Carboxylesterase mutant and application thereof in preparation of (R)-o-chloromandelic acid

Abstract

The invention relates to the technical field of gene engineering of enzymes, and provides a carboxylesterase mutant and application thereof in preparation of (R)-o-chloromandelic acid in order to solve the problem that in the prior art, a process for preparing (R)-o-chloromandelic acid methyl ester through a dynamic kinetic resolution biological method is tedious. The mutant is I228A obtained by mutation of the 228th amino acid of E2 esterase with an amino acid sequence as shown in SEQ ID NO: 1, or A150F obtained by mutation of the 150th amino acid, or F217Y obtained by mutation of the 217th amino acid, or I228A / A150F, I228A / F217Y, A150F / F217Y and I228A / A150F / F217Y obtained by combined mutation of the E2 esterase. The carboxylesterase mutant can be used for preparing (R)-o-chloromandelic acid and has good selectivity.

Description

Technical Field

[0001] The present invention relates to the technical field of enzyme genetic engineering, in particular to a carboxylesterase mutant and application thereof in the preparation of (R)-o-chloromandelic acid. Background Art

[0002] (R)-O-chloromandelic acid is an important intermediate precursor of the platelet aggregation inhibitor clopidogrel. Clopidogrel was successfully developed by the French company Sanofi-Aventis in 1986. Its sulfate salt is used clinically under the trade name Plavix, which is mainly used to treat cardiovascular and cerebrovascular diseases such as atherosclerosis. In 2009, the global sales of this drug reached 10 billion US dollars, second only to the lipid-lowering drug atorvastatin, becoming the second best-selling drug in the global pharmaceutical market. (R)-O-chloromandelic acid is methylated to obtain (R)-O-chloromandelic acid methyl ester, which is then synthesized into clopidogrel through sulfonation and nucleophilic substitution. The reaction yield is high and the product is basically free of racemization.

[0003] At present, the synthesis routes of (R)-methyl o-chloromandelate mainly include: 1) nitrilase catalyzes the hydrolysis of o-chloromandelonitrile, with a theoretical yield of 100%, but uses highly toxic hydrocyanic acid; 2) hydroxylase catalyzes o-chlorobenzaldehyde and hydrocyanic acid to asymmetric synthesize (R)-o-chloromandelonitrile, and then hydrolyzes to generate (R)-o-chloromandelic acid, but the process also uses highly toxic hydrocyanic acid; 3) asymmetric reduction of o-chlorobenzoylformic acid to obtain (R)-methyl o-chloromandelate, with a theoretical yield of 100%, and expensive coenzymes are used in the process; 4) starting from racemic o-chloromandelic acid ester, enzymatic hydrolysis and separation to obtain (R)-o-chloromandelic acid, with a theoretical yield of 50%. Patent CN103820521A couples racemase and esterase BioH to prepare (R)-methyl o-chloromandelate through dynamic kinetic resolution. The process requires separation of S-o-chloromandelic acid and chemical esterification before further application, and the process is relatively complicated. Summary of the invention

[0004] The present invention firstly overcomes the defect that the product cannot be obtained in one step by the dynamic kinetic resolution biological method for preparing (R)-methyl o-chloromandelate under the prior art, and provides a carboxylesterase mutant. The carboxylesterase mutant has high hydrolysis selectivity for (R)-methyl o-chloromandelate, can efficiently convert (R)-methyl o-chloromandelate using methyl o-chloromandelate as a substrate, and lays a foundation for the subsequent one-pot method of coupling racemase to prepare (R)-methyl o-chloromandelate.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions: A carboxylesterase mutant, which is obtained by subjecting an E2 esterase having an amino acid sequence as shown in SEQ ID NO: 1 to a mutation at amino acid position 228 to obtain I228A, or a mutation at amino acid position 150 to obtain A150F, or a mutation at amino acid position 217 to obtain F217Y, or a combination thereof to obtain I228A / A150F, I228A / F217Y, A150F / F217Y, or I228A / A150F / F217Y.

