Gene for regulating and controlling corn kernel texture and carotenoid synthesis

Abstract

The invention discloses a second key QTL gene Ven2 for controlling hard flour endosperm formation, the genes Ven2 and Ven1 jointly regulate hard flour endosperm formation, the expression combination of the two genes can be used for breeding and improvement of hard flour corn and / or nutrition fortified corn, new corn varieties are created, and the application prospect is wide.

Description

Technical Field

[0001] The invention belongs to the field of agricultural biotechnology and relates to genes for regulating corn kernel texture and carotenoid synthesis, and specifically relates to an application of a combination of two genes, Ven1 (NCBI accession number Zm00001d026056) and Ven2 (NCBI accession number GRMZM2G012966) or their functionally inactivated mutants, in regulating corn kernel texture and carotenoid synthesis. Background Art

[0002] Maize kernel texture is an important agronomic trait, which is determined by the ratio of hard endosperm to floury endosperm. Kernels with more hard endosperm are hard and not easy to break. They can resist the friction generated during mechanical harvesting, transportation and storage of corn and maintain the integrity of the kernels. They also help prevent kernel mildew, but directly affect the processing and cooking characteristics of corn. Kernels with more floury endosperm are softer in texture, more prone to breakage, and more likely to mildew, thereby reducing the appearance and nutritional quality of corn. In addition, a high proportion of hard endosperm will increase the bulk density of corn and is also beneficial to the dehydration of kernels during filling and maturity. Therefore, breeders tend to select varieties and materials with hard kernel texture. However, the QTLs and key genes that control the formation of hard / floury endosperm in natural maize populations have always been an unsolved mystery.

[0003] The ratio of hard / floury endosperm determines the texture of corn kernels. Kernels with more floury endosperm are softer in texture, less transparent, and have a floury texture; kernels with more hard endosperm are hard, have good light transmittance, and are hard. Corn endosperm mainly contains starch and storage protein (about 60% of which are alcohol-soluble proteins). The synthesis and storage of starch in the kernel endosperm are carried out in amyloplasts, which are surrounded by a phospholipid bilayer membrane to form starch granules (SGs); while alcohol-soluble proteins are synthesized in the rough endoplasmic reticulum and wrapped by the endoplasmic reticulum membrane to form protein bodies (PBs); when mature, the diameter of the protein body is 1-2μm, which is much smaller than the size of starch granules 20-30μm (Larkins and Hurkman 1978; Lending and Larkins 1989; Gibbon and Larkins 2005). During the development of the endosperm, the protein bodies in the peripheral area of ​​the endosperm are dense and the starch granules are small, while the protein bodies in the central area are sparse and the starch granules are large. When the seeds mature and dehydrate, the starch granules in the central area of ​​the endosperm are completely exposed due to the lack of protein bodies, forming a loose powdery / soft endosperm; while all the membrane systems in the cells in the peripheral area of ​​the endosperm are broken, and a large number of alcohol-soluble proteins and all other cellular contents (cytoplasm, organelles and cytoskeleton, etc.) are intertwined to form a protein matrix (Proteinaceous matrix), which tightly wraps the starch granules, forming a dense hard endosperm like concrete (Gibbon and Larkins 2005).

[0004] Most of the genes reported to affect hard / floury endosperm of grains are mutants that affect alcohol-soluble protein synthesis, protein body formation, and starch synthesis. This series of single-gene floury mutants (Opaque / floury) mainly revealed the key roles of alcohol-soluble proteins / protein bodies, starch / starch bodies, and cytoskeleton-related proteins in the formation of hard endosperm, but how protein bodies and starch bodies interact in this process and which metabolites affect them are unclear (Zhang et al. 2018). In addition, hard and floury endosperm phenotypes have rich variations in natural maize populations, ranging from almost completely hard to completely floury materials, but the QTLs and molecular mechanisms that control their formation are poorly understood. Since 2016, our research group has used the hard maize inbred line W64A and the floury maize inbred line A619 to construct the hard and floury near-isogenic lines NILW64A and NILA619 under the A619 background. BSA sequencing was then used to fine-tune the main QTL for the formation of hard endosperm, Ven1 (Wang et al. 2020). Ven1 RNAi transgenic materials (KN5585 inbred background) showed a completely floury endosperm phenotype. Ven1 encodes β-carotene hydroxylase 3 (CHYB1 / HYD3), which produces polar lutein and zeaxanthin by hydroxylating the β-ionone ring of non-polar α- / β-carotene. Mutations in Hyd3 can effectively increase the content of β-carotene (Vallabhaneni et al. 2009; Yan et al. 2010), while Ven1 A619 It is such a superior allele. Ven1 A619The 3' end of the gene contains a 1250-bp deletion, which is similar to a loss-of-function mutant. Ven1 has a fragment deletion and low expression in the floury near-isogenic line NILA619, which results in the inability of β-carotene to be hydroxylated into polar carotene downstream, increasing the content of it and other non-polar carotenes upstream, thereby changing the physicochemical properties of the starch membrane. The starch membrane of NILA619 is more stable and expands irregularly, and its degradation is delayed during the dehydration of endosperm cells, which hinders the interaction between protein bodies and starch granules and the formation of protein matrix, and floury endosperm is formed when the grain matures. In contrast, Ven1 is highly expressed in the hard near-isogenic line NILW64A, and the content of non-polar carotenoids is reduced. The starch membrane is regular and easily degraded, which is conducive to the concentration of protein bodies and cytoplasm on the surface of the starch body, forming a dense protein matrix surrounding structure, which is an important basis for the formation of hard endosperm. When constructing the backcross population of W64A and A619, the hard and powdery phenotypes did not separate in the first two generations. Moreover, when Ven1 RNAi / + pollen was hybridized with 262 inbred lines, more than 70% of the inbred lines had hard kernels throughout the ears. These results suggest that Ven1 may exist in natural populations. A619 The hard endosperm modifiers (Modifiers) can transform Ven1 A619 Cloning other key QTL genes / locus for hard / floury endosperm formation will further reveal the molecular genetic mechanism of hard / floury endosperm formation in natural populations and explore excellent allele variations for breeding improvement. Summary of the invention

[0005] After years of hard work, we used Ven1RNAi materials (KN5585 background) and G399 inbred lines containing modification factors to create near-isogenic lines. Through BSA sequencing, map-based cloning and genetic verification, we cloned the gene Ven2, which encodes the key enzyme for α-carotene synthesis, lycopene ε-cyclase LCYE (Lycopene ε-cyclase). The α-carotene (α-carotene) and β-carotene (β-carotene) synthesis pathways are two branches of the carotenoid pathway. These results show that the anabolism of carotenoids is a key factor affecting the formation of hard / floury endosperm; carotenoids are the third important metabolite that affects the formation of hard / floury endosperm in addition to the two main endosperm storage substances, protein bodies and starch bodies. The cloning of Ven2 not only has important theoretical research value, but also can create improved corn hard floury endosperm appearance quality and cultivate carotenoid nutrition-fortified corn. Accordingly, the present invention includes the following technical solutions.

