Tagatose-4-epimerase mutants, encoding genes and uses
By site-directed mutagenesis of tagatose-4-epimerase, constructing a recombinant vector and transforming it into recombinant genetically engineered bacteria, the problems of complex and costly D-tagatose synthesis were solved, achieving efficient and environmentally friendly D-tagatose preparation.
Patent Information
- Application Number
- CN202510181276.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-19
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2044-12-19
AI Technical Summary
Existing D-tagatose synthesis processes are cumbersome, involve complex separation and purification, require harsh reaction conditions, and have high preparation costs. Furthermore, the substrate lactose is expensive and has low utilization rates.
By site-directed mutagenesis of tagatose-4-epimerase, a recombinant vector was constructed and transformed into recombinant genetically engineered bacteria. The mutant was used to synthesize D-tagatose under mild conditions using D-fructose as a substrate in a single-step reaction.
This method enables the preparation of D-tagatose with high catalytic activity, low cost, and environmental friendliness. The reaction conditions are mild, the product is singular, and the separation and purification are simple.
Smart Images

Figure CN119913138B_ABST
Abstract
Description
[0001] This invention is a divisional application of Chinese Patent Application No. 202411874516.9, filed on December 19, 2024, whose original invention was entitled "A tagatose-4-epimerase mutant and its application". Technical Field
[0002] This invention belongs to the fields of biopharmaceuticals and biotransformation, specifically relating to a tagatose-4-epimerase mutant, the mutant encoding gene, a recombinant vector containing the mutant encoding gene, a recombinant genetically engineered bacterium containing the mutant encoding gene, and the application of the tagatose-4-epimerase mutant in the preparation of D-tagatose. Background Technology
[0003] Tagatose is an epimer of fructose, in which five carbon molecules and one oxygen molecule form a ring structure. It is a relatively rare, naturally occurring hexose ketose, with a sweetness similar to sucrose, but producing only one-third the calories. Tagatose has advantages such as low energy, lowering blood sugar, improving gut microbiota, and preventing tooth decay, thus showing broad application prospects in medicine, health products, and other fields.
[0004] Tagatose is extremely rare in nature and is currently synthesized primarily through chemical or biological methods. The chemical method uses D-galactose as a raw material, producing D-tagatose in a two-step reaction. However, the chemical method suffers from drawbacks such as harsh and difficult-to-control reaction conditions, easy pollution, complex processes, and numerous byproducts that are difficult to separate and purify. The biological method for preparing D-tagatose offers advantages such as being environmentally friendly, producing a single product, and being simple to separate and purify, thus becoming the main method for D-tagatose synthesis. Currently, the main method used is the dual-enzyme method, which involves the synergistic catalysis of lactose synthesis by β-galactosidase and L-arabinose isomerase. This method requires two steps: first, β-galactosidase hydrolyzes lactose to produce the intermediate product D-galactose, and then L-arabinose isomerase catalyzes the synthesis of D-tagatose. However, this method suffers from high costs due to the high cost of lactose as a substrate, the complexity of the two-step reaction, and the low substrate utilization rate caused by the first step of lactose hydrolysis, further increasing the cost. Therefore, finding other efficient pathways to synthesize D-tagatose is of great research significance and application value.
[0005] Tagatose-4-epimerase can synthesize D-tagatose through epimerization using inexpensive D-fructose as a substrate. It is not only environmentally friendly, easy to separate and purify, and has mild reaction conditions, but also has the advantages of simple reaction and low cost, and has good application prospects. Summary of the Invention
[0006] This invention aims to overcome the shortcomings of existing technologies in the synthesis of D-tagatose, such as cumbersome steps, complex separation and purification, harsh and difficult-to-control reaction conditions, and high preparation costs. It provides a tagatose-4-epimerase mutant, a mutant encoding gene, a recombinant vector containing the mutant encoding gene, and a recombinant genetically engineered bacterium containing the mutant encoding gene, and applies the tagatose-4-epimerase mutant to the process of preparing D-tagatose.
[0007] To achieve the above-mentioned objectives, the present invention is implemented through the following technical solution:
[0008] A tagatose-4-epimerase mutant derived from the amino acid sequence shown in SEQ ID NO.1 by site-directed mutation, wherein the mutation site is one or more of the following: (1) position 75, (2) position 140, (3) position 165, (4) position 361.
[0009] As a preferred embodiment, a tagatose-4-epimerase mutant is derived from an amino acid sequence as shown in SEQ ID NO.1 by site-directed mutation, wherein the mutation site is one or more of the following: (1) position 75, (2) position 140, (3) position 165, (4) position 361, (5) position 69, (6) position 70.
