RNA interference fragment of crustacean hyperglycemia hormone gene and application thereof

Abstract

The invention relates to the technical field of RNA interference, and particularly discloses an RNA interference fragment of a crustacean hyperglycemia hormone gene and application of the RNA interference fragment. The RNA interference fragment provided by the invention is injected into a third step foot of a river crab in an injection manner and is used for interfering the mRNA expression quantity of a hyperglycemia hormone gene CHH of a crustacean of the river crab. The fighting behavior of the eriocheir sinensis is effectively controlled, the yield in large-scale breeding of the eriocheir sinensis is improved, and economic losses caused by incomplete crabs due to fighting of the eriocheir sinensis are reduced.

Description

Technical Field

[0001] The invention relates to the technical field of RNA interference, and in particular to an RNA interference fragment of a crustacean hyperglycemic hormone gene and application thereof. Background Art

[0002] Chinese mitten crab (Eriocheir sinensis), also known as river crab, is an important aquaculture species in my country. Fighting behavior often occurs in its pond culture, resulting in animal limb mutilation and consumption of a large amount of energy, which is harmful to the growth and survival of farmed crustaceans and ultimately leads to loss of economic value. Studies have confirmed that serotonin and dopamine are involved in the regulation of river crab fighting behavior through related receptors. Studying the fighting behavior of Chinese mitten crab is of great significance for the large-scale culture of this species.

[0003] RNA interference is a gene silencing phenomenon at the post-transcriptional level. It is achieved by artificially synthesizing double-stranded RNA in vitro or double-stranded RNA in vivo to specifically degrade homologous mRNA in cells, thereby silencing the corresponding gene and preventing gene expression. It has the advantages of specificity, high efficiency, and easy operation. Summary of the invention

[0004] The present invention provides an RNA interference fragment of a crustacean hyperglycemic hormone gene and application thereof, which solves the problem of frequent fighting behaviors of river crabs during aquaculture, which results in a decrease in aquaculture yield.

[0005] The present invention adopts the following technical scheme: an RNA interference fragment of a crustacean hyperglycemic hormone gene, wherein the nucleotide sequence of the RNA interference fragment is shown in SEQ ID NO:1.

[0006] An RNA interference fragment of a crustacean hyperglycemic hormone gene, the nucleotide sequence of the RNA interference fragment is shown in SEQ ID NO:2.

[0007] An RNA interference fragment of a crustacean hyperglycemic hormone gene, the nucleotide sequence of the RNA interference fragment is shown in SEQ ID NO:3.

[0008] The application of RNA interference fragments of crustacean hyperglycemic hormone genes in the preparation of drugs for inhibiting the fighting behavior of Chinese mitten crabs.

[0009] The application of the RNA interference fragment of the crustacean hyperglycemic hormone gene is to inject the RNA interference fragment into the third walking leg of the river crab to interfere with the expression of the mRNA of the river crab crustacean hyperglycemic hormone gene CHH.

[0010] Beneficial effects of the present invention:

[0011] 1. The present invention utilizes RNA interference technology to silence the expression of the crustacean hyperglycemic hormone gene CHH in Chinese mitten crab, thereby effectively controlling the fighting behavior of Chinese mitten crab, which is beneficial to increasing the yield in large-scale breeding of Chinese mitten crab and reducing the economic losses caused by the incompleteness of the crab itself due to fighting.

[0012] 2. The preparation method of the RNA interference fragment provided in the present invention is simple, and the injection method is simple to apply and easy to promote. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a schematic diagram of the results of culturing different RNA interference fragments with the thoracic ganglion of Chinese mitten crab in vitro for 16 hours in the embodiments of the present invention.

[0014] Figure 2 Schematic diagram of the effect of the RNA interference fragment in Example 1 of the present invention and the comparative example RNA fragment on CHH mRNA expression 48 hours after injection into crab.

[0015] Figure 3 This is a graph showing the effect of the RNA interference fragment on the fighting behavior of Chinese mitten crab in Example 5 of the present invention. DETAILED DESCRIPTION

[0016] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0017] Embodiment 1: A method for preparing an RNA interference fragment of a crustacean hyperglycemic hormone gene comprises the following steps:

[0018] (1) dsRNA primer design

[0019] Place the CDS region of the target gene in the following website: http: / / www.detaibio.com / tools / index.php?r=transmembrane% to predict the transmembrane region, ensure that the designed dsRNA interference primer is not in the transmembrane region, use Primer Premier 5 to design the interference fragment primer, the primer length is about 20bp, the interference fragment length is 200-500bp, the GC content is 40%-60%, and the Tm value is 55℃-66℃. And add the T7 promoter sequence (TAATACGACTCACTATAGGG) at the 5' end of the forward primer and the reverse primer at the same time. In order to ensure that an effective interference fragment is finally obtained, three interference fragments, dsCHH-1, dsCHH-2 and dsCHH-3, were designed. The interference fragment designed using the EGFP gene was used as the control group. The specific sequences of dsCHH-1, dsCHH-2 and dsCHH-3 and the upstream and downstream primers of the EGFP gene are shown in Table 1;

