactions. Although the biosynthetic pathways of different microorganisms may vary to some extent, they generally involve four key steps: (1) Substrate supply. The biosynthesis of SCO usually depends on substrate supply, such as carbon sources like glucose, glycerol, and cellulose; (2) Fatty acid synthesis. Carbon sources are utilized to participate in metabolism and are converted into Acetyl-CoA, and fatty acid chains are gradually synthesized through a series of enzymatic catalytic reactions; (3) Triacylglycerol synthesis. After the fatty acid chains are synthesized, they are combined with glycerol molecules through enzymatic catalytic reactions to form triacylglycerol (TAG); (4) Oil accumulation. Microorganisms accumulate large amounts of oil to store energy and adapt to environmental changes. It should be noted that because different organisms have different metabolic pathways and regulatory mechanisms, the biosynthetic pathways of oil may vary to some extent. For example, yeast synthesizes oil through the fatty acid synthase (FAS) pathway of yeast cells; at the same time, some marine microorganisms such as microalgae, deep-sea bacteria, and marine fungi synthesize oil through the polyketide synthases (PKS) pathway (Jia et al., 2023).

[0003] Eicosapentaenoic acids (EPA), known as the "vascular scavenger", are ω-3 polyunsaturated fatty acids that are crucial for human health and have physiological functions such as preventing cardiovascular diseases, regulating blood lipids, preventing Alzheimer's disease, anti-inflammation, and anti-cancer. They are widely used in industries such as food, medicine, and feed. The traditional source of EPA is deep-sea fish oil, but due to factors such as overfishing and environmental pollution, the output of fish oil has been decreasing year by year and cannot meet the market demand for EPA. Seeking green and sustainable production routes is a key issue that urgently needs to be solved currently. Producing EPA through the fermentation of microorganisms (fungi, microalgae, bacteria) has become the main alternative source for EPA production. However, common EPA-producing microorganisms have a long fermentation cycle and require specific culture conditions such as low temperature, high pressure, light, etc. to accumulate large amounts of EPA, which greatly limits the industrial production of EPA.

[0004] Schizochytrium is a marine heterotrophic microorganism with the advantages of fast growth rate, high production of polyunsaturated fatty acids (PUFAs), and few by-products, making it a candidate strain for EPA production. Currently, research on Schizochytrium for EPA production mainly focuses on the engineering transformation of the PKS pathway and the optimization of fermentation engineering. For example, in patent CN119120230A, by replacing the key catalytic domain in the Schizochytrium PKS pathway with the corresponding functional domain in the heterologous EPA-type PKS pathway, the resulting genetically engineered strain can improve the proportion of EPA; in patent CN119081889A, by adding an exogenous factor - gingerol, the production of EPA in Schizochytrium is effectively increased; in patent CN116179584A, by overexpressing the genes AT, KS, or AT-KS in the MetE-like domain in the wild type of Schizochytrium, the accumulation of EPA is significantly increased. However, it is worth noting that compared with other oil-producing microorganisms, Schizochytrium has abundant precursor supply (NADPH and acetyl coenzyme A) and substrate support (the proportion of palmitic acid can reach more than 20% of the total fatty acids). However, due to the incomplete endogenous FAS pathway, it is difficult to achieve the synthesis of unsaturated fatty acids based on the FAS pathway. Summary of the Invention

[0005] An object of the present invention is to provide a genetically engineered Schizochytrium strain with a reshaped FAS pathway, enabling the genetically engineered Schizochytrium strain to biosynthesize EPA using the FAS pathway.

[0006] To achieve these and other advantages in accordance with the present invention, there is provided a genetically engineered Schizochytrium strain with a reshaped FAS pathway, which is obtained by heterologously expressing the C16 elongase gene E16, the C18 elongase gene E18, the Δ9 desaturase gene D9, the Δ5 desaturase gene D5, the Δ6 desaturase gene D6, and the Δ15 desaturase gene D15 in the wild type of Schizochytrium;

[0007] The nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 1;

[0008] The nucleotide sequence of the C18 elongase gene E18 is SEQ ID NO: 2;

[0009] The nucleotide sequence of the Δ9 desaturase gene D9 is SEQ ID NO: 3;

[0010] The nucleotide sequence of the Δ5 desaturase gene D5 is SEQ ID NO: 4;

[0011] The nucleotide sequence of the Δ6 desaturase gene D6 is SEQ ID NO: 5;

[0012] The nucleotide sequence of the Δ15 desaturase gene D15 is SEQ ID NO: 6.

