Sweet tea cinnamicyl-CoA reductase gene and its application
By cloning and expressing the CCR and CHS genes of sweet tea, we achieved the in vitro synthesis of phlorizin via dihydro-coumaroyl-CoA catalysis, solving the problem of unclear synthesis pathway of dihydro-coumaroyl-CoA and realizing the efficient synthesis of phlorizin.
Patent Information
- Application Number
- CN202510018446.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-07
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-01-07
AI Technical Summary
The in vivo synthesis pathway of dihydrocoumaroyl-CoA is unclear in the existing technology, especially the enzymatic reaction mechanism of the double bond reduction step of coumaroyl-CoA, which makes it difficult to synthesize phloretin precursors.
The CCR and CHS genes of sweet tea were cloned and expressed. The protein encoded by the CCR gene catalyzes the production of dihydrocoumaroyl-CoA from 4-hydroxyphenylpropanal and synthesizes phlorin in conjunction with the CHS gene. Phlorin was synthesized in vitro in a prokaryotic system by constructing a recombinant vector containing CCR and CHS.
The synthesis of phlorizin was successfully catalyzed from 4-hydroxyphenylpropanal to dihydrocoumaroyl-CoA, and then generated under the action of CHS, achieving efficient in vitro synthesis of phlorizin. The product also included dihydro-bis(demethyl)-angolin and dihydro-coumaroyltriacetin.
Smart Images

Figure CN119913175B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of sweet tea genetic engineering, specifically involving the isolation and functional analysis of the genes of cinnamoyl-CoA reductase (CCR) and chalcone synthase (CHS) in sweet tea, and also involves the in vitro synthesis of phlorizin using the CCR and CHS genes of sweet tea. Background Technology
[0002] Sweet tea, scientifically known as *Lithocarpus litseifolius* (Hance) Chun, is an important traditional Chinese tea substitute. It gets its name from the pronounced sweetness of its young leaves. This sweetness does not come from sugars but from dihydrochalcone compounds. Dihydrochalcones are a class of atypical flavonoids. Their aglycones have a 2-phenylchromone (C6-C3-C6) basic skeleton. Their A ring originates from malonyl-CoA metabolism and has hydroxyl groups at the 2′, 4′, and 6′ positions. Their B ring originates from the shikimic acid pathway and has hydroxyl groups at the 3 and 4 positions. Unlike other flavonoids, the double bond in the C3 carbon chain is reduced, preventing the formation of the C ring. The A and B rings are linked by a carbon chain. The main dihydrochalcone compounds in sweet tea are phlorizin and its glycosides.
[0003] Similar to the synthesis of naringenin chalcone, phlorizin is generated by the condensation reaction of one molecule of dihydro-p-coumaroyl-CoA and three molecules of malonyl-CoA under the action of CHS. However, the in vivo synthetic pathway of dihydro-p-coumaroyl-CoA, a precursor of phlorizin, remains inconclusive. To date, the product encoded by the double bond reductase (DBR) gene in apples has been reported to have the ability to reduce p-coumaroyl-CoA to dihydro-p-coumaroyl-CoA, but its function has been questioned because no corresponding activity was detected in experiments conducted by other teams. Furthermore, many DBRs from different species have been reported to reduce the double bond in p-coumaraldehyde to 4-hydroxyphenylpropionaldehyde. Therefore, the in vivo synthesis of dihydro-p-coumaroyl-CoA remains highly controversial, with the main point of contention being how the reduction of the double bond in coumaroyl-CoA by its precursor is carried out via an enzymatic reaction.
[0004] Existing studies have shown that CCR is a key gene in the plant lignin metabolism pathway. The protein it encodes can reduce p-coumaryl-CoA, feruloyl-CoA, and sinigrin-CoA to p-coumaraldehyde, coniferaldehyde, and sinigrin, respectively, which are then converted into the corresponding lignin monomers under the catalysis of cinnamyl alcohol dehydrogenase (CAD). Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a gene sequence of cinnamoyl coA reductase (CCR) and the protein it encodes and its novel function.
[0006] To address the aforementioned technical problems, the present invention provides a sweet tea gene, comprising a sweet tea CCR gene and a sweet tea CHS gene, wherein the nucleotide sequence of the sweet tea CCR gene is shown in SEQ ID No: 1, and the nucleotide sequence of the sweet tea CHS gene is shown in SEQ ID No: 2.