[0006] Compared with the wild-type E2 esterase, the carboxylesterase mutant of the present invention has higher selectivity in the process of converting racemic methyl o-chloromandelate to prepare (R)-o-chloromandelic acid, so the product yield is improved, the raw material cost of preparing (R)-o-chloromandelic acid can be reduced, and the production efficiency can be improved.

[0007] Preferably, the amino acid sequence of the carboxylesterase mutant I228A is shown in SEQ ID NO: 2; The amino acid sequence of the carboxylesterase mutant A150F is shown in SEQ ID NO: 3; The amino acid sequence of the carboxylesterase mutant F217Y is shown in SEQ ID NO: 4; The amino acid sequences of the carboxylesterase mutants I228A / A150F, I228A / F217Y, A150F / F217Y, and I228A / A150F / F217Y are shown in SEQ ID NOs: 5-8, respectively.

[0008] A gene encoding the above-mentioned carboxylesterase mutant, wherein the nucleotide sequence of the gene encoding the carboxylesterase mutant I228A is shown in SEQ ID NO: 9; The nucleotide sequence of the gene encoding the carboxylesterase mutant A150F is shown in SEQ ID NO: 10; The nucleotide sequence of the gene encoding the carboxylesterase mutant F217Y is shown in SEQ ID NO: 11; The nucleotide sequences of the genes encoding the carboxylesterase mutants I228A / A150F, I228A / F217Y, A150F / F217Y, and I228A / A150F / F217Y are shown in SEQ ID NOs: 12-15, respectively.

[0009] Preferably, the encoding gene of the carboxylesterase mutant is obtained by amplifying the encoding gene of the E2 esterase by using a specific primer pair, and the nucleotide sequence of the encoding gene of the E2 esterase is shown in SEQ ID NO: 16; The specific primer pair is one, two or three of I228A-F / R, A150F-F / R, and F217Y-F / R; The nucleotide sequence of I228A-F is GACGCGCTGGACCTCCCGAATATT, The nucleotide sequence of I228A-R is CAGCGCGTCACCCACGGCTG; The nucleotide sequence of A150F-F is CATTTTCTGACCATTGGTATT; The nucleotide sequence of A150F-R is CAGAAAATGGTAACCAAATGCCG; The nucleotide sequence of F217Y-F is CACTACGGCCTGGCGGCGAA; The nucleotide sequence of F217Y-R is GCCGTAGTGGGATGCCGGAT;

[0010] A recombinant expression vector containing the above-mentioned coding gene, wherein the recombinant expression vector is a plasmid, phage or virus vector containing a mutant coding gene.

[0011] An engineered bacterium expressing the above-mentioned carboxylesterase mutant is obtained by transforming the above-mentioned recombinant expression vector into a host bacterium.

[0012] A method for preparing (R)-o-chloromandelic acid, comprising taking o-chloromandelic acid methyl ester as a substrate, reacting it with the carboxylesterase mutant according to claim 1 or 2 and a solvent to obtain R-o-chloromandelic acid.

[0013] The substrate methyl o-chloromandelate is a mixture of (S)-methyl o-chloromandelate and (R)-methyl o-chloromandelate. The carboxylesterase mutant of the present invention can catalyze and decompose (R)-methyl o-chloromandelate to obtain (R)-methyl o-chloromandelate with high purity, and the carboxylesterase mutant of the present invention has high selectivity for (R)-methyl o-chloromandelate, and its decomposition effect on (S)-methyl o-chloromandelate is much lower than that of (R)-methyl o-chloromandelate. The preparation steps of the (R)-methyl o-chloromandelate are simple and the reaction conditions are gentle.

[0014] Preferably, the carboxylesterase mutant is added in the form of wet cells after fermentation and culture of the above-mentioned engineered bacteria, or in the form of crude enzyme solution obtained by crushing the wet cells.