[0013] Preferably, the wild type of Schizochytrium is Aurantiochytrium limacinum SR21.

[0014] Preferably, the C16 elongase gene E16 is from Mortierella alpina , the C18 elongase gene E18 is from Euglena gracilis , the Δ9 desaturase gene D9 is from Parietichytrium sp. , the Δ5 desaturase gene D5 is from Thraustochytrium sp. , the Δ6 desaturase gene D6 is from Pythium aphanidermatum , the Δ15 desaturase gene D15 is from Pythium aphanidermatum .

[0015] The present invention also provides the application of the above Schizochytrium genetic engineering strain in the production of EPA.

[0016] The present invention also provides a method for constructing the above Schizochytrium engineering strain, comprising the following steps:

[0017] S1. Using plasmid pC322-GFP as a backbone, inserting the C16 elongase gene E16 into this backbone to obtain the recombinant plasmid pCA322-E16;

[0018] S2. Using the recombinant plasmid pCA322-E16 as a backbone, inserting the Δ9 desaturase gene D9 into this backbone to obtain the recombinant plasmid pCA322-E16-D9;

[0019] S3. Using the recombinant plasmid pCA322-E16-D9 as a backbone, inserting the C18 elongase gene E18 into this backbone to obtain the recombinant plasmid pCA322-E16-E18-D9;

[0020] S4. Removing the Δ9 desaturase gene D9 from the recombinant plasmid pCA322-E16-E18-D9 to obtain the recombinant plasmid pCA322-E16-E18, then fusing the Δ9 desaturase gene D9, the Δ5 desaturase gene D5, the Δ6 desaturase gene D6 and the Δ15 desaturase gene D15 to obtain fragment 1, and inserting fragment 1 into the recombinant plasmid pCA322-E16-E18 to obtain the recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15;

[0021] S5. Transferring the recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15 into Agrobacterium tumefaciens AGL-1, after obtaining positive transformants, infecting the wild type of Schizochytrium with the positive transformants to obtain the Schizochytrium genetic engineering strain.

[0022] Preferably, the recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15 further comprises an endogenous promoter PA, an endogenous terminator CYC, and a linker peptide E2A that links the C16 elongase gene E16 and the C18 elongase gene E18.

[0023] Preferably, the recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15 further comprises an endogenous promoter PATP, an endogenous terminator TA, and a linker peptide P2A that links the Δ9 desaturase gene D9, the Δ5 desaturase gene D5, the Δ6 desaturase gene D6, and the Δ15 desaturase gene D15.

[0024] The present invention also provides a method for fermentatively producing EPA using the above-mentioned Schizochytrium genetic engineering strain, comprising the following steps:

[0025] A. Coating the Schizochytrium engineering strain on a solid plate medium and culturing at a temperature of 20-30 °C for 12-96 h;

[0026] B. Selecting single colonies and inoculating them into a secondary seed liquid medium, and culturing on a shaker at a temperature of 20-30 °C and a speed of 160-220 rpm for 12-96 h to obtain a liquid seed solution;

[0027] C. Inoculating the liquid seed solution into a fermentation broth medium at an inoculation amount of 1%-10%, and culturing on a shaker at a temperature of 20-30 °C and a speed of 160-220 rpm for 12-120 h, and collecting the cells after the end of the culture;

[0028] Among them, the composition of the solid plate medium is: glucose 30 g / L, yeast powder 8 g / L, seawater crystal 20 g / L, agar powder 20 g / L, and the pH is adjusted to 6.5;

[0029] The composition of the secondary seed liquid medium is: glucose 30 g / L, yeast powder 8 g / L, seawater crystal 20 g / L, and the pH is adjusted to 6.5;

[0030] The composition of the fermentation broth medium is: glucose 80 g / L, yeast powder 5 g / L, NaCl 0.3 g / L, K2SO4 1 g / L, KH2PO4 0.1 g / L, MgSO4·7H2O 4 g / L, CaCl2 0.05 g / L, and the pH is adjusted to 6.5.