[0007] The present invention also provides the proteins encoded by the above-mentioned sweet tea gene, the amino acid sequence of the protein encoded by the sweet tea CCR gene is shown in SEQ ID NO: 3, and the amino acid sequence of the protein encoded by the sweet tea CHS gene is shown in SEQ ID NO: 4.
[0008] The present invention also provides the use of the protein encoded by the sweet tea CCR gene: the protein encoded by the sweet tea CCR gene catalyzes the oxidation of 4-hydroxyphenylpropanal to form dihydrocoumaroyl-CoA, a precursor for phloretin synthesis.
[0009] An improvement to the use of the protein encoded by the sweet tea CCR gene of the present invention: catalyzing 4-hydroxyphenylpropanal and coenzyme A (CAS No. 85-61-0) to generate dihydrocoumaroyl-CoA.
[0010] As a further improvement to the use of the protein encoded by the sweet tea CCR gene of the present invention: phloretin is synthesized under the combined action of the protein encoded by the sweet tea CHS gene.
[0011] The present invention also provides a method for synthesizing phlorizin: a reaction system containing a protein encoded by the CCR gene of sweet tea, a protein encoded by the CHS gene of sweet tea, 4-hydroxyphenylpropionaldehyde, coenzyme A, NADP and malonyl-CoA is reacted to obtain phlorizin.
[0012] As an improvement to the method for synthesizing phloretin of the present invention:
[0013] The reaction system consists of the following components: protein encoded by the CCR gene at a final concentration of 1 mg / mL, protein encoded by the CHS gene at a final concentration of 1 mg / mL, 4-hydroxyphenylpropionaldehyde, coenzyme A, NADP and malonyl-CoA at a final concentration of 500 μM, and the remainder is pH 6.5 citrate buffer.
[0014] React at 25±0.5℃ for 2-8 hours (preferably 4-8 hours);
[0015] The resulting products include phloretin as the main product, and dihydro-bisnoryangonin and dihydro-p-coumaroyl triacetinacid lactone as byproducts.
[0016] The present invention has found that, in addition to catalyzing the reduction of substances such as coumaroyl-CoA, feruloyl-CoA, and mustard-CoA, CCR can also catalyze the oxidation of 4-hydroxyphenylpropanal to form dihydro-p-coumaroyl-CoA, a precursor for the synthesis of phloretin.
[0017] The prokaryotic expression product of the CCR gene can catalyze the synthesis of dihydrocoumaroyl-CoA from 4-hydroxyphenylpropanal, and combined with the prokaryotic expression of the chalcone synthase (CHS) gene, it enables the in vitro synthesis of phloretin.
[0018] This invention employs the following technical solution: Total RNA was extracted from sweet tea leaves, and the sweet tea CCR gene and sweet tea CHS gene were cloned and verified by reverse transcription-polymerase chain reaction (RT-PCR) and sequencing. These genes have the nucleotide sequences shown in SEQ ID No: 1 and SEQ ID No: 2, respectively. The CCR gene open reading frame (ORF) is 996 bp in length and encodes the CCR protein, which is 331 amino acids long and has the sequence shown in SEQ ID No: 3. The CHS gene open reading frame (ORF) is 1170 bp in length and encodes the CHS protein, which is 389 amino acids long and has the sequence shown in SEQ ID No: 4.
[0019] This invention also provides the optimal reaction conditions for the prokaryotic expression product of the sweet tea CCR gene to catalyze p-coumaroyl-CoA, feruloyl-CoA, mustard-CoA, and 4-hydroxyphenylpropanal. This demonstrates that the sweet tea CCR gene-encoded product provided by this invention can not only catalyze the formation of the corresponding hydroxycinnamaldehyde from p-coumaroyl-CoA, feruloyl-CoA, and mustard-CoA, but also catalyze the formation of dihydrop-coumaroyl-CoA from 4-hydroxyphenylpropanal. Furthermore, the in vitro synthesis of phlorizin using 4-hydroxyphenylpropanal as a starting substrate can be achieved through the combined action of the CCR and CHS gene expression products.