[0006] The first aspect of the present invention provides a gene for regulating corn kernel texture and / or carotenoid synthesis, wherein the gene is gene Ven1 (NCBI accession number Zm00001d026056, also referred to herein as Ven1 W64A ) and the gene Ven2 (NCBI accession number GRMZM2G012966, encoding a functional lycopene ε-cyclase LCYE (Lycopene ε-cyclase) or LCYE protein, also referred to as Ven2 in this article G399 ) or its functionally inactive mutant (Ven1 A619 , Ven1RNAi; gene Ven2 KN5585 , Ven2 / function-inactive mutant), that is, a genetic combination of two genes, both of which are expressed simultaneously in corn, or in which the expression of the gene Ven1 is suppressed.

[0007] Based on the function of Ven2 and its loss-of-function mutants in regulating the formation of hard / floury endosperm phenotype in maize, the gene Ven2 can be regarded as a modifier of Ven1.

[0008] Optionally, the nucleotide sequence of the functionally inactive mutant of the above gene Ven2 (NCBI accession number GRMZM2G012966) is SEQ ID NO: 1, referred to herein as Ven2 KN5585 .

[0009] The second aspect of the present invention provides the use of the combination of the above-mentioned gene Ven1 and gene Ven2 / functional inactive mutant in regulating corn kernel texture and / or carotenoid synthesis.

[0010] Genes Ven2 and Ven1 jointly regulate the formation of hard-silty endosperm, and the expression combination of genes Ven1 and Ven2 can be used for the breeding and improvement of hard-silty corn and / or nutritional corn.

[0011] In one embodiment, the combination in the above-mentioned use comprises the following manner:

[0012] (A) When corn expresses or overexpresses one of gene Ven1 and gene Ven2, or expresses or overexpresses both gene Ven1 and gene Ven2, corn forms hard endosperm;

[0013] (B) When the Ven1 and Ven2 genes in corn are inactivated or their expression is inhibited at the same time, corn forms floury endosperm;

[0014] (C) When the gene Ven2 is expressed in corn (i.e., Ven2 functions normally) and the expression of the gene Ven1 in corn is inhibited (e.g., Ven1 RNAi), hard kernels are obtained and the lutein content of corn is significantly increased, with the lutein content reaching more than 48.6 μg / g;

[0015] (D) When maize expresses a functionally inactive mutant of the gene Ven2, such as Ven2 KN5585 Alternatively, when the expression of gene Ven2 is inhibited and the expression of gene Ven1 in corn is inhibited (such as Ven1RNAi), corn with completely powdery grains and significantly increased lycopene and β-carotene is obtained. The lycopene content is as high as 0.4μg / g and the β-carotene content is as high as 10μg / g, which can be used as nutritionally fortified corn.

[0016] The inhibition of the expression of the above-mentioned gene Ven1 or Ven2 includes, but is not limited to, down-regulation, inactivation, functional attenuation or knockout of the gene Ven1 or Ven2. The inhibition of the expression of the gene Ven1 or Ven2 is implemented by the following methods:

[0017] (1) Knockout of the gene Ven1 or Ven2 in maize chromosomes;

[0018] (2) downregulating the expression level of the gene Ven1 or Ven2 in maize chromosomes;

[0019] (3) replacing the gene Ven1 or Ven2 in the chromosome of wild-type corn with a mutant encoding a gene Ven1 or Ven2 that has lost its function or is downregulated; and / or

[0020] (4) Blocking, inhibiting or interfering with the expression of the gene Ven1 or Ven2 in the chromosome of wild-type corn.

[0021] Furthermore, the above method (2) can be selected from the following group:

[0022] (2-1) mutation of the promoter region and / or coding region of the Ven1 or Ven2 gene results in downregulation of the expression level of the Ven1 or Ven2 gene;

[0023] (2-2) mutation of upstream regulatory factors of gene Ven1 or Ven2 leads to downregulation of the expression level of gene Ven1 or Ven2; or

[0024] (2-3) The interacting proteins of the Ven1 or Ven2 proteins are introduced into wild-type maize to change the function of the Ven1 or Ven2 genes.

[0025] Optionally, the above method (3) can be selected from the following group:

[0026] (3-1) Base mutations occur in the coding region, resulting in loss of function of the encoded protein Ven1 or Ven2;

[0027] (3-2) Frameshift mutation occurs in the coding region, resulting in loss of function of the encoded protein Ven1 or Ven2.

[0028] In one embodiment, the expression inhibition of the above-mentioned gene Ven1 or Ven2 can be implemented by gene editing technology, antisense nucleic acid, and transcriptional regulation.

[0029] The above-mentioned gene editing technology can be selected from the following groups: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, MuGENT.

[0030] In one embodiment, the above gene Ven1 or gene Ven2 / functional inactive mutant such as Ven2 KN5585 Overexpression was achieved by:

[0031] (i) cloning the gene Ven1 or gene Ven2 / functionally inactive mutant into a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, i.e., a gene Ven1 or gene Ven2 / functionally inactive mutant overexpression vector, and transforming corn plants by Agrobacterium-mediated method to obtain transgenic corn overexpressing the gene Ven1 or gene Ven2 / functionally inactive mutant; or

[0032] (ii) Gene Ven1 or gene Ven2 / functionally inactive mutant is cloned on a maize chromosome by gene editing technology to obtain transgenic maize that overexpresses gene Ven1 or gene Ven2 / functionally inactive mutant.

[0033] Preferably, the corn is selected from the following varieties: existing wild species, inbred lines, farmer species and hybrids.

[0034] The third aspect of the present invention provides a gene Ven2 mutant having a nucleotide sequence as shown in SEQ ID NO:1.

[0035] Compared with the Ven2 genotype with normal function (NCBI accession number GRMZM2G012966, also referred to as Ven2 G399 ), the allele Ven2 KN5585 There is a 400 bp fragment inserted in the promoter region and a 7000 bp fragment inserted at the 3' end of the gene. At the same time, due to the large splicing variation, a premature termination codon appears in the fifth exon of the cDNA sequence, which leads to the biological function defect of LCYE protein.

