Virus whole genome sequencing method

Abstract

The invention relates to the technical field of virus whole genome sequencing, and discloses a method for virus whole genome sequencing, which comprises the following steps: S1, extracting a sample genome, operating according to a specification of a commodity kit, extracting RNA (Ribonucleic Acid) of the sample genome, and performing library construction after reverse transcription and targeted amplification. According to the method for sequencing the whole genome of the virus, the whole genome sequence of the virus can be obtained through the sequencing method, and compared with the current detection which only stays at negative and positive detection, the whole genome sequence can be obtained on the basis through the method for sequencing, epidemiological traceability is carried out, and meanwhile the sequencing cost can be effectively reduced.

Description

Technical Field

[0001] The present invention relates to the technical field of virus whole genome sequencing, and in particular to a method for virus whole genome sequencing. Background Art

[0002] Whole genome sequencing is the genome sequencing of individuals of species with unknown genome sequences. Genomic DNA is extracted and randomly interrupted. DNA fragments of the required length (0.2-5Kb) are recovered by electrophoresis, and adapters are added to prepare DNA clusters. Finally, the inserted fragments are sequenced using the Paired-End (Solexa) or Mate-Pair (SOLiD) method, and the measured sequences are assembled into Contigs. The distance of the Paired-End can be further assembled into Scaffolds, and then assembled into chromosomes, etc. The assembly effect is related to the sequencing depth, coverage, sequencing quality, etc. Commonly used assemblies include: SOAPdenovo, Trimity, Abyss, etc.

[0003] Sequencing depth refers to the ratio of the total number of bases (bp) obtained by sequencing to the size of the genome. It is one of the indicators for evaluating the amount of sequencing. There is a positive correlation between sequencing depth and genome coverage. The error rate or false positive results caused by sequencing will decrease with the increase of sequencing depth. For sequenced individuals, if a double-end or Mate-Pair solution is used, when the sequencing depth is above 50X to 100X, the genome coverage and sequencing error rate control can be guaranteed, and the subsequent assembly of sequences into chromosomes can become easier and more accurate.

[0004] Sequencing coverage: the proportion of bases covered by the genome sequenced; sequencing coverage is one of the indicators reflecting the randomness of sequencing; the relationship between sequencing depth and coverage can be determined by the Lander-Waterman Model (1988). When the depth reaches 5X, it can cover more than about 99.4% of the genome.

[0005] The current methods for whole genome sequencing of viruses have the following deficiencies in actual operation:

[0006] 1) The cost of third-generation sequencing is high, and its accuracy is lower than that of high-throughput sequencing;

[0007] 2) The viral load is low, and the success rate of direct sequencing is low. Summary of the invention

[0008] In view of the problems that the third-generation sequencing of the above-mentioned existing methods is high in cost, low in accuracy compared with high-throughput sequencing, low in viral load, and low in success rate of direct sequencing, the present invention is proposed.

[0009] Therefore, the purpose of the present invention is to provide a method for whole genome sequencing of the virus, the purpose of which is to obtain the whole genome sequence of the Zaru virus. Compared with the current detection which only stays at negative and positive detection, the present invention can obtain the whole genome sequence on this basis and conduct epidemiological tracing.

[0010] In order to solve the above technical problems, the present invention provides the following technical solutions: a method for whole genome sequencing of a virus, comprising S1, extracting the sample genome, operating according to the instructions of the commercial kit, extracting the sample genome RNA, and constructing a library after reverse transcription and targeted amplification;

[0011] S2, N6 Buffer 4μL; RT Buffer 5μL; RT Enzyme Mix 1μL; Take a new 0.2mL PCR tube, mark the sample name, use a pipette to draw 10μL of the prepared reverse transcription reaction solution into the tube, then add 10μL of the RNA sample to be tested, pipette 10 times to mix, centrifuge instantly to collect the reaction solution to the bottom of the tube, and place the PCR tube on the PCR instrument;

[0012] S3, targeted amplification, adding a targeted primer set and amplifying the whole viral genome according to the amplification conditions;

[0013] S4, library construction;

[0014] S5, interrupt product purification, add 48ul magnetic beads to the reaction tube (2), gently blow 10 times to mix thoroughly, and let stand at room temperature for 5min; centrifuge briefly and place on a magnetic stand for 2-5min, discard the supernatant; add 160ul of newly prepared 80% ethanol to rinse the magnetic beads and tube wall, invert the PCR tube twice and discard the supernatant; centrifuge briefly, then dry the liquid, open the lid to dry, and add 45ul of elution buffer to elute;

[0015] S6, connector connection, all reagents are thawed in advance; connector connection system (30ul):

[0016] Buffer 23ul

[0017] Ligase 5ul

[0018] Ligation Enhancer 2ul

[0019] Connection conditions: 25℃, 10min

[0020] Add 22ul TE and continue with the next steps;