[0020] The specific technical steps for implementing this invention are as follows:
[0021] I. Cloning and Sequence Analysis of Sweet Tea CCR and CHS Genes
[0022] Tender leaves from the new shoots of sweet tea were collected in spring, thoroughly ground in liquid nitrogen, and total RNA was extracted from the leaves. Electrophoresis and ultraviolet analysis confirmed that the RNA quality and concentration met the requirements for gene cloning. Using total RNA as a starting material, [the following method was employed]. Ultra TM Directional RNALibrary Prep Kit for The kit (New England Biolabs, Inc.) was used to construct a transcriptome library through processes including mRNA isolation and fragmentation, double-stranded cDNA synthesis, cDNA end repair with A-terminal addition, NEBNext adapter ligation, selection and recovery of specific length fragments, and PCR amplification and enrichment. Specific procedures were followed according to the kit's instructions. The constructed transcriptome library was then sent to a sequencing company for sequencing and assembly using the Illumina HiSeq 2500 platform.
[0023] Primers CCR-F / CCR-R (Table 1) and CHS-F / CHS-R (Table 1) for cloning ORFs were designed based on the candidate CCR and CHS gene sequences obtained from transcriptome sequencing. The candidate ORF sequences were amplified by RT-PCR, and the amplified products were electrophoresed on a 1.0% agarose gel. Figure 1 The target band was excised and recovered. The amplified product was inserted into the pCold-TF vector (where TF stands for Trigger Factor, a prokaryotic ribosome-binding chaperone protein that promotes co-translational folding of nascent peptide chains) under the action of homologous recombination ligase. Recombinant vectors pCold-TF-CCR containing the CCR gene and pCold-TF-CHS containing the CHS gene were constructed respectively. They were transformed into DH5α competent Escherichia coli and plated on LB solid medium containing 100 μg / ml ampicillin sodium for resistance screening. Positive colonies were picked and propagated for 12 h. Colony PCR was performed using the pCold-TF universal primers pCold-TF-F / pCold-TF-R (Table 1). Positive clones were sequenced by Sangon Biotech Co., Ltd. using the Sanger sequencing method. Based on the sequencing results, the amino acid sequences of CCR and CHS encoded by the ORF were deduced using EditSeq in the DNAStar software package, and compared with the GenBank database using Blast (www.blast.ncbi.nlm.nih.gov / Blast.cgi).
[0024] II. Analysis of the reduction and oxidation reaction characteristics catalyzed by CCR protein
[0025] The recombinant plasmid pCold-TF-CCR, verified by sequencing, was extracted and transformed into competent Rosetta(DE3) cells. After propagation, the recombinant protein was induced to express under low temperature (16℃) conditions using isopropyl-β-D-thiogalactoside (IPTG). The purified recombinant CCR protein was obtained by nickel column purification, following the instructions of the relevant kits. The molecular weight of the recombinant CCR protein was 88.93 kDa (His tag + TF + HRV3C protease site carrier protein: 52.52 kDa; target protein CCR: 36.41 kDa). SDS-PAGE analysis showed high expression and high solubility of the target gene CCR (e.g., [missing information]). Figure 2 (As shown in lane S1).
[0026] Recombinant CCR protein was treated with HRV3C protease to remove the carrier protein and recover CCR. Using p-coumaroyl-CoA, feruloyl-CoA, and mustard-CoA as substrates, CCR and cofactor NADPH were added to the system. After enzymatic reaction, 5 μL of trifluoroacetic acid was added to terminate the reaction. The formation of the product was monitored to clarify the reduction reaction characteristics catalyzed by the CCR protein. The results showed that CCR could catalyze the formation of p-coumaroyl-CoA, feruloyl-CoA, and mustard-CoA into the corresponding p-coumaraldehyde, coniferaldehyde, and mustardaldehyde. Further investigation of the oxidation activity catalyzed by CCR was conducted. Specifically, 4-hydroxyphenylpropanal was used as a substrate, and CCR, cofactor NADP, and coenzyme A were added. After enzymatic reaction, 10 μL of sodium hydroxide was added to hydrolyze the reaction product (sodium hydroxide can hydrolyze hydroxycinnamoyl-CoA and other analogues into the corresponding hydroxycinnamic acid analogues). The results showed that the product after sodium hydroxide hydrolysis had a high abundance of dihydro-p-coumaric acid (…). Figure 3 This indicates that CCR can catalyze the oxidation of 4-hydroxyphenylpropanal to dihydrocoumaroyl-CoA. The study also showed that recombinant CCRs not treated with HRV3C protease can also effectively catalyze the oxidation of 4-hydroxyphenylpropanal to dihydrocoumaroyl-CoA.