[0010] Preferably, the tagatose-4-epimerase mutant is derived from the amino acid sequence shown in SEQ ID NO.1 by site-directed mutation, wherein the mutation site is one or two of the following: (1) position 75, (4) position 361.
[0011] Preferably, the mutant is obtained by mutating one or more of the following sites of the amino acid sequence shown in SEQ ID NO.1: (1) glutamic acid at position 75 is mutated to alanine (E75A), (2) proline at position 140 is mutated to leucine (P140L), (3) arginine at position 165 is mutated to alanine (R165A), and (4) phenylalanine at position 361 is mutated to histidine (F361H).
[0012] Preferably, the mutant is obtained by mutating one or more of the following sites of the amino acid sequence shown in SEQ ID NO.1: (1) glutamic acid at position 75 is mutated to alanine (E75A), (2) proline at position 140 is mutated to leucine (P140L), (3) arginine at position 165 is mutated to alanine (R165A), (4) phenylalanine at position 361 is mutated to histidine (F361H), (5) arginine at position 69 is mutated to alanine (R69A), and (6) asparagine at position 70 is mutated to alanine (N70A).
[0013] As a further preferred embodiment, the mutant is obtained by mutating the amino acid sequence shown in SEQ ID NO.1 by changing glutamic acid at position 75 to alanine (E75A) and phenylalanine at position 361 to histidine (F361H), and its amino acid sequence is preferably shown in SEQ ID NO.3.
[0014] A tagatose-4-epimerase mutant encoding gene as described above, wherein the tagatose-4-epimerase mutant encoding gene is preferably as shown in SEQ ID NO.4.
[0015] A recombinant vector constructed from the coding gene as described above.
[0016] A recombinant genetically engineered bacterium obtained by transformation of the recombinant vector as described above.
[0017] The tagatose-4-epimerase mutant described in this invention is produced by mutating multiple amino acids of the wild-type tagatose-4-epimerase, thereby increasing its relative enzyme activity. First, the wild-type tagatose-4-epimerase encoding gene (sequence shown in SEQ ID NO.2) is ligated to the expression vector pET28a(+) to construct a recombinant expression plasmid. Then, the constructed recombinant expression plasmid is transformed into *E. coli* BL21(DE3). Using the recombinant expression plasmid containing the tagatose-4-epimerase encoding gene as a template, gene modification is performed using site-directed mutagenesis. The recombinant expression plasmid is then transformed into *E. coli* BL21(DE3) to obtain *E. coli* BL21(DE3) recombinant genetically engineered bacteria containing the tagatose-4-epimerase mutant encoding gene. The obtained recombinant genetically engineered bacteria were induced and cultured. Bacterial cells containing the recombinant tagatose-4-epimerase mutant were isolated from the culture medium. A crude enzyme solution of the tagatose-4-epimerase mutant was obtained by separating the culture medium from the bacterial cells. The relative activities of the mutant tagatose-4-epimerase and the wild-type tagatose-4-epimerase were compared, and mutants with higher tagatose-4-epimerase activity were screened.
[0018] The application of the tagatose-4-epimerase mutant as described above in the preparation of D-tagatose.
[0019] Preferably, the application involves using wet bacterial cells obtained through fermentation culture of recombinant genetically engineered bacteria containing the tagatose-4-epimerase mutant encoding gene, or crude enzyme extracted from wet bacterial cells after ultrasonic disruption, or purified enzyme as a catalyst, with D-fructose as a substrate, in Ni 2+ In the presence of the substance, the reaction is carried out in a sodium phosphate buffer solution with a pH of 7-9 at 70-80°C. After the reaction is complete, the reaction solution is separated and purified to obtain D-tagatose.
[0020] As a further preferred embodiment, the application is as follows: using wet bacterial cells obtained by fermentation culture of recombinant genetically engineered bacteria containing the tagatose-4-epimerase mutant encoding gene, or crude enzyme extracted from wet bacterial cells after ultrasonic disruption, or purified enzyme as a catalyst, D-fructose as a substrate, and sodium phosphate buffer solution with a pH of 8 as a reaction medium to construct a reaction system, and conducting the reaction at 75°C with 1mM Ni 2+ The reaction was carried out at 1000 rpm for 30 min, and the reaction solution was separated and purified to obtain D-tagagose; wherein the amount of catalyst used was 40 g / L based on the wet cell weight, and the initial concentration of the substrate was 50 g / L.