[0015] Preferably, the solvent is an aqueous solution containing Tris-HCl and ethanol, the concentration of Tris-HCl is 100 mM, and the volume percentage of ethanol is 5%.

[0016] Preferably, the amount of the carboxylesterase mutant added to the mixed solution is 10-20 g / L based on wet bacteria, and the amount of methyl o-chloromandelate added is 10-20 g / L.

[0017] Therefore, the present invention has the following beneficial effects: (1) the carboxylesterase mutant obtained by the present invention can be used for the biological preparation of (R)-o-chloromandelic acid, and no other by-products are generated in the preparation process, and the selectivity is greatly improved; (2) the method for preparing (R)-o-chloromandelic acid has the advantages of simple operation and low cost, which greatly reduces the production cost and has broad application prospects. DETAILED DESCRIPTION

[0022] The detection conditions of high performance liquid chromatography (HPLC) in the following specific implementation method are as follows: the chiral column uses CHIRALPAK DAICEL IG (4.6*250mm, 5μm), the column temperature is 5°C, the mobile phase is n-hexane:ethanol=98:2, the flow rate is 0.3mL / min, the reaction solution is adjusted to pH 3, and then 5 volumes of ethyl acetate are added for extraction, and then centrifuged to take the supernatant; the supernatant after extraction with ethyl acetate needs to be vacuum filtered until the ethyl acetate is completely volatilized, and then the mobile phase n-hexane:ethanol=98:2 is added to dissolve the sample, and sent to the liquid phase for detection; (S)-methyl o-chloromandelate peaks at 10.107min, (R)-methyl o-chloromandelate peaks at 11.18min, (S)-o-chloromandelic acid peaks at 17.604min, and (R)-o-chloromandelic acid peaks at 18.939min.

[0023] Examples 1-7 The steps for constructing the E2 carboxylesterase mutant are as follows: (1) Construction of recombinant cloning vector: The mutant was prepared using E2 carboxylesterase as a template. The gene nucleic acid sequence of E2 carboxylesterase is shown in SEQ ID NO: 16, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 1. The strain pET28a-E2 containing the gene encoding E2 carboxylesterase was activated on an LB plate containing 1‰ Kan resistance, cultured at 37°C for 18h, and a single colony was picked in a 50mL LB conical flask also containing 1‰ Kan resistance, cultured at 37°C, 220rpm until OD600 was about 0.6, and the plasmid was extracted according to the instructions of the plasmid mini-extraction kit; (2) The extracted plasmid was used as a template, and a point mutation kit was used to complete the carboxylesterase mutant. The PCR primers, PCR system and conditions were shown in Table 1-3. After PCR, 1 μL of Dpn I was added to the PCR reaction solution, and the reaction was carried out at 37° C. for 1 h to obtain a Dpn I digestion template reaction system; (3) All the mutant plasmids constructed above were transformed into E. coli BL21 competent cells, mixed and placed on ice for 30 min. After that, the E. coli BL21 competent cells were placed in a heat shock at 42°C for 90 s and then placed on ice for 5 min. Then 1 mL of LB medium without added resistance was added. After that, the E. coli BL21 competent cells were placed at 37°C for 1 h. After that, 200 μL of the cells were spread on LB medium containing 1‰ Kan and cultured in a 37°C constant temperature incubator until a single colony grew; (4) After a single colony is grown, a single colony is picked and cultured in an LB tube containing the same resistance at 37°C and 220 rpm overnight. Then, 200 μL of the bacterial solution is aspirated under aseptic operation conditions in a clean bench for sequencing. If the sequencing is successful, an equal volume of glycerol solution (40% glycerol) is added to the remaining bacterial solution and then stored in a -80°C refrigerator for later use.