[0027] Further analysis was conducted to determine the optimal reaction conditions for the redox reaction of the CCR protein. Specifically, enzymatic reactions were carried out using p-coumaroyl-CoA and 4-hydroxyphenylpropionaldehyde as substrates in a series of buffer systems with varying pH values and at different temperatures. The product formation under different temperatures, buffer systems, and acidity conditions was compared. The optimal reaction conditions for the sweet tea CCR with the substrate p-coumaroyl-CoA were ultimately determined to be: 30℃, pH 6.0, and a phosphate buffer system. Figure 4 The optimal reaction conditions for the substrate 4-hydroxyphenylpropionaldehyde are: 25°C, a phosphate buffer system at pH 8.0, or a citric acid buffer system at pH 6.5. Figure 5 III. Synthesis of Phlorin using CCR and CHS Catalysis
[0028] The recombinant plasmid pCold-TF-CHS, verified by sequencing, was extracted and transformed into competent Rosetta(DE3) cells. After propagation to an OD value between 0.6 and 0.8, recombinant protein expression was induced by IPTG under low temperature conditions. The predicted molecular weight of the recombinant CHS protein was 95.26 kDa (His tag + TF + HRV3C protease site carrier protein was 52.52 kDa, and the target protein CHS was 42.75 kDa). SDS-PAGE analysis showed that the target gene CHS was highly expressed and highly soluble (e.g., Figure 2 (As shown in lane S2). Using 4-hydroxyphenylpropionaldehyde as a substrate, recombinant CCR and CHS, coenzyme A, NADP, and malonyl-CoA were added to the system, and the reaction was carried out at 25°C and a citrate buffer system at pH 6.5 for 2 hours. HPLC-MS analysis showed that a large amount of phlorizin was generated after the enzymatic reaction, accompanied by a small amount of byproducts (byproduct 1 is dihydro-bis(demethyl)-angioclase, and byproduct 2 is dihydro-coumaryltriacetin). Figure 6 When the CCR protein is absent in the system, phlorizin cannot be generated. This indicates that CCR can catalyze the conversion of 4-hydroxyphenylpropanal to dihydrocoumaroyl-CoA, which in turn generates phlorizin under the action of CHS.
[0029] IV. Application of CCR Gene
[0030] Rosetta(DE3) engineered bacteria containing recombinant plasmids pCold-TF-CCR and pCold-TF-CHS were amplified, and recombinant protein expression was induced by IPTG at low temperature. The engineered bacteria were then sonicated, and CCR and CHS purified by nickel column chromatography were mixed with 4-hydroxyphenylpropionaldehyde, coenzyme A, NADP, and malonyl-CoA. The mixture was reacted in citrate buffer at 25°C and pH 6.5 for 4-8 hours. An equal volume of ethyl acetate was added to the mixture for extraction once. The upper ethyl acetate layer was collected, and the lower aqueous phase was extracted once more with an equal volume of ethyl acetate. The two ethyl acetate layers were combined, and the ethyl acetate was removed by vacuum distillation at 45°C. The paste was transferred to a petri dish and freeze-dried to obtain a dry powder containing 75% phloretin. Attached Figure Description
[0031] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.
[0032] Figure 1 This is an RT-PCR electrophoresis image of the open reading frames of the sweet tea CCR gene (S1) and CHS gene (S2);
[0033] Figure 2 The results are from low-temperature induced expression of recombinant CCR(S1) and CHS(S2) SDS-PAGE and Coomassie brilliant blue staining.
[0034] Figure 3 These are the HPLC-DAD detection results of the products of the CCR-catalyzed oxidation reaction of 4-hydroxyphenylpropionaldehyde;
[0035] Figure 4 This is a comparison of the effects of CCR catalysis on the reduction of coumarin-CoA under different acidity (A) and temperature (B) conditions;
[0036] Figure 5 This is a comparison of the effects of CCR on the oxidation of 4-hydroxyphenylpropanal under different acidity (A) and temperature (B) conditions;
[0037] Figure 6 The results are HPLC-MS analysis of the synthesis of phlorizin from the substrate 4-hydroxyphenylpropanal via CCR and CHS co-catalysis.