[0021] The wet bacterial cells obtained by fermentation culture of the recombinant genetically engineered bacteria containing the tagatose-4-epimerase mutant encoding gene of the present invention are prepared as follows: The recombinant genetically engineered bacteria containing the tagatose-4-epimerase mutant encoding gene are inoculated into LB liquid medium containing a final concentration of 50 μg / mL kanamycin resistance, and cultured at 37°C and 180 rpm for 10 h. Then, the bacteria are inoculated into fresh LB liquid medium containing a final concentration of 50 μg / mL kanamycin resistance at a volume concentration of 2%, and cultured at 37°C and 180 rpm until the bacterial OD600 reaches 0.6-0.8. IPTG is added to a final concentration of 0.1 mM, and the bacteria are induced to culture at 28°C for 12 h. After centrifugation at 4°C and 8000 rpm for 10 min, the supernatant is discarded and the wet bacterial cells are collected.
[0022] Preparation of the crude enzyme of the mutant tagatose-4-epimerase described in this invention: Resuspension of 0.2 g of wet bacterial cells containing the tagatose-4-epimerase mutant encoding gene in 9.8 mL of 50 mM sodium phosphate buffer (pH 7.0) was performed under ice bath conditions using ultrasonic disruption (200 W power, 1 s duration, 2 s interval, continuous disruption for 15 min) to obtain cell lysate. The cell lysate obtained after ultrasonic disruption was centrifuged at 8000 rpm and 4℃ for 10 min, and the supernatant obtained was the desired crude enzyme solution.
[0023] Therefore, the present invention has the following beneficial effects:
[0024] This invention prepared a tagatose-4-epimerase mutant with high catalytic activity and high stereoselectivity for D-tagatose. The mutant has the advantages of mild reaction conditions, green and environmentally friendly production, single product, and simple separation and purification. Attached Figure Description
[0025] Figure 1 SDS-PAGE image of tagatose-4-epimerase.
[0026] Figure 2This is a schematic diagram of the enzymatic synthesis pathway for D-tagatose.
[0027] Figure 3 This is a schematic diagram of the HPLC detection of the substrate D-fructose and the product D-tagatose.
[0028] Figure 4 Bar chart showing the relative enzyme activity of wild-type tagatose-4-epimerase and tagatose-4-epimerase mutant. Detailed Implementation
[0029] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.
[0030] Example 1: Wild-type tagatose-4-epimerase genetically engineered bacteria E. coli Construction of BL21(DE3) / DTE
[0031] After codon optimization, the gene sequence derived from Thermotoga petrophila tagatose-4-epimerase in the gene bank was synthesized into the pET28a(+)-DTE plasmid. This plasmid was then transformed into E. coli BL21(DE3) to obtain wild-type E. coli BL21(DE3) / DTE, denoted as DTE.
[0032] Example 2: Site-directed mutagenesis to construct E. coli BL21(DE3) / DTE-muts
[0033] Site-directed mutagenesis was introduced into the tagatose-4-epimerase DTE using site-directed mutagenesis. Primers were designed as follows:
[0034] R69A:
[0035] Upstream primer 1: 5'-CTTTTTCTTTTGCGAGgcgAACCATGAAAATC-3'
[0036] Downstream primer 2: 5'-CTCGCAAAAGAAAAAGCTCACGCCTTCC-3'
[0037] N70A:
[0038] Upstream primer 1: 5'-CTTTTTCTTTTGCGAGCGCgcgCATGAAAATC-3'
[0039] Downstream primer 2: 5'-CTCGCAAAAGAAAAAGCTCACGCCTTCC-3
[0040] E75A:
[0041] Upstream primer 1: CCATGAAAATCTGgcgGTGCTGCGCAAATAT
[0042] Downstream primer 2: 5'-CAGATTTTCATGGTTGCGCTCGCAAAAG-3'
[0043] P140L:
[0044] Upstream primer 3: 5'- TACCTGGCGCGATGTTctgGATGATGCGAC-3'
[0045] Downstream primer 4: 5'-AACATCGCGCCAGGTACGACCAGTACGTTC-3'
[0046] R165A:
[0047] Upstream primer 5: 5'- GCGGATCATGTGAAAgcgCCGGAAGATTTGG-3'
[0048] Downstream primer 6: 5'-TTTCACATGATCCGCATCCGCGCCAAAGC-3'
[0049] F361H:
[0050] Upstream primer 7: 5'- GTGCGACTGGTGGTCTGcatCTGGTGAAAAC-3'
[0051] Downstream primer 8: 5'- CAGACCACCAGTCGCACTCGCAAACGC -3'
[0052] The site-directed mutagenesis primers were as described above, with lowercase letters indicating the mutation sites. Similarly, using plasmid DNA containing the DTE gene as a template, mutations were introduced via PCR. The PCR reaction program was as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 10 s, 72℃ for 3 min 30 s, repeated 35 times; followed by a 10 min extension at 72℃. The PCR product was treated with DpnI at 37℃ for 3 h, inactivated at 80℃ for 10 min, and then transformed into *E. coli* BL21(DE3) recipient bacteria. The transformed bacteria were plated on LB agar plates containing a final concentration of 50 mg / L kanamycin and incubated at 37℃ for 12 h. Single colonies were randomly selected for sequencing analysis, yielding the DTE mutants DTE-R69A, DTE-N70A, DTE-E75A, DTE-P140L, DTE-R165A, DTE-F361H, and DTE-E75A / F361H.