[0036] A fourth aspect of the present invention provides a method for identifying a gene expressing a Ven2 mutant Ven2 as described above. KN5585 The method for producing corn comprises the following steps:

[0037] Extract maize genomic DNA and perform PCR amplification using the following primer pairs:

[0038] Forward primer Ven2-F: ATTCCAGCCCAATAAAATAGCC (SEQ ID NO: 2),

[0039] Reverse primer Ven2-R: GACGACGAGACACGAGAGGC (SEQ ID NO: 3),

[0040] When the PCR product size is 640 bp and the nucleotide sequence of the amplified fragment is SEQ ID NO: 4, it indicates that the corn genome contains a functionally inactive gene Ven2 mutant having a nucleotide sequence of SEQ ID NO: 1, namely, Ven2 KN5585 ;

[0041] ATTCCAGCCCAATAAAATAGTCGGAGCCAACCCAAAAGCATCCGACCCAAATGACAGCCGAGACCAATGCGTGAAAGCACCACGTCACTGTCACTGACACGCGGGACTGGCAGCGCAGGTGGAGAGTGGACACTCACGCCTAGAGATGGCCAAACGGGCCGGCCCGGCCCGGCCCGGGCCCGGTGAAGCCCGACTAAAACTAAAACCGGCTCACTGAGAGCTGAACAATGAGCTTAAGTTCTGTCAAGCCGGCCGCGGCCCAGCCTAACGGGGCCGGCCCGTTTAGCACGAAAAAACGGGCCAAAAAGCGGGCTAAACGGGCCGGTAAGCACGTTTTAGTGTAAAAAAAACGGGCTTAACGGGCTTAGAGGTAACGGCCGTCACTGCTGCTGGCCGTGCCTGAGTTCACTGTCCAAACCCGCCCGCTTATTCTACCGTGCCGGGCTCGGACCAGGCCCAAAAAGTAAACTTCGTGCCGGGCTCACGGGCGTCGTGCTTTTTGGCCATCTATACTCACGCCCCCGACGCCCTCCTGAAAATGCGAAAACCATATCCACGCCGCGTGGGCCCTGTGCCAATCCAAAACCGCCACGTGCCATATCCGGTGATACGCCTCCCCGGCCTCTCGTGTCTCGTCGTC(SEQ ID NO:4);

[0042] When the size of the PCR product is 275 bp and the nucleotide sequence of the amplified fragment is SEQ ID NO:5, it indicates that the maize genome contains the gene Ven2.

[0043] ATTCCAGCCCAATAAAATAGCCGGAGCCAACCCAAAAGCATCCGACCAAAATAACAGCCGAGCCCAATGCGTGAAAGCACCACGTCACTGTCACTGACACGCGGGACGGG CAGCGCAGCCGGAGAGGTGGAGAGTGGACACTCACGGCTCACGCCCCCGGCGCCCTCCTGAAAATGCGAAAACCATATCCACGCCGCGTGGGCCCTGTGCCAATCCAAAACCGCCACGTGCCATATCCGGTGATACGCCTCCCCGGCCTCTCGTGTCTCGTCGTC (SEQ ID NO: 5).

[0044] Preferably, the above method further comprises the following step of detecting gene Ven1 (NCBI accession number Zm00001d026056):

[0045] Extract maize genomic DNA and perform PCR amplification using the following primer pairs:

[0046] Forward primer Ven1-F: ACACCACATGGACAAGTTCG (SEQ ID NO: 6),

[0047] Reverse primer Ven1-R1: ACACTCTGGCCCATGAACAC (SEQ ID NO: 7),

[0048] Reverse primer Ven1-R2: ACAGCAATACAGGGGACCAG (SEQ ID NO: 8),

[0049] When the PCR product size is 293 bp and the nucleotide sequence of the amplified fragment is SEQ ID NO: 9, it indicates that the maize genome contains a functional allele Ven1 W64A ;

[0050] ACACCACATGGACAAGTTCGGCGGCGTCCCGTATGGGCTCTTCCTGGGACCAAAGGTGCGCGAGTGGTGTGGCCCTTCTTCTTTTGTCCTCGCATTGCCTGTGAATCCGCGATCCTCTGCGACTGACGTCTGTGGCTGTGGCTGTGGTT TCAGGAGCTGGAGGAGGTTGGTGGCCTGGACGAGCTTGTTAGCAGTCCGGTGAGTGAAGCTACTGATACTGAAGACGCAGGAGAAGAAAAGACGCGTCCAGTTGTATGCGTTGTCCGAACAAGCGTGTTCATGGGCCAGAGTGT(SEQID NO:9);

[0051] When the PCR product size is 540 bp and the nucleotide sequence of the amplified fragment is SEQ ID NO: 10, it indicates that the maize genome contains the loss-of-function allele Ven1 A619 , that is, the gene has undergone a Ven1 deletion mutation and has no function.

[0052] (SEQ ID NO: 10).

[0053] Optionally, the above PCR amplification is a PCR MIX method.

[0054] A fifth aspect of the present invention provides a kit for implementing the above identification method, comprising the following PCR primers for amplifying gene Ven1 (NCBI accession number Zm00001d026056) and gene Ven2 (NCBI accession number GRMZM2G012966):

[0055] Forward primer Ven2-F: ATTCCAGCCCAATAAAATAGCC (SEQ ID NO: 2),

[0056] Reverse primer Ven2-R: GACGACGAGACACGAGAGGC (SEQ ID NO: 3);

[0057] Forward primer Ven1-F: ACACCACATGGACAAGTTCG (SEQ ID NO: 6),

[0058] Reverse primer Ven1-R1: ACACTCTGGCCCATGAACAC (SEQ ID NO: 7),

[0059] Reverse primer Ven1-R2: ACAGCAATACAGGGGACCAG (SEQ ID NO: 8).

[0060] The kit may further include a nucleic acid extraction system for extracting total RNA or DNA from corn plant tissues such as leaves or kernels, and / or a reverse transcription system for reverse transcription into cDNA.

[0061] Furthermore, the kit also includes instructions for use, which record the operating steps for extracting plant RNA or DNA, the steps for detecting the mutant of the gene Ven2 with a nucleotide sequence such as that shown in SEQ ID NO: 1, and the identification criteria.

[0062] For example, the instructions may be written on bottles, test tubes and the like, boards, or on a separate piece of paper, or on the outside or inside of a container, such as a paper with an operation demonstration video APP download window such as a QR code. The instructions may also be in multimedia form, such as a CD, U disk, network disk, etc.

[0063] Through years of multi-generation genetic population creation, BSA sequencing, map-based cloning and genetic verification, the present invention cloned the second key QTL controlling the cultivation of corn hard powder, Ven2, which encodes lycopene ε cyclase LCYE (Lycopene ε-cyclase), and found that the anabolism of carotenoids is a key factor affecting the formation of hard / floury endosperm, further expanding the genetic basis for controlling the formation of hard / floury endosperm of corn in natural populations; and providing a solid theoretical foundation, gene resources and genetic materials for the genetic improvement of corn hard endosperm, carotenoid nutritional fortification and the cultivation of high-nutritional quality corn. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 The kernel phenotype, gene localization map and Ven2 gene cloning of each corn material in Examples 1-3 are shown. Among them, a: ear photos of corn G399, KN5585, Ven1RNAi and G399 x Ven1RNAi; b: kernel cross-section; c.: (G399 x Ven1RNAi)xVen1RNAiF 1 BC 1 The ear of F 1 BC 1Cross-section of isolated hard-silty kernels; e: BSA localization map of Ven2; f: map-based cloning of Ven2; g and h: 24DAP endosperm RNA-seq data of Ven1 and Lcye in hard / silty near-isogenic lines and their parents.