[0038] Figure 7 This is the alignment result of the CCR of this invention with GenBank Blast. Detailed Implementation
[0039] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:
[0040] Example 1: Cloning and Sequence Analysis of Sweet Tea CCR and CHS Genes
[0041] Tender leaves of sweet tea shoots were harvested in spring (March 20th). After removing the veins, the leaves were thoroughly ground in liquid nitrogen. Total RNA was extracted using the EasyPlant RNA kit (Zhejiang EasyPlant Biotechnology Co., Ltd.). Electrophoresis showed that the RNA was intact and undegraded. UV analysis indicated that the extracted RNA had an OD260 / OD280 ratio of 1.9–2.0 and a concentration of approximately 1000 μg / ml, meeting the requirements for subsequent experiments. Using total RNA as the starting material, [further details on starting materials and methods are needed]. Ultra TM Directional RNA Library Prep Kitfor The kit (New England Biolabs, Inc.) was used to construct a transcriptome library through processes including mRNA isolation and fragmentation, double-stranded cDNA synthesis, cDNA end repair with A-terminal addition, NEBNext adapter ligation, selection and recovery of fragments of specific lengths, and PCR amplification and enrichment. Specific procedures were followed according to the kit's instructions. The constructed transcriptome library was then sent to a sequencing company for sequencing and assembly using the Illumina HiSeq 2500 platform.
[0042] Primer pairs CCR-F / CCR-R (upstream and downstream primers for CCR gene ORF cloning) and CHS-F / CHS-R (upstream and downstream primers for CHS gene ORF cloning) were designed based on the ORF sequences of the CCR and CHS candidate genes obtained from transcriptome sequencing. Using previously extracted total RNA as a template, HiScript was employed. TM The II Q RT SuperMix kit (Nanjing Novizan Biotechnology Co., Ltd.) was used to synthesize the first strand of cDNA. For specific instructions, please refer to the relevant instructions for the reverse transcription kit.
[0043] Using the first strand of cDNA as a template, and with primer pairs CCR-F / CCR-R and CHS-F / CHS-R respectively, KODOne was employed. TM PCR Master Mix reagent (Toyobo [Shanghai] Biotechnology Co., Ltd.) was used to amplify the ORF sequence of candidate genes via RT-PCR. Specific procedures were performed according to the relevant reagent instructions. The amplified products were then electrophoresed on a 1.0% agarose gel. Figure 1 The target band was excised and recovered using the TaKaRa Agarose Gel DNAPurification Kit Ver.2.0 (Takara Bio [Dalian] Co., Ltd.). The complete CCR ORF amplification product (SEQ ID NO:1) and the complete CHS ORF amplification product (SEQ ID NO:2) were recombinated with the linearized pCold-TF vector using homologous recombination ligase to form circular pCold-TF-CCR and pCold-TF-CHS, respectively. Specific procedures were performed according to the kit instructions. In other words, the recombinant vector pCold-TF-CCR containing the CCR gene and the recombinant vector pCold-TF-CHS containing the CHS gene were constructed.
[0044] The recombinant plasmid was transformed into DH5α competent E. coli, and plated on LB solid medium containing 100 μg / ml ampicillin sodium for resistance selection. Positive clones were picked and amplified in LB liquid medium for 12 h. Using pCold-TF universal primers (universal upstream and downstream primers for pCold-TF vector insert sequence sequencing), KOD One was used. TMPCR Master Mix reagent (Toyobo [Shanghai] Biotechnology Co., Ltd.) was used for bacterial culture PCR. Positive recombinant bacteria were sequenced by Shanghai Sangon Biotech Co., Ltd. using the Sanger sequencing method. Sequencing verification revealed that the CCR gene (SEQ ID NO:1) ORF was 996 bp long, and the CHS gene (SEQ ID NO:2) ORF was 1170 bp long. The amino acid sequences of CCR and CHS encoded by the ORFs were deduced using EditSeq from the DNAStar software package. The CCR amino acid sequence (SEQ ID NO:3) contained 331 amino acid residues with a relative molecular weight of 36.41 kDa; the CHS amino acid sequence (SEQ ID NO:4) contained 389 amino acid residues with a relative molecular weight of 42.75 kDa. The amino acid sequences of CCR and CHS were compared with those in the GenBank database using the Blast tool (www.blast.ncbi.nlm.nih.gov / Blast.cgi). The cloned CCR gene encoding product showed 100% identity with the unknown functional protein sequence KAL0010863.1 from sweet tea in the database; the cloned CHS gene encoding product showed 100% identity with the unknown functional protein sequence KAK9991562.1 from sweet tea in the database.