[0020] (2) dsRNA template preparation

[0021] First, the target gene interference fragment was amplified, and the crab tissue cDNA was used as the PCR amplification template, and the target gene interference fragment was amplified with dsRNA primers. The PCR reaction system was: 2×Taq PCR MasterMix, 10μL; forwardPrimer, 1μL; reverse Primer, 1μL; cDNA, 1μL; ddH2O, 7μL. The PCR reaction program was: 94℃, 5min; 94℃, 30s, 64℃, 30s, 72℃, 3min, 34cycles; 72℃, 10min. The obtained PCR product was purified with DNA Clean&ConcentratorTM-5 (ZYMO RESEARCH, USA), and the DNA concentration was detected using Nanodrop 2000 to obtain high-concentration, high-quality interference fragment template DNA, which was then connected, transformed and sent to Sangon Company (Shanghai) for sequencing to ensure that the interference fragment template sequence was correct.

[0022] (3) Synthesis of dsRNA interference fragments

[0023] The dsRNA interference fragment was synthesized according to the Novagen T7 RNAi Transcription Kit (TR102). The reaction system was: 8 μL NTP Mix, 2 μL 10× Transcription Buffer, 2 μL T7 Enzyme Mix, 1-4 μL DNA template (1 μg added), RNase-free H 2O was added to a total volume of 20 μL, and then reacted in a PCR instrument at 37°C for 2 hours. The obtained transcription product, i.e., dsRNA, was subjected to double enzyme digestion, with the following system: Transcription Product, 20 μL; RNase-free H2O, 17 μL; DNase I, 1 μL; RAase T1 (10 U / μL), 2 μL, and the total reaction system was 40 μL. Then, it was placed in a PCR instrument and incubated at 37°C for 30 minutes.

[0024] (4) Purification of dsRNA interference fragments

[0025] The dsRNA interference fragment was purified by phenol / chloroform extraction. The digested dsRNA was added to an equal volume of phenol (water-saturated phenol / chloroform = 1:1), mixed at room temperature, and then centrifuged at 4°C, 12000rpm for 15min; the supernatant was transferred to a new 1.5mL centrifuge tube, an equal volume of chloroform was added, and centrifuged at 4°C, 12000rpm for 15min; the supernatant was taken, 1 / 10 of the supernatant volume of 3M sodium acetate and 2.5 times the volume of anhydrous ethanol were added, and precipitated at -80°C for 3h, and then centrifuged at 4°C, 12000rpm for 30min; the supernatant was discarded, 500μL of 75% ethanol was added, and the precipitate was washed; centrifuged at 4°C, 12000rpm for 10min, and the ethanol was discarded; dried in a fume hood, the precipitate was dissolved in an appropriate amount of DEPC water, and stored at -80°C for use.

[0026] Table 1 Sequence list of primers for dsCHH-1, dsCHH-2, dsCHH-3 and EGFP gene

[0027]

[0028] The nucleotide sequences of the primers in Table 1 are shown in SEQ ID NO: 5 to SEQ ID NO: 12.

[0029] Example 2: RNA interference fragment of crustacean hyperglycemic hormone gene, the nucleotide sequence of RNA interference fragment dsCHH-1 is: (SEQ ID NO: 1)

[0030] CAACTGAGAGACGGTGCAGACTCCTCAGCAGCGTTGGGAGAGCTGAGTGTAGCCGGGGAGGGACCAGCCGGCCACCCTCTGGAGAAACGCCAGGCCTACGACCGCTCCCGCAAGGGCATCTACGACAGGTCCCTCTTCAGCAAGCTGGAACACGTGTGCGACGACTGCTTCAACCTCTACCGCTCGTCCCATGTCGCTAGTGGCTGCAGGAGAGACTGTTTCGACAATGATATGTTTGAGTACTGTGTGGAGGGCCTTCTThe nucleotide sequence of dsCHH-2 is: (SEQ ID NO: 2)

[0031] GCCTCGATTCTCATCCTCCCCCATGCACACGCCCGCTCAGCAGAAGGGTTCGGGCGCATGGAGAGGTTGCTGAGTCAACTGAGAGACGGTGCAGACTCCTCAGCAGCGTTGGGAGAGCTGAGTGTAGCCGGGGAGGGACCAGCCGGCCACCCTCTGGAGAAACGCCAGGCCTACGACCGCTCCCGCAAGGGCATCTACGACAGGTCCCTCTTCAGCAAGCTGGAACACGTGTGCGACGACTGCTTCAACCTCTACCGCTCGTCCCATGTCGCTAGTGGCTGCAGGAGAGACTGTTTCGACAATGATATGTTTGAGTACTGTGTGGAGGGCCTTCTThe nucleotide sequence of dsCHH-3 is: (SEQ ID NO: 3)