[0065] Figure 2 The kernel phenotype and hard endosperm ratio statistics of each corn material in Examples 4-6, the genetic verification of Ven2 and the phenotypic investigation process are shown. Among them, a: F obtained after three generations of backcrossing of corn G399 x Ven1RNAi with Ven1RNAi as the recurrent parent 1 BC 3 Cluster, hard powder separation; b: NIL Ven2 G399 (Hard) and NIL Ven2 KN5585 (Powder) ear image; c: NIL Ven2 G399 and NIL Ven2 KN5585 Longitudinal section of kernel; d: NIL Ven2 G399 and NIL Ven2 KN5585 Statistics of hard endosperm proportion, 12 replicates for each material, data are expressed as mean ± standard deviation, data were analyzed using a two-tailed t-test, and p-values ​​were calculated; e: Genetic verification of Ven2 (Lcye) gene.

[0066] Figure 3 The results show the determination of various carotenoid contents in different corn materials in Example 7 and the detection of various carotenoid contents in the endosperm of different genetic materials at 20DAP. Among them, Ven2 and Ven1 encode LCYE and HYD3 proteins respectively, and Ven2 G399 The allele of the normal LCYE protein, Ven2 KN5585 It is an allele of functionally inactive LCYE protein. G399 (genotype is Lcye; Hyd3, Ven2 and Ven1 functions are normal), Ven1RNAi (KN5585 background, genotype is lcye; hyd3, Ven2 and Ven1 functions are inactive), NILG399 (G399 background, genotype is Lcye; hyd3, Ven2 functions normally but Ven1 functions inactive), NILRNAi (G399 background, genotype is lcye; hyd3, Ven2 and Ven1 functions are inactive). LCYB, lycopene β-cyclase; LCYE, lycopene ε-cyclase; HYD3, β-ring hydroxylase.

[0067] Figure 4The phenotype and transmission electron microscopy images of the materials in Example 8, and the ultrastructural observation of endosperm starch bodies and protein bodies are shown. 3 F 1 The yellow (hard kernels after maturity) and pink (floury kernels after maturity) endosperms were separated and observed under transmission electron microscope. DETAILED DESCRIPTION

[0068] In our previous study, we first cloned the major QTL-Ven1 (Vitreous endosperm 1) that controls the formation of hard / floury endosperm in maize from natural populations. This gene encodes β-carotene hydroxylase 3 (HYD3), which affects the stability of starch membrane and the interaction between protein body and starch body by regulating the content of polar and non-polar carotene in the endosperm, thereby affecting the formation of hard / floury endosperm (Wang et al. 2020). In further exploring the existence of the Ven1 in natural maize populations, we found that the main QTL-Ven1 (Vitreous endosperm 1) that controls the formation of hard / floury endosperm in maize was HYD3 (Wang et al. 2020). A619 In the study of hard endosperm modifiers, Ven1 RNAi material was used to screen out the Ven1 modifier Ven2 in the natural population through BSA sequencing, map-based cloning and genetic verification. It encodes the key enzyme for α-carotene synthesis, lycopene ε-cyclase LCYE (Lycopene ε-cyclase). The α-carotene (α-carotene) and β-carotene (β-carotene) synthesis pathways are two branches of the carotenoid pathway. These results show that the anabolism of carotenoids is a key factor affecting the formation of hard / floury endosperm; carotenoids are the third important metabolite affecting the formation of hard / floury endosperm in addition to the two main endosperm storage substances, protein bodies and starch bodies. The cloning of Ven2 not only has important theoretical value, but also can improve the appearance quality of corn hard endosperm and cultivate carotenoid nutrition fortified corn.

[0069] The cloned maize Ven2 gene sequence in the B73 genome is GRMZM2G012966, encoding lycopene ε cyclase LCYE. LCYE is in NILVen2 G399 The Ven2 allele in G399 The genomic and cDNA sequences of NIL Ven2 are identical to those of B73, encoding a functional LCYE protein. RNAI The Ven2 allele in KN5585There is an insertion of more than 400 bp in the promoter region and an insertion of more than 7000 bp at the 3' end of the gene. At the same time, due to the large splicing variation, a premature termination codon appears in the fifth exon of the cDNA sequence, which leads to the biological function defect of LCYE protein.

[0070] Based on the modification relationship between gene Ven1 and gene Ven2, the collaboration between the two can make corn form different agronomic traits and biological phenotypes. Their combination can be used to regulate corn kernel texture (hard, powdery endosperm) and / or carotenoid synthesis, thus having some new uses, including:

[0071] 1. Cultivate hard corn with good appearance quality. High hard endosperm content can improve kernel texture, make it less likely to break during harvest and storage, have high bulk density, and good appearance quality. Different allelic variations of Ven1 and Ven2 can be used to create hard corn with good appearance quality.

[0072] 2. Cultivate completely floury corn. Floury corn has a soft texture and its kernels are easily broken, which is an important quality in starch production or winemaking. Currently, most floury corns are mutants related to starch and protein synthesis in endosperm filling, such as the O2 mutant. These mutants cause flouriness by affecting the synthesis of starch and storage proteins. These mutants seriously affect grain filling and grain development and are difficult to use in production. KN5585 The (Ven2 function inactivation, i.e. inhibition of Ven2 expression) site can create full-flour corn without affecting the synthesis and yield of starch and protein, and has important application potential.

[0073] 3. Cultivate corn fortified with carotene. β-Carotene is the main source of vitamin A; lycopene, lutein, and zeaxanthin are also natural food pigments with high utilization value, and are also important health functional molecules. Combination of Ven1RNAi and Ven2 G399 (Ven2 function is normal, that is, Ven2 is expressed) site can create high lutein hard corn (content up to 48μg / g or more); Combination of Ven1RNAi and Ven2 KN5585 The site can be used to create completely powdery high-lycopene (content up to 0.4μg / g, the seeds are reddish pink 24 days after pollination) and high-β-carotene (content up to 10μg / g) corn materials, which have important application value.