[0045] Table 1 Primer sequences
[0046] CCR-F ggtaggcatatggagatgcc agtttctgga caaac CCR-R ctcgagggtaccgagttaag actgaatatg aatagaatct tc CHS-F ggtaggcatatggagatggt gactgttgat gaagtac CHS-R ctcgagggtaccgagttaag cagagacact gtgg pCold-TF universal upstream primer ccactttcaacgagctgatg pCold-TF universal downstream primers ggcagggatc ttagattctg
[0047] Example 2: Analysis of the reduction and oxidation reaction characteristics catalyzed by CCR protein
[0048] The pCold-TF-CCR positive colonies obtained in Example 1, verified by sequencing, were propagated in LB liquid medium for 12 h. The recombinant plasmid pCold-TF-CCR was extracted using the AFT Spin EndoFree Plasmid Midi Kit (Aibotek Biotechnology Co., Ltd.). Specific procedures are detailed in the plasmid extraction instructions. The recombinant plasmid was transformed into competent Rosetta (DE3) cells and plated on LB solid medium containing 100 μg / ml ampicillin sodium and 34 μg / ml chloramphenicol for resistance selection. Positive clones were picked and inoculated into LB liquid medium, cultured at 37°C with shaking until the OD value reached 0.6-0.8. IPTG was added to the medium at a final concentration of 1 mM and the culture was incubated at 16°C to induce recombinant protein expression. The recombinant CCR protein was estimated to have a molecular weight of approximately 88.93 kDa. SDS-PAGE analysis showed that the target gene CCR, fused with the TF factor, was highly expressed and highly soluble (e.g., [missing information - likely a typo]). Figure 2 (As shown in lane S1).
[0049] The fusion recombinant protein was adsorbed onto a nickel column using His-tagged protein agarose gel purification resin (Yisheng Biotechnology [Shanghai] Co., Ltd.), and then eluted to obtain purified recombinant CCR protein. Specific procedures were performed according to the relevant kit instructions. The obtained recombinant CCR was then digested with HRV3C protease to remove the carrier protein, and purified again using a nickel column to obtain the CCR protein. Specific procedures were performed according to the relevant reagent instructions.
[0050] A 1 mM aqueous solution of p-coumaroyl-CoA, feruloyl-CoA, and mustard-CoA, and a 10 mM NADPH (reduced nicotinamide adenine dinucleotide phosphate) solution were prepared separately. CCR protein was mixed with each substrate and the NADPH solution to achieve a CCR protein concentration of 1 mg / mL and a final concentration of each substrate and NADPH of 200 μM. The reaction system was shaken in a 30°C metal bath for 10 min, and the reaction was terminated by adding 5 μL of trifluoroacetic acid. Catalytic activity analysis of CCR protein reduction was performed, revealing that CCR protein could catalyze the reduction of p-coumaroyl-CoA, feruloyl-CoA, and mustard-CoA to produce p-coumaraldehyde, coniferaldehyde, and mustardaldehyde, respectively.
[0051] To further investigate the characteristics of the CCR-catalyzed oxidation reaction, a 20 mM solution of 4-hydroxyphenylpropionaldehyde, NADP, and coenzyme A (4-aminopyrimidine imidazole) was prepared. The recombinant CCR protein was mixed with these substances to achieve a CCR protein concentration of 1 mg / mL and a final concentration of 500 μM for each substance. The reaction was carried out at 30°C for 2 h. Then, 10 μL of sodium hydroxide (which hydrolyzes dihydro-p-coumaryl-CoA to the corresponding dihydro-p-coumaric acid) was added to terminate the reaction. HPLC-DAD analysis showed that dihydro-p-coumaric acid was generated after hydrolysis with sodium hydroxide. This indicates that CCR can catalyze both the reduction of p-coumaryl-CoA to aldehydes and the oxidation of 4-hydroxyphenylpropionaldehyde to dihydro-p-coumaryl-CoA (4-aminopyrimidine imidazole). Figure 3 ).