[0031] The present invention has at least the following beneficial effects: The present invention has for the first time completed the metabolic remodeling of the FAS pathway in Schizochytrium, achieving the de novo biosynthesis of FAS-derived EPA. The heterologously assembled FAS pathway is conducive to promoting the co-production of EPA and DHA in Schizochytrium and increasing the production of PUFAs through the bifunctional pathway of PKS and FAS. Moreover, the recombinant Schizochytrium described in the present invention can produce EPA accounting for 2.08% of the total fatty acids through the FAS pathway, and can also produce docosahexaenoic acid (DHA) accounting for at least more than 41% of the total fatty acids.

[0032] Other advantages, objectives, and features of the present invention will be partially reflected by the following description and partially understood by those skilled in the art through the research and practice of the present invention. Brief Description of the Drawings

[0033] Figure 1A Gas chromatogram of wild-type Schizochytrium;

[0034] Figure 1B Gas chromatogram of the Schizochytrium pC322-E16 transformant;

[0035] Figure 2 Gas chromatogram of the Schizochytrium pC322-E16-D9 transformant;

[0036] Figure 3 Comparison chart of the fermentation results of related transformants during the metabolic remodeling of the FAS pathway in Schizochytrium. Detailed Description of the Embodiments

[0037] The following further detailed description of the present invention is provided in conjunction with the accompanying drawings, so that those skilled in the art can implement it with reference to the text of the specification.

[0038] It should be noted that the experimental methods described in the following embodiments are all conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0039] Example 1: Verification of the Overexpression of the C16 Elongase Gene to Initially Activate the FAS Pathway

[0040] The specific method is as follows:

[0041] 1. Primers

[0042]

[0043] 2. Fragment Amplification and Homologous Recombination Procedures

[0044]

[0045] 3. Experimental methods

[0046] To obtain transformants, we first digested the existing expression plasmid pC322-GFP in the laboratory with restriction endonuclease ApaI to obtain the basic skeleton. Then, we used primer pairs PA-F / R and CYC-F11 / R11 to extract wild-type Schizochytrium ( Aurantiochytrium limacinum SR21, the sequences of the endogenous promoter PA and terminator CYC were amplified from the DNA genome of Schizochytrium (which has been disclosed in patent CN119307499A), and the codon-optimized C16 elongase gene was obtained by amplification with primer pair E16-F / R. Subsequently, it was connected to the pC322-GFP expression vector containing G418 resistance and enzyme digestion by homologous recombinase. Next, it was transformed with Escherichia coli DH5α and single colonies were selected for PCR verification to verify the positive transformants, thus successfully constructing pCA322-E16. Finally, pCA322-E16 was first transformed into Agrobacterium AGL-1, and the obtained positive transformants were then used for Schizochytrium infection. The specific method of infection was referred to the previous patent CN119307499A of this laboratory.

[0047] Fermentation verification of transformants. First, the Schizochytrium pCA322-E16 transformants were spread on seed solid plate medium (temperature 28°C, culture time 48h). Then, single colonies were selected and inoculated into secondary seed liquid medium for culture (temperature 28°C, 200rpm, culture time 48h) to obtain liquid seed liquid. Then, the liquid seed liquid was inoculated into fermentation liquid medium at an inoculation rate of 1% to 10% for culture (temperature 28°C, 220rpm, culture time 120h). Finally, the cells after the culture was collected, and the fatty acid composition of lipids was determined by gas chromatography (GC-2010, Shimadzu, Japan), which was equipped with sp-2560 column (100 m×0.25 mm×0.20 μm, Supelco, USA) and flame ionization detector, and then converted into fatty acid methyl esters by improved standard method. The relative content of each component was calculated by chromatographic peak area normalization method.

[0048] Among them, the composition of the solid plate culture medium is: glucose 30 g / L, yeast powder 8 g / L, sea crystal 20 g / L, agar powder 20 g / L, and the pH is adjusted to 6.5; the composition of the secondary seed liquid culture medium is: glucose 30 g / L, yeast powder 8 g / L, sea crystal 20 g / L, and the pH is adjusted to 6.5; the composition of the fermentation liquid culture medium is: glucose 80g / L, yeast powder 5g / L, NaCl 0.3g / L, K2SO41g / L, KH2PO40.1g / L, MgSO4·7H2O 4g / L, CaCl20.05g / L, and the pH is adjusted to 6.5.