[0032] GGTGGTGGTGGTAGCTCTTGGCGCCTCGATTCTCATCCTCCCCCATGCACACGCCCGCTCAGCAGAAGGGTTCGGGCGCATGGAGAGGTTGCTGAGTCAACTGAGAGACGGTGCAGACTCCTCAGCAGCGTTGGGAGAGCTGAGTGTAGCCGGGGAGGGACCAGCCGGCCACCCTCTGGAGAAACGCCAGGCCTACGACCGCTCCCGCAAGGGCATCTACGACAGGTCCCTCTTCAGCAAGCTGGAACACGTGTGCGACGACTGCTTCA

[0033] Comparative Example: Double-stranded RNA of dsEGFP enhanced green fluorescent protein, nucleotide sequence: (SEQ ID NO: 4)

[0034] ACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTA CAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGC

[0035] Embodiment three:

[0036] Healthy crabs were selected, and their thoracic ganglia were taken after anesthesia on ice, and placed in 24-well culture plates, and 1 μg of interference fragments (dsEGFP, dsCHH-1, dsCHH-2, dsCHH-3) were added respectively, with dsEGFP as the control group, and 6 replicates per group. 200 μL of M199 culture medium containing 1% double antibody was added to each well, and the cells were placed in a constant temperature incubator at 28°C for 16 hours, and then samples were taken and the expression of CHH mRNA was analyzed.

[0037] In order to further determine the effective time of dsRNA in crabs, the interference fragment was injected into the crabs from the third walking leg at a dose of 1 μg / g. After 48 hours, the thoracic ganglia were taken out, quickly placed in liquid nitrogen and stored in a -80℃ refrigerator. The expression of CHH mRNA was analyzed by qRT-PCR. The specific sequences of CHH primers are shown in Table 2.

[0038] Table 2 CHH primer sequences

[0039] name Nucleotide sequence (5'-3') CHH-F GTGGTTGGCAGGAAGAAGTAGA (SEQ ID NO: 13) CHH-R GCTGTGACGGAGATGGCTAAAA (SEQ ID NO: 14)

[0040] After the interference fragments were cultured with the thoracic ganglion of Chinese mitten crab in vitro for 16 hours, the results showed that all three dsCHH interference fragments reduced the expression level of CHH mRNA. Figure 1 As shown, the interference fragments of dsCHH-1 and dsCHH-2 were significantly lower than those of the dsEGFP group, and the interference fragment of dsCHH-3 was extremely significantly lower than that of the dsEGFP group, indicating that the interference fragments of dsCHH-1, dsCHH-2, and dsCHH-3 can effectively inhibit the expression of CHH mRNA in thoracic ganglia, among which dsCHH-3 has the best interference effect.

[0041] In order to further explore the effective time of dsCHH interference fragment in vivo, the dsCHH-3 interference fragment was injected into the crab and the brain ganglion and thoracic ganglion were obtained 48 hours later. Figure 2 As shown, compared with the dsEGFP group, Figure 2 (A) Cerebral ganglion and Figure 2 (B) The expression of CHH mRNA in the thoracic ganglion of the dsCHH-3 group was extremely significantly reduced.

[0042] Embodiment 4:

[0043] Behavioral experiments

[0044] After the crabs were cultured in the monoculture system for 7 days, two crabs with a weight difference of no more than 4% were randomly selected to ensure that their appendages were intact and without obvious damage. The third walking leg of the crabs was injected with dsEGFP and dsCHH-3 interference fragments at a dose of 1 μg / g. After the injection, they were returned to the monoculture system and placed in a round bucket with an opaque partition 48 hours later. When the crabs adapted for 10 minutes, the fighting behavior was recorded for 1 hour with a camera.

[0045] The results are as follows Figure 3 show, Figure 3 The number of times the crab approaches as shown in (A) Figure 3 The number of contacts shown in (B) and Figure 3 The number of fights shown in (C) was significantly reduced. Figure 3 The total fighting duration shown in (D) is shortened but not significantly. These results all indicate that CHH can promote the fighting behavior of Chinese mitten crabs, and the RNA interference fragment prepared by the present invention can significantly reduce the fighting behavior of Chinese mitten crabs. This provides a basis for the preparation of drugs for preventing fighting behavior in large-scale breeding of Chinese mitten crabs.

[0046] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. An RNA interference fragment of a crustacean hyperglycemic hormone gene, characterized in that: The nucleotide sequence of the RNA interference fragment is shown in SEQ ID NO:

1.

2. An RNA interference fragment of a crustacean hyperglycemic hormone gene, characterized in that: The nucleotide sequence of the RNA interference fragment is shown in SEQ ID NO:

2.

3. An RNA interference fragment of a crustacean hyperglycemic hormone gene, characterized in that: The nucleotide sequence of the RNA interference fragment is shown in SEQ ID NO:

3.

4. Use of the RNA interference fragment of the crustacean hyperglycemic hormone gene according to any one of claims 1 to 3 in the preparation of a drug for inhibiting the fighting behavior of Chinese mitten crab.

5. The use of the RNA interference fragment of the crustacean hyperglycemic hormone gene according to claim 4, characterized in that: The RNA interference fragment is injected into the third walking leg of the river crab to interfere with the mRNA expression of the river crab crustacean hyperglycemic hormone gene CHH.

Images