[0052] The optimal reaction conditions for the reduction or oxidation of CCR catalyzed by coumaroyl-CoA and 4-hydroxyphenylpropionaldehyde were analyzed, using p-coumaroyl-CoA and 4-hydroxyphenylpropionaldehyde as substrates, respectively. Specifically, 50 mM citrate buffer (pH 4.5-6.5), 50 mM phosphate buffer (pH 6.0-8.0), and 50 mM Tris-hydrochloric acid buffer (pH 7.5-9.0) were prepared. In a reaction solution with a final CCR protein concentration of 1 mg / mL, 200 μM p-coumaroyl-CoA and NADPH were added, or 500 μM 4-hydroxyphenylpropionaldehyde, CoA, and NADP were added, and the volume was brought up to 250 μL with buffers of different pH values. The reaction was then carried out at 30 °C for 10 min, and the product formation under different buffer systems and acidity conditions was compared. Similar reaction systems were prepared under the optimal buffer system, and the reactions were carried out at a series of temperatures (10-50 °C) for 10 min, with the product formation at different temperatures compared. The final results showed that:
[0053] The optimal catalytic conditions for CCR of the substrate coumaroyl coenzyme A are a temperature of 30°C and a phosphate buffer system at pH 6.0. Figure 4 );
[0054] The optimal catalytic conditions for the substrate 4-hydroxyphenylpropionaldehyde are a temperature of 25°C and a phosphate buffer system at pH 8.0 or a citric acid buffer system at pH 6.5. Figure 5 );
[0055] This indicates that CCR can catalyze the reduction reaction of hydroxycinnamoyl-CoA substances (including p-coumaryl-CoA, feruloyl-CoA, and mustard-CoA) into the corresponding hydroxycinnamoyl aldehydes, and can also catalyze the reverse oxidation reaction of 4-hydroxyphenylpropanal into dihydrocomaryl-CoA (a precursor for the synthesis of phloretin), but the reaction conditions are different.
[0056] Example 3: Synthesis of phlorizin using CCR and CHS catalysis
[0057] The pCold-TF-CHS positive colonies obtained in Example 1, which were verified by sequencing, were cultured in LB liquid medium at 37°C with shaking for 12 h. The recombinant plasmid pCold-TF-CHS was extracted using the AFT Spin EndoFree Plasmid Midi Kit (Aibotek Biotechnology Co., Ltd.). Specific procedures are detailed in the plasmid extraction instructions. The recombinant plasmid was transformed into competent Rosetta (DE3) cells and plated on LB solid medium containing 100 μg / ml ampicillin sodium and 34 μg / ml chloramphenicol for resistance selection. Positive clones were picked and propagated until the OD value was between 0.6 and 0.8. Recombinant protein expression was induced by IPTG under low temperature conditions. The predicted molecular weight of the recombinant CHS protein was 95.26 kDa (His tag + TF + HRV3C protease site carrier protein: 52.52 kDa; target protein CHS: 42.75 kDa). SDS-PAGE analysis showed that the target gene CHS was highly expressed and highly soluble. The recombinant CHS protein was obtained by digestion with HRV3C protease to remove the carrier protein, followed by purification with a nickel column to obtain the CHS protein. The removal of the carrier protein did not affect the enzyme activity. Please refer to the relevant reagent instructions for details.
[0058] Next, experiments were conducted to synthesize phlorizin in vitro from prokaryotically expressed CCR and CHS proteins. Specifically, 4-hydroxyphenylpropionaldehyde, coenzyme A, NADP, and malonyl-CoA were added to a mixed CCR and CHS protein solution (final concentration of each protein was 1 mg / mL) to a final concentration of 500 μM, and the volume was adjusted to 250 μL with pH 6.5 citrate buffer. After reacting at 25 °C for 2 h, 5 μL of trifluoroacetic acid was added to terminate the reaction. HPLC-MS analysis showed that... Figure 6 As shown, under these reaction conditions, a large amount of phlorizin is generated, along with a small amount of byproducts (byproduct 1 is dihydro-bis(demethyl)-angolin, and byproduct 2 is dihydro-coumaryl triacetate lactone). However, when the CCR is absent in the system, the generation of phlorizin and the two byproducts cannot be detected. This indicates that the CCR can catalyze the conversion of 4-hydroxyphenylpropionaldehyde to dihydro-p-coumaryl coenzyme A, which then generates phlorizin under the action of the CHS protein.
[0059] When CHS is absent in the system, 4-hydroxyphenylpropionaldehyde is converted to dihydrocoumaroyl-CoA under the catalysis of CCR, but no phloretin or two byproducts are generated.