[0074] In the description of the technical solutions of the present invention, the term "and / or" used in terms such as "A and / or B", "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B and / or C" is intended to cover each of the following embodiments: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0075] For example, Ven1RNAi (receptor is KN5585, carrying a non-functional Ven2 site Ven2 KN5585 ) was hybridized into the inbred line G399, and then backcrossed with Ven1RNAi as the recurrent parent to identify and retain the Ven1RNAi site, and at the same time select hard kernels; after three generations of backcrossing, the hard kernels were self-pollinated to obtain the hard near-isogenic material NILVen2 G399 and NILVen2 KN5585 NILVen2 G399 The genotypes of the two loci in the G399 (Ven2 is functional), that is, the function of Ven1 is inactivated, while the function of Ven2 is retained, which can significantly increase the lutein content of the grain. The lutein content in the obtained corn grain is as high as 48μg / g or more, which can be used to create high-lutein hard corn.

[0076] In another example, the powdery near-isogenic line NILVen2 KN5585 The genotypes of the two loci were Ven1RNAi and Ven2 KN5585 , that is, the functions of Ven1 and Ven2 are both inactivated, which can significantly increase the content of lycopene and β-carotene. The lycopene content is as high as 0.4μg / g, and the β-carotene content is as high as 10μg / g, and completely powdery β-carotene-fortified corn is cultivated.

[0077] The results of field experiments confirmed that the present invention has produced some technical effects, including: 1) The second key QTL gene Ven2 that controls the formation of hard powdery endosperm in natural populations was cloned. Ven2 and Ven1 genes jointly regulate the formation of hard powdery endosperm and can be used for the breeding and improvement of hard powdery corn. 2) The combination of Ven2 genes with normal functions and Ven1 RNAi is used to cultivate hard high-lutein corn. 3) The combination of Ven2 genes with inactivated functions and Ven1 RNAi produces completely powdery corn, which is rich in lycopene and β-carotene and can be used as nutritionally fortified corn. 4) The hard high-lutein corn material NILVen2 was created G399 and powdery high beta-carotene corn NILVen2 KN5585, providing valuable genetic material for the genetic improvement of corn.

[0078] As used herein, the term "(lutein content) increase" or "increase" and the like can mean an increase of at least 10% compared to a reference level (such as wild-type corn / initial corn), for example, an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least 100% compared to a reference level, or any increase between 10%-200%.

[0079] The construction of these genetically engineered corns that express gene Ven1 and / or gene Ven2 or inhibit the expression of gene Ven1 and / or gene Ven2 can be achieved by using traditional recombinant plasmid Agrobacterium-mediated transformation methods and / or gene editing technology that has been widely used in recent years.

[0080] The present invention is further described in detail below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0081] Example

[0082] The examples involve the addition amounts, contents and concentrations of various substances, wherein the percentages described therein, unless otherwise specified, are all by mass percentages.

[0083] Materials and methods

[0084] The whole gene synthesis, primer synthesis and gene sequencing in the examples were all completed by Shanghai Boshang Biotechnology Co., Ltd.

[0085] The molecular biology experiments in the embodiments include plasmid construction, enzyme digestion, ligation, competent cell preparation, transformation, culture medium preparation, etc., and are mainly carried out with reference to the third edition of Molecular Cloning Experiment Guide (J. Sambrook, DW Russell (USA), translated by Huang Peitang, etc., Science Press, Beijing, 2002). If necessary, the specific experimental conditions can be determined by simple experiments.

[0086] PCR amplification experiments were performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. If necessary, adjustments could be made through simple experiments.

[0087] In the embodiments, the molecular biology methods and transgenic plant construction methods, including using gene editing technology to knock out the gene Ven1 in corn to create the genotype Ven1RNAi transgenic corn, are operated using technical means commonly used in the art, for example, reference can be made to articles published by this research group (Wang et al. 2020), etc.

[0088] Self-pollination, hybridization, and field breeding of corn are carried out according to conventional breeding methods.

[0089] Example 1: Genetic Population Creation

[0090] In the early stage, we used maize Ven1RNAi / + pollen to cross 262 inbred lines. More than 70% of the inbred lines had hard kernels throughout the ears after cross-breeding, which suggests that Ven1 may exist in natural populations. A619 The hard endosperm modifiers (Modifiers) can transform Ven1 A619 We constructed an F-type strain using an inbred line G399 containing a hard endosperm modification factor and Ven1 RNAi (KN5585 inbred background). 1 BC 1 group( Figure 1 In the ad), the hard powdery kernels showed a segregation close to 1:1, suggesting the existence of a major QTL locus.

[0091] Example 2: Locating QTL loci using BSA sequencing

[0092] From F 1 BC 1 The hard and powdery kernels ( Figure 1 c) and d) were mixed and pooled for BSA analysis, and the specific method was as follows:

[0093] (1) Separating the ear F 1 BC 1 More than 100 seeds of hard and powdery seeds with accurate phenotypes were selected, germinated in the greenhouse, and leaf genomic DNA was extracted. The DNA extracted from 50 plants of hard and powdery types was mixed into pools. For each pool, the DNA of each sample was mixed in equal proportions. The DNA of the parents was extracted at the same time. The sequencing depth of the hard type (+ / -) pool was 50x, the sequencing depth of the powdery type (- / -) pool was 50x, and the parent G399 and Ven1RNAi were sequenced 30x each.

[0094] (2) Genomic DNA was sheared according to the Illumina TruSeq DNA PCR-free standard operation to create libraries. Paired-end (PE) sequencing was performed on these libraries using the next-generation sequencing technology (NGS) based on the Illumina HiSeq sequencing platform. The two mixed pools of high-quality data obtained after filtering were aligned to the reference genome using the default parameters of the bwa program. The SNP information was obtained using the GATK software to calculate the SNP index, and SNPs with a SNP index of <0.3 in both components were filtered. The SNP-index in each window was calculated with a window size of 4Mb and a step size of 200kb. The difference in the SNP index of the two progeny mixed pools was calculated to obtain △(SNP index) = SNP index (silty type) - SNP index (hard type). 10,000 permutation tests were performed, and the 95% (orange) confidence level was selected as the screening threshold, and the windows with a confidence level of more than 95% were selected as candidate intervals. △(SNP index) reflects the significant difference in genotype frequency between the two pools. The region above the threshold line is selected as the candidate region related to the trait. The results show that there is only one obvious peak between 139M-146M of chromosome 8, and the candidate interval ( Figure 1 (e)

[0095] Example 3: Gene map cloning

[0096] Molecular marker primers were designed based on the linkage interval of BSA, and 500 F 1 BC 2 Individuals perform fine positioning and narrow the interval to 142.96M-143.53M, with a 0.5M interval ( Figure 1 In order to identify candidate genes, the hard parent G399 and the powdery parent Ven1RNAi and hard near-isogenic lines (NILVen2 G399 ), powdery near-isogenic lines (NILVen2 KN5585 ) RNA was extracted from the endosperm of these four materials 24 days after pollination (24DAP) and RNA-seq analysis was performed. The specific experimental steps are as follows:

[0097] (1) Take about 50 mg of sample and place it in a 2 mL tube. Add 400 μL of RNA extraction SDS buffer, shake thoroughly, and place on ice. See the table below for SDS buffer:

[0098]

[0099] (2) Add 400 μL of phenol-chloroform (phenol is saturated in NaAc / HAc, mixed in a 1:1 ratio, phenol pH is 4.2, placed at 4°C, and the lower layer is used after stratification), shake vigorously for 30 seconds, place on ice for 5 minutes, shake during this period, centrifuge at 12,000 rpm at 4°C for 10 minutes, and aspirate 350 μL of supernatant into a new 1.5 mL centrifuge tube.