[0053] Example 3: Preparation of wet cells of recombinant tagatose-4-epimerase mutant
[0054] Recombinant *E. coli* BL21(DE3) / DTE-muts containing the gene expressing the recombinant tagatose-4-epimerase mutant obtained in Example 2 were inoculated into LB liquid medium containing a final concentration of 50 μg / mL kanamycin resistance and cultured at 37°C and 180 rpm for 10 h. Then, 2% (v / v) inoculum was added to fresh LB liquid medium containing a final concentration of 50 μg / mL kanamycin resistance and cultured at 37°C and 180 rpm until the bacterial OD600 reached 0.6-0.8. IPTG was added to a final concentration of 0.1 mM, and the culture was induced at 28°C for 12 h. After centrifugation at 4°C and 8000 rpm for 15 min, the supernatant was discarded, and the precipitate was collected to obtain the wet cells of the recombinant tagatose-4-epimerase mutant. These wet cells can be used directly as a biocatalyst or for protein purification.
[0055] Example 4: Isolation and purification of tagatose-4-epimerase mutant
[0056] Preparation of the pure enzyme solution of the mutant tagatose-4-epimerase described in this invention: Resuspension of 0.2 g of wet bacterial cells containing the tagatose-4-epimerase mutant encoding gene in 9.8 mL of 100 mM, pH 8.0 sodium phosphate buffer solution was performed under ice bath conditions using ultrasonic disruption (200 W power, 1 s duration, 2 s interval, continuous disruption for 15 min) to obtain cell lysate. The cell lysate obtained after ultrasonic disruption was centrifuged at 8000 rpm and 4℃ for 10 min, and the supernatant obtained was the desired crude enzyme solution. The crude enzyme solution can be further purified to obtain the pure enzyme solution. The SDS-PAGE image of tagatose-4-epimerase is shown below. Figure 1 As shown. Among them, Figure 1 From left to right, lane 1 is the protein molecular weight marker, lane 2 is the crude tagatose-4-epimerase, and lane 3 is the pure tagatose-4-epimerase mutant enzyme.
[0057] Example 5: Determination of the catalytic activity of tagatose-4-epimerase mutant
[0058] The crude wild-type tagatose-4-epimerase and the crude recombinant tagatose-4-epimerase mutants DTE-R69A, DTE-N70A, DTE-E75A, DTE-P140L, DTE-R165A, DTE-F361H, and DTE-E75A / F361H obtained by isolating and purifying according to the method in Example 4 were used to catalyze the substrate (D-fructose).
[0059] The enzyme catalytic system composition and catalytic conditions are as follows: Wet bacterial cells were resuspended and diluted with phosphate buffer (100 mM, pH 8.0), and D-fructose was added to a final concentration of 50 g / L and Ni to a final concentration of 1 mM. 2+ A 1 mL reaction system was prepared using phosphate buffer (50 mM, pH 8.0). The reaction was carried out at 75°C and 1000 rpm for 30 min, then terminated by boiling in water for 10 min. After centrifugation at 13000 rpm for 10 min, the supernatant was diluted appropriately and filtered through a membrane. The conversion rate was detected by high-performance liquid chromatography (HPLC). A schematic diagram of the enzymatic synthesis of D-tagatose is shown below. Figure 2 As shown.