[0049] The nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 1:

[0050] ATGGAGTCTGGTCCTATGCCTGCTGGTATCCCTTTCCCTGAGTACTACGACTTCTTCATGGACTGGAAGACCCCTCTCGCTATTGCTGCTACCTACACCGTCGCTGTCGGTCTCTTCAACCCTAAGGTCGGTAAGGTCTCTCGCGTCGTCGCTAAGTCTGCTAACGCTAAGCCTGCTGAGCGCACTCAGTCTGGTGCTGCTATGACCGCTTTCGTCTTCGTCCACAACCTCATCCTCTGCGTCTACTCTGGTATCACCTTCTACCACATGTTCCCTGCTATGGTCAAGAACTTCCGCACCCACACCCTCCACGAGGCTTACTGCGACACCGATCAGTCTCTCTGGAACAACGCTCTCGGTTACTGGGGTTATCTCTTTTACCTCTCTAAGTTCTACGAGGTCATCGACACCATCATTATCATCCTCAAGGGTCGCCGCTCTTCTCTCCTTCAGACCTACCACCACGCTGGTGCTATGATCACCATGTGGTCTGGTATCAACTACCAAGCTACCCCTATCTGGATCTTCGTCGTCTTCAACTCTTTCATCCACACCATCATGTACTGCTACTACGCTTTCACCTCTATCGGTTTCCACCCTCCTGGTAAGAAGTACCTCACCTCTATGCAGATCACTCAGTTCCTCGTCGGTATCACCATCGCTGTCTCTTACCTCTTCGTCCCTGGTTGCATCCGCACCCCTGGTGCTCAGATGGCTGTCTGGATCAACGTCGGTTACCTCTTCCCTCTTACCTACCTCTTCGTTGATTTTGCTAAGCGCACCTACTCTAAGCGCACCGCTATCGCTGCTCAAAAAAAGGCTCAGTAG

[0051] 4. Results

[0052] To verify that the FAS pathway of Schizochytrium is initially activated, in this example, the wild type of Schizochytrium ( Aurantiochytrium limacinumSR21) was used for control detection, and the detection results are as Figures 1A - 1B shown, Figure 1A which is the gas chromatogram of the wild type of Schizochytrium sp.; Figure 1B which is the gas chromatogram of the Schizochytrium sp. pCA322-E16 transformant.

[0053] According to Figures 1A - 1B the results, the wild type of Schizochytrium sp. can synthesize 43.71% palmitic acid (C16:0) and no stearic acid (C18:0) and its derivatives appear. This provides good metabolic precursors for the heterologous recombination of the FAS pathway. After overexpressing the C16 elongase gene (converting palmitic acid to stearic acid), the palmitic acid content of the transformant pCA322-E16 decreased, and 7.33% stearic acid appeared. This indicates that in Schizochytrium sp., after introducing the C16 elongase, palmitic acid was converted into stearic acid. The FAS pathway was initially activated.

[0054] Example 2: Co-expression of C16 elongase gene and D9 desaturase gene to verify the derivation of stimulating the FAS pathway

[0055] The specific method is as follows:

[0056] 1. Primers

[0057]

[0058] 2. Fragment amplification and homologous recombination procedure

[0059]

[0060] 3. Experimental method

[0061] For the acquisition of transformants. First, the existing expression plasmid pCA322-E16 in the laboratory was digested with the restriction enzyme SgsI to obtain the basic backbone. Secondly, the sequences of the endogenous promoter PATP and terminator TA were amplified from the DNA genome of the wild type of Schizochytrium sp. ( Aurantiochytrium limacinum SR21) using the primer pairs PATP-F / R and TA-F / R, and the codon-optimized Δ9 desaturase gene D9 was amplified using the primer pair D9-F / R. Subsequently, it was ligated to the digested pCA322-E16 expression vector containing G418 resistance through a homologous recombinase. Then, it was transformed into Escherichia coli DH5α and single colonies were selected for PCR verification to verify the positive transformants. Thus, pCA322-E16-D9 was successfully constructed. Finally, pCA322-E16-D9 was first transferred into Agrobacterium tumefaciens AGL-1, and the obtained positive transformants were used for the infection of Schizochytrium sp. The specific method refers to Example 1.