[0100] (3) Add 1 mL of Trizol extract to the supernatant tube, shake thoroughly, and place on ice for 5 min. Then add 200 μL of chloroform to the mixed solution, shake thoroughly, place on ice for 5 min, centrifuge at 12,000 rpm and 4°C for 10 min, and aspirate 500 μL of the supernatant (do not aspirate the middle layer and the organic phase below) into a new centrifuge tube.

[0101] (4) Add 500 μL of isopropanol to the supernatant, shake thoroughly, place on ice for 10 min, centrifuge at 12,000 rpm at 4°C for 10 min, and discard the supernatant.

[0102] (5) Add 1 mL of 70% ethanol solution and flick the precipitate to make it float. Place the precipitate on ice for 1 min, then centrifuge at 12,000 rpm at 4°C for 5 min and discard the supernatant.

[0103] (6) Centrifuge briefly and use a small pipette to remove excess liquid. Let the RNA precipitate dry at room temperature for about 2 minutes and add 100 μL of ddHO. 2 O dissolves the precipitate.

[0104] (7) The RNA extracted above was purified by column using QIAGEN RNeasy Plus Mini Kit according to the standard method of the kit, which involved the removal of DNA using DNaseI. Finally, 30 μL of RNase-free H 2 O to dissolve.

[0105] The library construction, sequencing and subsequent bioinformatics analysis during the RNA-seq analysis were entrusted to Shanghai Ouyi Biomedical Technology Co., Ltd. The expression pattern analysis of Ven1 found that the gene was highly expressed in G399, while the expression in Ven1RNAi and the two near-isogenic lines was very low, indicating that the near-isogenic line material was indeed the background of Ven1RNAi ( Figure 1 Then, the gene expression pattern in the 142.96M-143.53M interval was analyzed, and it was found that only the gene Lcye (Gene No. GRMZM2G012966 in the third edition, Gene No. Zm00001d011210 in the fourth edition) was highly expressed in the hard parent and the hard near-isogenic endosperm, but was lowly expressed in the floury parent and the floury near-isogenic endosperm ( Figure 1g), which corresponds to the phenotype of hard-silty kernels, so this gene was used as a candidate gene for genetic verification.

[0106] Example 4: Creation of near-isogenic lines

[0107] To create near-isogenic lines, follow the steps below:

[0108] 1. Hybridize the inbred line G399 and Ven1RNAi to obtain F 1 , and backcrossed with Ven1RNAi to obtain F 1 BC 1 a population from which hard, floury kernels are selected and separated;

[0109] 2. F 1 BC 1 The hard kernels obtained were planted and backcrossed with Ven1RNAi to obtain F2 that segregated for hard and powdery kernels. 1 BC 2 The hard-grained population was continued to be planted and backcrossed with Ven1RNAi to obtain F 1 BC 3 The ear is characterized by a separation of hard powdery kernels close to 3:1 ( Figure 2 a);

[0110] 3. Select hard kernels and self-pollinate to obtain F2BC3 kernels, which will have a 3:1 segregation of hard and powdery kernels;

[0111] 4. Select hard and powdery kernels for two consecutive generations of self-pollination to obtain stable genetic all-hard near-isogenic NIL Ven2 G399 The NIL Ven2 KN5585 ( Figure 2 (b)

[0112] Example 5: Hard near-isogenic lines contain more hard endosperm

[0113] The hard endosperm content is calculated as follows:

[0114] 1. Get NIL Ven2 G399 and NIL Ven2 KN5585 The mature kernels were cut longitudinally and photographed under a stereo microscope. Figure 2 c);

[0115] 2. Use Image J software to measure the hard endosperm area and the overall area of ​​the endosperm, and calculate the proportion of hard endosperm in the endosperm;

[0116] 3. Take 12 replicates for each material.

[0117] The results showed that the hard near-isogenic line NIL Ven2 G399 The proportion of hard endosperm in kernels was significantly greater than that of floury near-isogenic NIL Ven2 KN5585 The seeds ( Figure 2 (d)

[0118] Example 6: Genetic Verification of Ven2 Candidate Gene

[0119] We obtained the EMS mutant B73-lcye of the Lcye gene from the B73 EMS mutant library (http: / / maizeems.qlnu.edu.cn / ) and used this mutant for genetic verification ( Figure 2 (e)

[0120] 1. In the early stage, we used Ven1RNAi and B73 hybridization, F 1 All the kernels are hard, indicating the presence of a modifying factor in B73. All the kernels of the B73-lcye mutant are hard (because there is another hard gene, Ven1, in B73);

[0121] 2. The F1 material of B73-lcye and G399 (normal Ven1, heterozygous Lcye) was crossed with Ven1RANi (KN5585 background, Ven2 mutation, Ven1 suppressed), and powdery grains were isolated from the ears, indicating that the gene was the allele of Ven2;

[0122] 3. When B73-lcye (Ven1 normal, Lcye mutant) and Ven1RNAi (KN5585 background, Ven2 mutant, Ven1 dominant suppression) were crossed, the Ven1 locus in B73 was suppressed, and all the kernels in the ear became floury. These results indicate that Lcye is the second key QTL gene controlling the formation of hard floury endosperm, Ven2; Ven2 and Ven1 can jointly regulate the formation of hard floury endosperm in maize in natural populations.

[0123] The B73-lcye mutant was identified by conventional PCR, and the specific method is as follows.

[0124] The CTAB method was used to extract corn DNA for subsequent identification, including:

[0125] (1) Place corn leaves in a 2 mL tube, add a steel column, treat with liquid nitrogen, and then grind (60 Hz, 60 s).

[0126] (2) After grinding, add 0.6 mL of CTAB extraction buffer and mix well.

[0127] (3) Place in a 65°C oven for 60 min, mixing every 10-15 min.

[0128] (4) Take out and place at room temperature for 5-10 minutes, add equal volumes of chloroform:isoamyl alcohol (24:1) to the centrifuge tube, seal it and shake it for 5 minutes.

[0129] (5) Centrifuge at 13,000 rpm for 15 min at room temperature and transfer the supernatant to a new 1.5 mL centrifuge tube.

[0130] (6) Add an equal volume of isopropanol, invert and mix, and place at -20 degrees for 20 min.