[0060] The HPLC detection method was as follows: A Thermo High Performance Liquid Chromatography (HPLC) system (Milford, USA) and a differential detector were used. The analytical column was a Sugar-Park (300 × 6.5 mm). The mobile phase was 0.5 mg / mL EDTA-calcium disodium, and the solvent was ultrapure water. The column temperature was set to 80℃, the flow rate was maintained at 0.4 mL / min, and the injection volume was 10 μL. The external standard method was used to determine the conversion rate of D-fructose and the yield of D-tagatose based on the peak retention time and peak area. A schematic diagram of the HPLC detection of the substrate D-fructose and the product D-tagatose is shown below. Figure 3 As shown in the bar chart. The relative enzyme activities of wild-type tagatose-4-epimerase and tagatose-4-epimerase mutants are shown in the bar chart. Figure 4 As shown.
[0061] The relative activities of wild-type DTE and tagatose-4-epimerase mutants are shown in Table 1 below:
[0062] Table 1: Relative activities of wild-type DTE and tagatose-4-epimerase mutant
[0063] tagatose-4-epimerase mutant Relative activity (%) WT 100 R69A 98 N70A 65 E75A 120 P140L 123 R165A 120.3 F361H 120.6 E75A / F361H 126
[0064] Example 6: Application of recombinant tagatose-4-epimerase wild-type DTE in the preparation of D-tagatose
[0065] Using the recombinant Escherichia coli BL21(DE3) / DTE wet cells containing the recombinant expression plasmid obtained in Example 4 as a biocatalyst, D-tagatose was prepared by catalytic reaction with D-fructose as a substrate. Example 7 used this as a control.
[0066] The enzyme catalytic system composition and catalytic conditions are as follows: Crude enzyme was diluted with phosphate buffer (100 mM, pH 8.0), and D-fructose was added to a final concentration of 50 g / L and Ni to a final concentration of 1 mM. 2+ A 1 mL reaction system was prepared using phosphate buffer (50 mM, pH 8.0). The reaction was carried out at 75 °C and 1000 rpm for 30 min, and then terminated by boiling in water for 10 min. After centrifugation at 13000 rpm for 10 min, the supernatant was taken, diluted appropriately, filtered through a membrane, and detected by high performance liquid chromatography (HPLC).
[0067] Example 7: Application of recombinant tagatose-4-epimerase mutant E75A / F361H in the preparation of D-tagatose
[0068] Using the crude enzyme solution of recombinant Escherichia coli BL21(DE3) / DTEE75A / F361H containing the recombinant expression plasmid obtained in Example 4 as a biocatalyst, D-tagatose was synthesized enzymatically using D-fructose as a substrate.
[0069] The catalytic reaction system and catalytic conditions are as follows: the final concentration of tagatose-4-epimerase is 40 g / L, the final concentration of D-fructose is 50 g / L, and Ni is added at a final concentration of 1 mM. 2+ A 1 mL conversion system was constructed using sodium phosphate buffer solution (pH 8.0) as the reaction medium. The reaction was carried out at 75°C and 1000 rpm. HPLC analysis showed that the relative enzyme activity was 1.26 times higher than that of the original strain.
[0070] The above description is merely a detailed explanation of preferred embodiments and principles of the present invention. For those skilled in the art, there may be changes in specific implementation methods based on the ideas provided by the present invention, and these changes should also be considered within the scope of protection of the present invention.
Claims
1. A tagatose-4-epimerase mutant, characterized in that, It is derived from the amino acid sequence shown in SEQ ID NO.1 by site-directed mutation, the mutation being: (1) the arginine at position 165 is mutated to alanine.
2. The encoding gene of the tagatose-4-epimerase mutant according to claim 1.
3. A recombinant vector constructed from the encoding gene of claim 2.
4. A recombinant genetically engineered bacterium obtained by transformation of the recombinant vector according to claim 3.
5. The application of the tagatose-4-epimerase mutant as described in claim 1 in the preparation of D-tagatose.
6. The application according to claim 5, characterized in that, The application is as follows: using wet cells obtained by fermentation culture of recombinant genetically engineered bacteria containing the tagatose-4-epimerase mutant encoding gene, or crude enzyme extracted from wet cells after ultrasonic disruption, or purified enzyme as a catalyst, and D-fructose as a substrate, in Ni 2+ In the presence of the substance, the reaction is carried out in a sodium phosphate buffer solution with a pH of 7-9 at 70-80°C. After the reaction is complete, the reaction solution is separated and purified to obtain D-tagatose.
Citation Information
Patent Citations
Tagolose-4-epimerase mutant and application thereof
CN119320766A
Tagolose-4-epimerase mutant and application thereof in preparation of D-tagatose
CN119932003A