[0062] For the fermentation verification of transformants, the method refers to Example 1.

[0063] The nucleotide sequence of the Δ9 desaturase gene D9 is SEQ ID NO: 3:

[0064]

[0065] The nucleotide sequence of PATP is SEQ ID NO: 7:

[0066]

[0067] 4. Results

[0068] The experimental results are as follows Figure 2 As shown. By co-expressing the C16 elongase gene E16 and the Δ9 desaturase gene D9, it is expected that stearic acid will be converted to oleic acid. However, unexpectedly, both a very small amount of oleic acid (C18:1) and 3.40% linoleic acid (C18:2) appeared in the fatty acid profile. Therefore, we speculate that the wild type of Schizochytrium ( Aurantiochytrium limacinum SR21), there is an endogenous Δ12 desaturase that can catalyze the further conversion of oleic acid that should have been produced into linoleic acid.

[0069] Example 3: Validation of dual-module co-expression of complete heterologous FAS pathway genes for FAS pathway metabolic remodeling

[0070] The specific method is as follows:

[0071] 1. Primers

[0072]

[0073] 2. Fragment amplification and homologous recombination procedures

[0074]

[0075] 3. Experimental methods

[0076] Transformants for FAS pathway remodeling were obtained, which were mainly divided into two expression cassette modules for the complete expression of FAS pathway. First, the existing expression plasmid pCA322-E16-D9 in the laboratory was digested with restriction endonuclease SgsI to obtain the basic skeleton. Secondly, for the elongase gene, A) primer pair PA-F / R, CYC-F11 / R11 was used to extract the elongase gene from Schizochytrium ( A. limacinum SR21) to amplify the sequences of the endogenous promoter PA and terminator CYC; B) to obtain the codon-optimized C18 elongase gene E18 by amplifying with primer pair E18-F / R; C) to connect the C18 elongase gene E18 with the C16 elongase gene E16 by using E2A through a fragment fusion strategy, thereby obtaining the recombinant plasmid pCA322-E16-E18-D9.

[0077] Subsequently, for the desaturase gene, the recombinant plasmid pCA322-E16-E18-D9 was first digested with restriction endonuclease Kpn2I to remove the D9 fragment and obtain the recombinant backbone. Then A) the primer pair PATP-F / R and TA-F / R were used to isolate the desaturase gene from Schizochytrium ( A. limacinumA) Amplify the sequences of the endogenous promoter PATP and terminator TA from the DNA genome of Schizochytrium sp. SR21. B) Amplify the codon-optimized Δ5 desaturase gene (D5) using the primer pair D5-F / R; amplify the codon-optimized Δ6 desaturase gene (D6) using the primer pair D6-F / R; amplify the codon-optimized Δ15 desaturase gene (D15) using the primer pair D15-F / R. C) By means of a fragment fusion strategy, use P2A to ligate D5, D6, D15 and D9, and thus fragment 1 is obtained. Finally, ligate the promoter PATP, fragment 1 and terminator TA to the plasmid pCA322-E16-E18 that has been digested with enzymes and contains G418 resistance through a homologous recombinase. Then, transform it into Escherichia coli DH5α and pick single colonies for PCR verification to verify the positive transformants. Thus, pCA322-E16-E18-D9-D5-D6-D15 is successfully constructed. Finally, first transfer pCA322-E16-E18-D9-D5-D6-D15 into Agrobacterium tumefaciens AGL-1, and use the obtained positive transformants for the infection of Schizochytrium sp. The specific method refers to Example 1.

[0078] Fermentation verification of the transformants. The method refers to Example 1.