[0131] (7) Centrifuge at 12,000 rpm for 1 min at room temperature and discard the supernatant. Wash the DNA precipitate with 1 mL of 75% ethanol 1 to 2 times, centrifuging at 12,000 rpm for 1 min each time and discarding the ethanol.

[0132] (8) Briefly centrifuge, aspirate excess liquid, and dry the DNA pellet at room temperature.

[0133] (9) Add 0.3 mL of H2O to dissolve the DNA precipitate.

[0134] PCR identification used forward primers EMS-F: GAGGCTCCAAGATATGCTTCTGT and EMS-R: TAGATCCGCCGCCAAGTAAC; PCR detection was performed using ordinary MIX and PCR programs, and sequence analysis was performed after sequencing of PCR products:

[0135] GAGGCTCCAAGATATGCTTCTGTGATATCGGACATCTTAGGAAATCGAGTTCCTGCAGAATATATGCTCGGAAATTCACAAAATTACAGTCCATCAATGCTTGGTAAGCATTTTTCTGGTATTTATTCAAGTTGGTTGGTTCGGTTCTACTGTGTAAAGGTTCAGACAAGTTA.

[0136] In the mutant, G mutated to A, causing the 440th amino acid Trp codon to mutate to a stop codon, resulting in premature termination of translation.

[0137] Example 7: Determination of carotenoid content

[0138] Genes Ven2 and Ven1 are not only key QTLs for regulating the formation of hard powdery endosperm, but also key genes in the carotenoid biosynthesis pathway. Figure 3As shown in the figure, Ven2 is the Lcye gene, which is the key gene for synthesizing α-carotene; Ven1 is the Hyd3 gene, which is the key gene for hydroxylating β-carotene; these two genes are located in two branches of the carotenoid synthesis metabolic pathway. Therefore, the variation of these two genes will lead to changes in the content of different components of carotenoids in the endosperm.

[0139] Four materials were selected: G399 (genotype Lcye; Hyd3, Ven2 and Ven1 functions were normal), Ven1RNAi (KN5585 background, genotype lcye; hyd3, Ven2 and Ven1 functions were inactivated), NILVen2 G399 (G399 background, genotype Lcye; hyd3, Ven2 function is normal but Ven1 function is inactive), NILVen2 KN5585 (G399 background, genotype lcye; hyd3, Ven2 and Ven1 functions are inactivated) endosperm, liquid nitrogen ground and then extracted with hexane: acetone: ethanol mixed extraction solution, liquid chromatography tandem mass spectrometry (LC-MS / MS) was used to detect carotenoids (lycopene, α-carotene, β-carotene, γ-carotene, ε-carotene, α-cryptoxanthin, β-cryptoxanthin, lutein, zeaxanthin) ( Figure 3 ).

[0140] The results showed that the endosperm of G399 was rich in hydroxylated polar carotenoids: lutein and zeaxanthin, while the content of non-polar carotenoids (lycopene and β-carotene) was very low; the endosperm of Ven1RNAi was mainly enriched in β-carotene, up to 8.4μg / g; while the content of polar carotenoids was very low; the hard near-isogenic line NILVen2 G399 Due to the inhibition of Ven1 gene (HYD3) in the endosperm, the content of α-carotene branch lutein increased significantly, reaching 48.6μg / g; the near-isogenic NILVen2 KN5585 Combination Ven2 KN5585 (Lcye function inactivation) and Ven1RNAi (Hyd3 expression inhibition) can obtain corn with completely powdery grains and significantly increased lycopene and β-carotene content, with lycopene content as high as 0.4μg / g and β-carotene content as high as 10μg / g.

[0141] The cloning of Ven1 and Ven2 genes and the creation of these genetic materials provide valuable genetic resources and genetic materials for the breeding of hard corn, floury corn and corn with extremely high carotenoid content.

[0142] Example 8: Ultrastructural observation of protein bodies and starch bodies in hard / floury endosperm

[0143] The yellow grains (hard when mature) and pink grains (powdery when mature, rich in tomato red) separated from the G399 and Vne1RNAi BC3F1 ears 24 days after pollination (24DAP) were sliced ​​by hand, fixed, embedded and sliced ​​in 2.5% glutaraldehyde solution, and then the starch granule morphology, starch body membrane morphology, protein body morphology, protein body arrangement and the interaction between starch granules and protein bodies were observed under a transmission electron microscope. Through these experiments, the effect of VEN2 on the formation of starch granule-protein body matrix during the formation of hard endosperm was studied. The results showed that the starch body membrane of yellow grains was wrinkled and the protein bodies tended to aggregate; the starch body membrane morphology of pink grains was mutated, swollen and expanded, and the protein bodies were more dispersed ( Figure 4 These results suggest that Ven2 affects the formation of scleroderma by regulating the content of polar and nonpolar carotenoids and influencing the distribution of starch membranes and protein bodies.

[0144] The above embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Any equivalent substitution or change made by a person skilled in the art based on the present invention is within the protection scope of the present invention.

[0145] It should be noted that the listing and discussion of previously disclosed documents in this specification should not be regarded as an admission that the document is prior art or common knowledge.

[0146] Main references

[0147] Gibbon BC,Larkins BA(2005)Molecular genetic approaches to developing quality protein maize.Trends Genet 21(4):227-233.doi:10.1016 / j.tig.2005.02.009.

[0148] Larkins BA,Hurkman WJ(1978)Synthesis and Deposition of Zein inProtein Bodies of Maize Endosperm.Plant Physiol 62(2):256-263.doi:DOI10.1104 / pp.62.2.256.

[0149] Lending CR,Larkins BA(1989)Changes in the Zein Composition of ProteinBodies during Maize Endosperm Development.Plant Cell 1(10):1011-1023.doi:DOI10.1105 / tpc.1.10.1011.

[0150] Vallabhaneni R,Gallagher CE,Licciardello N,Cuttriss AJ,Quinlan RF,Wurtzel ET(2009)Metabolite Sorting of a Germplasm Collection Reveals thehydroxylase3 locus as a new target for maize provitamin Abiofortification.Plant Physiology.DOI:10.1104 / pp.109.145177.

[0151] Wang H,Huang Y,Xiao Q,Huang X,Li C,Gao X,Wang Q,Xiang X,Zhu Y,Wang J,Wang W,Larkins BA,Wu Y(2020)Carotenoids modulate kernel texture in maize byinfluencing amyloplast envelope integrity.Nat Commun 11(1):5346.doi:10.1038 / s41467-020-19196-9.

[0152] Yan JB,Kandianis CB,Harjes CE,Bai L,Kim EH,Yang XH,Skinner DJ,Fu ZY,Mitchell S,Li Q,Fernandez MGS,Zaharieva M,Babu R,Fu Y,Palacios N,Li JS,DellaPenna D,Brutnell T,Buckler ES,Warburton ML,Rocheford T(2010)Rare geneticvariation at increasesβ-carotene in maize grain.Nat Genet 42(4):322-U374.doi:10.1038 / ng.551.