[0060] Example 4, Practical Application
[0061] Rosetta(DE3) engineered bacteria containing the recombinant plasmid pCold-TF-CCR and Rosetta(DE3) engineered bacteria containing the recombinant plasmid pCold-TF-CHS were inoculated into LB liquid medium and propagated at 37°C until the OD value reached 0.6-0.8. Then, IPTG was added to the medium at a final concentration of 1 mM and the culture was induced at 16°C for 16 h to promote recombinant protein expression. The cultured bacteria were centrifuged at 2000 rpm for 20 min and washed twice with an equal volume of 50 μM phosphate buffer (pH 8.0) to collect the cultured bacteria. The bacteria were then resuspended in no more than 5 times the volume of 50 μM phosphate buffer containing imidazole (10 mM imidazole, pH 8.0).
[0062] The engineered bacteria were sonicated for 30 min, centrifuged at 8000 rpm for 20 min to remove residue, and the supernatant was passed through a nickel column at a flow rate of 3 column volumes / h. Ten column volumes of 50 μM phosphate buffer (20 mM imidazole, pH 8.0) were added to resuspend and wash away contaminating proteins. Recombinant CCR and CHS were then eluted with 5 column volumes of 50 μM phosphate buffer (250 mM imidazole, pH 8.0) containing imidazole. The purified recombinant CCR and CHS were mixed with 4-hydroxyphenylpropionaldehyde, coenzyme A, NADP, and malonyl-CoA, and reacted under optimal conditions for 4-8 h (to ensure a more thorough reaction). The optimal reaction conditions were: final concentrations of CCR and CHS proteins of 1 mg / mL, final concentrations of 4-hydroxyphenylpropionaldehyde, coenzyme A, NADP, and malonyl-CoA of 500 μM, pH 6.5 citrate buffer to a final volume of 10 mL, and a reaction temperature of 25 °C.
[0063] An equal volume of ethyl acetate was added to the resulting reaction mixture for extraction, and the ethyl acetate layer was separated. An equal volume of ethyl acetate was then added to the extracted reaction mixture for a second extraction. The two ethyl acetate extractions were combined, and the ethyl acetate was removed by vacuum distillation at 45°C. The paste was transferred to a petri dish and freeze-dried (at -50°C for 72 hours) to obtain a dry powder containing more than 75% phloretin.
[0064] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.
Claims
1. The use of the protein encoded by the sweet tea CCR gene, characterized by: The protein encoded by the sweet tea CCR gene catalyzes the oxidation of 4-hydroxyphenylpropionaldehyde to form dihydrocoumaroyl-CoA, a precursor for phloretin synthesis. The nucleotide sequence of the sweet tea CCR gene is shown in SEQ ID No: 1, and the amino acid sequence of the protein encoded by the sweet tea CCR gene is shown in SEQ ID NO:
3.
2. The use of the protein encoded by the sweet tea CCR gene according to claim 1, characterized in that: It catalyzes the reaction of 4-hydroxyphenylpropanal and coenzyme A to produce dihydrocoumaroyl-CoA.
3. The use of the protein encoded by the sweet tea CCR gene according to claim 1 or 2, characterized in that: Phloretin is synthesized under the combined action of proteins encoded by the sweet tea CHS gene. The nucleotide sequence of the sweet tea CHS gene is shown in SEQ ID No: 2, and the amino acid sequence of the protein encoded by the sweet tea CHS gene is shown in SEQ ID NO:
4.
4. A method for synthesizing phlorizin, characterized in that: A reaction system comprising the protein encoded by the sweet tea CCR gene as described in claim 1, the protein encoded by the sweet tea CHS gene as described in claim 3, 4-hydroxyphenylpropionaldehyde, coenzyme A, NADP, and malonyl-CoA is reacted to obtain phloretin.
5. The method for synthesizing phlorizin according to claim 4, characterized in that: The reaction system consists of the following components: protein encoded by the CCR gene at a final concentration of 1 mg / mL, protein encoded by the CHS gene at a final concentration of 1 mg / mL, 4-hydroxyphenylpropionaldehyde, coenzyme A, NADP and malonyl-CoA at a final concentration of 500 μM, and the remainder is pH 6.5 citrate buffer. React at 25±0.5℃ for 2-8 hours; The resulting products include phloretin as the main product, and dihydro-bis(demethyl)-iancocin and dihydro-coumaryltriacetin as byproducts.
Citation Information
Patent Citations
Tea geometrid chitin synthetase gene chsA and use thereof
CN101215570A
Paulownia cinnhyl CoA reductase gene and use thereof
CN101434938A