[0079] The nucleotide sequence of the C18 elongase gene E18 is SEQ ID NO: 2:

[0080] ATGGAGGTCGTCAACGAGATCGTCTCTATCGGTCAAGAGGTCCTCCCTAAGGTCGACTACGCTCAGCTCTGGTCTGACGCTTCTCACTGCGAGGTCCTCTACGGTTCTATCGCTTTCGTCATCCTCAAGTTCACCCTCGGTCCTCTCGGTCCTAAGGGTCAGTCTCGCATGAAGTTCGTCTTCACCAACTACAATCTCCTCATGTCTATCTACTCTCTCGGTTCTTTCCTCTCTATGGCTTACGCTATGTACACCATCGGTGTCATGTCTGACAACTGCGAGAAGGCTTTCGACAACAACGTCTTCCGCATCACCACTCAGCTCTTCTACCTCTCTAAGTTCCTCGAGTACATCGACTCTTTCTACCTCCCTCTCATGGGTAAGCCTCTCACCTGGCTTCAGTTCTTCCACCACCTCGGTGCTCCTATGGACATGTGGCTCTTCTACAACTACCGCAACGAGGCTGTCTGGATCTTCGTCCTCCTCAACGGTTTCATCCACTGGATCATGTACGGTTACTACTGGACCCGCCTCATCAAGCTCAAGTTCCCTATGCCTAAGTCTCTCATCACCTCTATGCAGATCATTCAGTTCAACGTCGGTTTCTACATCGTCTGGAAGTACCGCAACATCCCTTGCTACCGCCAAGACGGTATGCGCATGTTCGGTTGGTTCTTCAACTACTTCTACGTCGGTACCGTCCTCTGCCTCTTCCTCAACTTCTACGTTCAGACCTACATCGTCCGCAAGCACAAGGGTGCTAAGAAGATTCAGTAG

[0081] The nucleotide sequence of the Δ5 desaturase gene D5 is SEQ ID NO: 4:

[0082]

[0083] The nucleotide sequence of the Δ6 desaturase gene D6 is SEQ ID NO: 5:

[0084]

[0085] The nucleotide sequence of the Δ15 desaturase gene D15 is SEQ ID NO: 6:

[0086]

[0087] The amino acid sequence of E2A is SEQ ID NO: 8

[0088] GSGQTCNYALLKLAGDVESNPGP

[0089] The amino acid sequence of P2A is SEQ ID NO: 9

[0090] GSGATNFSLLKQAGDVEENPGP

[0091] 4. Results

[0092] In the present invention, two strong promoter expression cassettes (one connected by E2A is responsible for the elongation of fatty acid chains, and the other connected by P2A is responsible for the desaturation of fatty acid chains) are used to overexpress C16 elongase, C18 elongase, Δ9 desaturase, Δ5 desaturase, Δ6 desaturase, and Δ15 desaturase simultaneously. The results show that the proportions of palmitic acid, stearic acid, and their fatty acid derivatives in the fatty acid profile have decreased significantly, and 2.08% of EPA appears. It can be seen that the present invention has completed the metabolic remodeling of the FAS pathway in Schizochytrium for the first time and achieved the de novo biosynthesis of FAS-derived EPA.

[0093] The results of Example 1, Example 2, and Example 3 are comprehensively statistically analyzed and shown in Figure 3 It can be seen that the heterologously assembled FAS pathway is beneficial to the co-production of EPA and DHA in Schizochytrium and increases the production of PUFAs through the bifunctional pathway of PKS and FAS. Moreover, the recombinant Schizochytrium described in the present invention can produce EPA accounting for 2.08% of the total fatty acids through the FAS pathway, and can also produce at least docosahexaenoic acid (DHA) accounting for more than 41% of the total fatty acids.

[0094] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and embodiments. It can be fully applied to various fields suitable for the present invention. For those familiar with the field, additional modifications can be easily made. Therefore, without departing from the general concept defined by the claims and the equivalent scope, the present invention is not limited to the specific details and the examples shown and described herein.

Claims

1. A Schizochytrium genetic engineering strain that reshapes the FAS pathway, characterized in that, The genetically engineered Schizochytrium strain is obtained by heterologously expressing the C16 elongase gene E16, C18 elongase gene E18, Δ9 desaturase gene D9, Δ5 desaturase gene D5, Δ6 desaturase gene D6, and Δ15 desaturase gene D15 in the wild-type Schizochytrium; The nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 1; The nucleotide sequence of the C18 elongase gene E18 is SEQ ID NO: 2; The nucleotide sequence of the Δ9 desaturase gene D9 is SEQ ID NO: 3; The nucleotide sequence of the Δ5 desaturase gene D5 is SEQ ID NO: 4; The nucleotide sequence of the Δ6 desaturase gene D6 is SEQ ID NO: 5; The nucleotide sequence of the Δ15 desaturase gene D15 is SEQ ID NO: 6; The Schizochytrium wild type is Aurantiochytrium limacinum SR21.