[0153] Zhang SS,Zhan JP,Yadegari R(2018)Maize mutants are no longer soopaque.Plant Reprod 31(3):319-326.doi:10.1007 / s00497-018-0344-3.

Claims

1. A gene for regulating corn kernel texture and / or carotenoid synthesis, characterized in that: The gene is a combination of gene Ven1 (NCBI accession number Zm00001d026056) and gene Ven2 (NCBI accession number GRMZM2G012966) or their functionally inactive mutants, both of which are expressed in corn at the same time, or the expression of gene Ven2 is suppressed.

2. The gene according to claim 1, characterized in that The nucleotide sequence of the functionally inactive mutant of the gene Ven2 (NCBI accession number GRMZM2G012966) is SEQ ID NO:

1.

3. Use of the gene combination as claimed in claim 1 in regulating corn kernel texture and / or carotenoid synthesis.

4. The use according to claim 3, characterized in that The combination includes the following: (A) When corn expresses or overexpresses one of the gene Ven1 (NCBI accession number Zm00001d026056) and the gene Ven2 (NCBI accession number GRMZM2G012966), or expresses or overexpresses both the gene Ven1 (NCBI accession number Zm00001d026056) and the gene Ven2 (NCBI accession number GRMZM2G012966), corn forms hard endosperm; (B) When the Ven1 and Ven2 genes in corn are inactivated or their expression is inhibited at the same time, corn forms floury endosperm; (C) When the gene Ven2 is expressed in corn and the expression of the gene Ven1 in corn is suppressed, corn with hard kernels and increased lutein content is obtained; (D) When corn expresses a functionally inactive mutant of the Ven2 gene or inhibits the expression of the Ven2 gene, and inhibits the expression of the Ven1 gene in corn, corn with increased powdery texture, lycopene and β-carotene is obtained.

5. The use according to claim 4, characterized in that The inhibition of the expression of the gene Ven1 or Ven2 refers to down-regulation, inactivation, functional attenuation or knockout of the gene Ven1 or Ven2. The inhibition of the expression of the gene Ven1 or Ven2 is implemented by the following methods: (1) Knockout of the gene Ven1 or Ven2 in maize chromosomes; (2) downregulating the expression level of the gene Ven1 or Ven2 in maize chromosomes; (3) replacing the gene Ven1 or Ven2 in the chromosome of wild-type corn with a mutant encoding a gene Ven1 or Ven2 that has lost its function or is downregulated; and / or (4) Blocking, inhibiting or interfering with the expression of the gene Ven1 or Ven2 in the chromosome of wild-type corn.

6. The use according to claim 5, characterized in that Method (2) is selected from the following group: (2-1) mutation of the promoter region and / or coding region of the Ven1 or Ven2 gene results in downregulation of the expression level of the Ven1 or Ven2 gene; (2-2) mutation of upstream regulatory factors of gene Ven1 or Ven2 leads to downregulation of the expression level of gene Ven1 or Ven2; or (2-3) Introducing the interacting proteins of Ven1 or Ven2 into wild-type maize to change the function of the gene Ven1 or Ven2; Method (3) is selected from the following group: (3-1) Base mutations occur in the coding region, resulting in loss of function of the encoded protein Ven1 or Ven2; (3-2) Frameshift mutation occurs in the coding region, resulting in loss of function of the encoded protein Ven1 or Ven2.

7. The use according to claim 4, characterized in that The overexpression of the gene Ven1 or gene Ven2 / functional inactive mutant is achieved by the following method: (i) cloning the gene Ven1 or gene Ven2 / functionally inactive mutant into a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, i.e., a gene Ven1 or gene Ven2 / functionally inactive mutant overexpression vector, and transforming corn plants by Agrobacterium-mediated method to obtain transgenic corn overexpressing the gene Ven1 or gene Ven2 / functionally inactive mutant; or (ii) Gene Ven1 or gene Ven2 / functionally inactive mutant is cloned on a maize chromosome by gene editing technology to obtain transgenic maize that overexpresses gene Ven1 or gene Ven2 / functionally inactive mutant.

8. A gene Ven2 mutant, characterized in that: It has the nucleotide sequence shown in SEQ ID NO:

1.

9. A method for identifying transgenic corn expressing a mutant of the gene Ven2 as claimed in claim 8, characterized in that: The steps include: Maize genomic DNA was extracted and PCR amplification was performed using the following primer pairs: Forward primer Ven2-F: ATTCCAGCCCAATAAAATAGCC (SEQ ID NO: 2), Reverse primer Ven2-R: GACGACGAGACACGAGAGGC (SEQ ID NO: 3), When the size of the PCR product is 640 bp and the nucleotide sequence of the amplified fragment is SEQ ID NO: 4, it indicates that the corn genome contains a mutant of the gene Ven2 with the nucleotide sequence of SEQ ID NO: 1; When the size of the PCR product is 275 bp and the nucleotide sequence of the amplified fragment is SEQ ID NO: 5, it indicates that the corn genome contains the wild-type gene Ven2. Preferably, the above method further comprises the following step of detecting gene Ven1 (NCBI accession number Zm00001d026056): Maize genomic DNA was extracted and PCR amplification was performed using the following primer pairs: Forward primer Ven1-F: ACACCACATGGACAAGTTCG (SEQ ID NO: 6), Reverse primer Ven1-R1: ACACTCTGGCCCATGAACAC (SEQ ID NO: 7), Reverse primer Ven1-R2: ACAGCAATACAGGGGACCAG (SEQ ID NO: 8), When the size of the PCR product is 293 bp and the nucleotide sequence of the amplified fragment is SEQ ID NO: 9, it indicates that the maize genome contains the gene Ven1; When the PCR product size is 540 bp and the nucleotide sequence of the amplified fragment is SEQ ID NO: 10, it indicates that the maize genome contains the loss-of-function allele Ven1 A619 , that is, Ven1 deletion mutation occurred and has no function.

10. A kit for implementing the method according to claim 9, characterized in that: The following PCR primers were included for amplifying gene Ven1 (NCBI accession number Zm00001d026056) and gene Ven2 (NCBI accession number GRMZM2G012966): Forward primer Ven2-F: ATTCCAGCCCAATAAAATAGCC (SEQ ID NO: 2), Reverse primer Ven2-R: GACGACGAGACACGAGAGGC (SEQ ID NO: 3); Forward primer Ven1-F: ACACCACATGGACAAGTTCG (SEQ ID NO: 6), Reverse primer Ven1-R1: ACACTCTGGCCCATGAACAC (SEQ ID NO: 7), Reverse primer Ven1-R2: ACAGCAATACAGGGGACCAG (SEQ ID NO: 8).

Images