[0024] Table 1. Primers for mutant construction

[0025] Table 2. PCR system

[0026] Table 3. PCR conditions

[0027] Embodiment 8-14 Inducible expression of E2 carboxylesterase mutants with amino acid sequences as shown in SEQ ID NO: 2-8: The engineered bacteria E. coli BL21 / pET28a-E2 constructed in Examples 1-7 were inoculated into LB liquid culture medium containing 50 μg / mL kanamycin, cultured overnight at 37°C, and the prepared bacteria were stored and stored. Then, 1% inoculum (v / v) was inoculated into 50 mL LB culture medium containing 50 μg / mL kanamycin, and cultured at 37°C, 200 rpm until the bacterial concentration OD600 reached about 0.6. IPTG was added at a final concentration of 0.1 mM, and after induction culture at 25°C for 16 h, the bacteria were collected by centrifugation at 4°C, 8000 rpm for 10 min, and stored at -80°C for later use.

[0028] Comparative Example 1 The inducible expression of the wild-type E2 carboxylesterase having an amino acid sequence as shown in SEQ ID NO: 1 is different from that of Examples 8-14 in that the strain pET28a-E2 containing the gene encoding E2 carboxylesterase is used.

[0029] Embodiment 15 The E2 carboxylesterase mutant hydrolyzes racemic o-chloromandelate methyl ester as follows: (1) 0.2 g of methyl o-chloromandelate and 0.3 g of the wet cells obtained in Example 8 were added to 20 mL of water containing Tris-HCl buffer (100 mM, pH 8.0) and 5% ethanol, and the mixture was placed in a constant temperature shaker at 30° C. and 220 rpm for reaction for 1 h; (2) After the reaction is completed, the reaction solution is adjusted to pH 3 with hydrochloric acid, and 5 volumes of ethyl acetate are added for extraction, followed by centrifugation to obtain the supernatant; (3) The supernatant was vacuum evaporated at 37° C. for 1 h, and then a mobile phase of n-hexane:ethanol=98:2 was added to dissolve and filter, and the substrate reaction and product generation were determined by high performance liquid chromatography (HPLC) equipped with an ultraviolet detector; (4) After replacing the wet bacteria in step (1) with the wet bacteria obtained in Examples 9-14, repeat steps (2) and (3).

[0030] Comparative Example 2 The wild type E2 carboxylesterase hydrolyzes racemic methyl o-chloromandelate, and the difference between the steps and those in Example 15 is that the wet bacteria used are the wet bacteria obtained in Comparative Example 1.

[0031] The conversion rate and E value of methyl o-chloromandelate were obtained by HPLC. The results are shown in Table 4.

[0032] Table 4. Response data of wild type and mutants

[0033] As can be seen from the above table, the E2 carboxylesterase mutant of the present invention can convert racemic o-chloromandelic acid methyl ester to prepare R-o-chloromandelic acid, and compared with the wild-type E2 carboxylesterase, the selectivity of the E2 carboxylesterase mutant of the present invention is greatly improved.

[0034] For single mutants, mutant I228A, which is generated by mutation of amino acid 228 of wild-type E2 carboxylesterase of SEQ ID NO: 1, has the best reaction selectivity. Compared with E2 carboxylesterase, the selectivity of mutant I228A for substrate is 320% of that of wild-type.

[0035] For multiple point mutants, the mutant I228A / A150F, which is generated by the wild-type E2 carboxylesterase through the mutation of the amino acid at position 228 and the combined mutation of the amino acid at position 150, has the best reaction selectivity. Compared with E2 carboxylesterase, the selectivity of the mutant I228A / A150F for the substrate is 460% of that of the wild-type. No other byproducts are generated, and the selectivity is greatly improved.

Claims

1. A carboxylesterase mutant, characterized in that: I228A obtained by mutating the amino acid at position 228 of the E2 esterase with the amino acid sequence shown in SEQ ID NO: 1, or A150F obtained by mutating the amino acid at position 150, or F217Y obtained by mutating the amino acid at position 217, or I228A / A150F, I228A / F217Y, A150F / F217Y, or I228A / A150F / F217Y obtained by a combination of mutations thereof.