2. Use of the genetically engineered Schizochytrium strain according to claim 1 in the production of EPA.

3. A method for constructing a Schizochytrium engineering strain, characterized in that: Comprising the following steps: S1. Using plasmid pC322-GFP as a backbone, inserting the C16 elongase gene E16 into this backbone to obtain the recombinant plasmid pCA322-E16; S2. Using the recombinant plasmid pCA322-E16 as a backbone, inserting the Δ9 desaturase gene D9 into this backbone to obtain the recombinant plasmid pCA322-E16-D9; S3. Using the recombinant plasmid pCA322-E16-D9 as a backbone, inserting the C18 elongase gene E18 into this backbone to obtain the recombinant plasmid pCA322-E16-E18-D9; S4. Removing the Δ9 desaturase gene D9 from the recombinant plasmid pCA322-E16-E18-D9 to obtain the recombinant plasmid pCA322-E16-E18, then fusing the Δ9 desaturase gene D9, Δ5 desaturase gene D5, Δ6 desaturase gene D6, and Δ15 desaturase gene D15 to obtain fragment 1, and inserting fragment 1 into the recombinant plasmid pCA322-E16-E18 to obtain the recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15; S5. Transferring the recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15 into Agrobacterium tumefaciens AGL-1, after obtaining positive transformants, using the positive transformants to infect the wild-type Schizochytrium to obtain the genetically engineered Schizochytrium strain; The nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 1; The nucleotide sequence of the C18 elongase gene E18 is SEQ ID NO: 2; The nucleotide sequence of the Δ9 desaturase gene D9 is SEQ ID NO: 3; The nucleotide sequence of the Δ5 desaturase gene D5 is SEQ ID NO: 4; The nucleotide sequence of the Δ6 desaturase gene D6 is SEQ ID NO: 5; The nucleotide sequence of the Δ15 desaturase gene D15 is SEQ ID NO: 6; The Schizochytrium wild type is Aurantiochytrium limacinum SR21.

4. The method for constructing the Schizochytrium engineering strain according to claim 3, characterized in that, The recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15 also contains a linker peptide E2A that connects the C16 elongase gene E16 and the C18 elongase gene E18, and the amino acid sequence of the linker peptide E2A is SEQ ID NO:

8.

5. The method for constructing the Schizochytrium engineering strain according to claim 3, characterized in that, The recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15 also contains an endogenous promoter PATP, an endogenous terminator TA, and a linker peptide P2A that connects the Δ9 desaturase gene D9, the Δ5 desaturase gene D5, the Δ6 desaturase gene D6, and the Δ15 desaturase gene D15, and the amino acid sequence of the linker peptide P2A is SEQ ID NO:

9.

6. The method for fermenting and producing EPA by the Schizochytrium genetic engineering strain as claimed in claim 1, wherein It includes the following steps: A. Spread the Schizochytrium engineering strain on a solid plate medium and culture it at a temperature of 20~30 °C for 12~96 h; B. Select single colonies and inoculate them into a secondary seed liquid medium. Shake-culture at a temperature of 20~30 °C and 160~220 rpm for 12~96 h to obtain a liquid seed solution; C. Inoculate the liquid seed solution into a fermentation broth medium at an inoculation amount of 1%~10%. Shake-culture at a temperature of 20~30 °C and 160~220 rpm for 12~120 h, and collect the cells after the culture ends; Among them, the composition of the solid plate medium is: 30 g / L of glucose, 8 g / L of yeast powder, 20 g / L of seawater crystal, 20 g / L of agar powder, and the pH is adjusted to 6.5; The composition of the secondary seed liquid medium is: 30 g / L of glucose, 8 g / L of yeast powder, 20 g / L of seawater crystal, and the pH is adjusted to 6.5; The composition of the fermentation broth medium is: 80 g / L of glucose, 5 g / L of yeast powder, 0.3 g / L of NaCl, 1 g / L of K2SO4, 0.1 g / L of KH2PO4, 4 g / L of MgSO4·7H2O, 0.05 g / L of CaCl2, and the pH is adjusted to 6.5.

Images