2. A carboxylesterase mutant according to claim 1, characterized in that: The amino acid sequence of the carboxylesterase mutant I228A is shown in SEQ ID NO: 2; The amino acid sequence of the carboxylesterase mutant A150F is shown in SEQ ID NO: 3; The amino acid sequence of the carboxylesterase mutant F217Y is shown in SEQ ID NO: 4; The amino acid sequences of the carboxylesterase mutants I228A / A150F, I228A / F217Y, A150F / F217Y, and I228A / A150F / F217Y are shown in SEQ ID NOs: 5-8, respectively.

3. A gene encoding a carboxylesterase mutant according to claim 1 or 2, characterized in that: The nucleotide sequence of the gene encoding the carboxylesterase mutant I228A is shown in SEQ ID NO: 9; The nucleotide sequence of the gene encoding the carboxylesterase mutant A150F is shown in SEQ ID NO: 10; The nucleotide sequence of the gene encoding the carboxylesterase mutant F217Y is shown in SEQ ID NO: 11; The nucleotide sequences of the genes encoding the carboxylesterase mutants I228A / A150F, I228A / F217Y, A150F / F217Y, and I228A / A150F / F217Y are shown in SEQ ID NOs: 12-15, respectively.

4. The gene encoding the carboxylesterase mutant according to claim 3, characterized in that: The encoding gene of the carboxylesterase mutant is obtained by amplifying the encoding gene of the E2 esterase by using a specific primer pair, and the nucleotide sequence of the encoding gene of the E2 esterase is shown in SEQ ID NO: 16; The specific primer pair is one, two or three of I228A-F / R, A150F-F / R, and F217Y-F / R; The nucleotide sequence of I228A-F is GACGCGCTGGACCTCCCGAATATT, The nucleotide sequence of I228A-R is CAGCGCGTCACCCACGGCTG; The nucleotide sequence of A150F-F is CATTTTCTGACCATTGGTATT; The nucleotide sequence of A150F-R is CAGAAAATGGTAACCAAATGCCG; The nucleotide sequence of F217Y-F is CACTACGGCCTGGCGGCGAA; The nucleotide sequence of F217Y-R is GCCGTAGTGGGATGCCGGAT.

5. A recombinant expression vector containing the coding gene according to claim 3 or 4, characterized in that: The recombinant expression vector is a plasmid, phage or virus vector containing a mutant encoding gene.

6. An engineered bacterium expressing the carboxylesterase mutant according to claim 1, characterized in that: The engineered bacteria are obtained by transforming the recombinant expression vector as described in claim 5 into host bacteria.

7. A method for preparing (R)-o-chloromandelic acid, characterized in that: Taking methyl o-chloromandelate as a substrate, mixing it with the carboxylesterase mutant as claimed in claim 1 or 2 and a solvent for reaction, (R)-o-chloromandelic acid is obtained.

8. The method for preparing (R)-o-chloromandelic acid according to claim 7, characterized in that: The carboxylesterase mutant is added in the form of wet bacteria after fermentation and culture of the engineered bacteria as claimed in claim 5, or in the form of crude enzyme liquid obtained by crushing the wet bacteria.

9. The method for preparing (R)-o-chloromandelic acid according to claim 7 or 8, characterized in that: The solvent is an aqueous solution containing Tris-HCl and ethanol, the concentration of Tris-HCl is 100 mM, and the volume percentage of ethanol is 5%.

10. The method for preparing (R)-o-chloromandelic acid according to claim 8, characterized in that: The amount of the carboxylesterase mutant added to the mixed solution is 10-20 g / L based on wet bacteria, and the amount of methyl o-chloromandelate added is 10-20 g / L.

Images