[0021] S7, ligation product purification, add 20ul magnetic beads, gently blow 10 times to mix completely. Stand at room temperature for 5min; centrifuge briefly and place on a magnetic stand for 2-5min, discard the supernatant; add 160ul of newly prepared 80% ethanol to rinse the magnetic beads and tube wall, discard the supernatant; repeat the above rinsing process once; centrifuge briefly, then absorb the liquid, open the lid to dry, and then add 51ul of eluent to elute. Determine the Qubit concentration of the eluent;

[0022] S8, secondary purification of ligation products, library mixing, take the corresponding sample nucleic acid in proportion to the required sequencing data volume and mix them, the amount of nucleic acid after mixing should be no less than 100ng; calculate the volume after mixing, add 0.7 times the volume of magnetic beads for purification. Let stand at room temperature for 5min; after instant centrifugation, place on the magnetic stand for 2-5min, discard the supernatant; add 160ul of newly configured 80% ethanol to rinse the magnetic beads and tube walls, discard the supernatant; repeat the above rinsing process once; instant centrifugation, then absorb the liquid, open the lid to dry, and then add 45ul of elution solution for elution. The Qubit concentration of the eluent is determined, and the total amount of the library should be no less than 50ng;

[0023] S9, sequencing process;

[0024] S10, sequencing data acquisition.

[0025] As a preferred embodiment of the method for whole genome sequencing of a virus according to the present invention, the PCR tube is placed on a PCR instrument and reacted at 25°C for 5 min, 42°C for 20 min, and 95°C for 5 min.

[0026] As a preferred embodiment of the method for whole genome sequencing of a virus described in the present invention, the sequencing process is performed according to the instructions of the sequencing kit.

[0027] As a preferred solution of the method for whole genome sequencing of a virus described in the present invention, the sequencing data acquisition in S10 mainly includes fastq files and report files, bioinfo files, summaryreport files, etc.

[0028] Beneficial effects of the present invention: The present invention can obtain the whole genome sequence of Zaru virus through the sequencing method. Compared with the current detection which only stays at negative and positive detection, the sequencing method can obtain the whole genome sequence on this basis, conduct epidemiological tracing, and effectively reduce the sequencing cost. DETAILED DESCRIPTION

[0029] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0030] As an embodiment of the present invention, a method for whole genome sequencing of a virus is provided, and the method for whole genome sequencing of a virus comprises:

[0031] S1, sample genome extraction: follow the instructions of the commercial kit to extract sample genomic RNA, and then construct the library after reverse transcription and targeted amplification;

[0032] S2, N6 Buffer 4μL; RT Buffer 5μL; RT Enzyme Mix 1μL; Take a new 0.2mL PCR tube, mark the sample name, use a pipette to draw 10μL of the prepared reverse transcription reaction solution into the tube, then add 10μL of the RNA sample to be tested, pipette 10 times to mix, centrifuge instantly to collect the reaction solution to the bottom of the tube, and place the PCR tube on the PCR instrument;

[0033] S3, targeted amplification, add the targeted primer set and amplify the whole viral genome according to the amplification conditions, the conditions are as follows:

[0034]

[0035] S4, library construction, including enzyme cleavage, purification of cleavage products, adapter ligation, purification of ligation products, secondary purification, quantification and other processes.

[0036] Enzyme digestion: The reaction system is as follows: 50-300ng genomic DNA;

[0037] Buffer 10ul

[0038] Enzyme 5ul

[0039] Make up the volume to 60ul with nuclease-free water

[0040] Reaction conditions:

[0041] 30℃, 7.5min; 65℃, 20min, 4℃, maintain. Note: The reaction time is particularly critical, end the reaction as soon as possible after completion, and place the reaction tube on ice;

[0042] S5, interrupt product purification, add 48ul magnetic beads to the reaction tube (2), gently blow 10 times to mix thoroughly, and let stand at room temperature for 5min; centrifuge briefly and place on a magnetic stand for 2-5min, discard the supernatant; add 160ul of newly prepared 80% ethanol to rinse the magnetic beads and tube wall, invert the PCR tube twice and discard the supernatant; centrifuge briefly, then dry the liquid, open the lid to dry, and add 45ul of elution buffer to elute;

[0043] S6, connector connection, all reagents are thawed in advance; connector connection system (30ul):

[0044] Buffer 23ul

[0045] Ligase 5ul

[0046] Ligation Enhancer 2ul

[0047] Connection conditions: 25℃, 10min

[0048] Add 22ul TE and continue with the next steps;

[0049] S7, ligation product purification, add 20ul magnetic beads, gently blow 10 times to mix completely. Stand at room temperature for 5min; centrifuge briefly and place on a magnetic stand for 2-5min, discard the supernatant; add 160ul of newly prepared 80% ethanol to rinse the magnetic beads and tube wall, discard the supernatant; repeat the above rinsing process once; centrifuge briefly, then absorb the liquid, open the lid to dry, and then add 51ul of eluent to elute. Determine the Qubit concentration of the eluent;

[0050] S8, secondary purification of ligation products, library mixing, take the corresponding sample nucleic acid in proportion to the required sequencing data volume and mix them, the amount of nucleic acid after mixing should be no less than 100ng; calculate the volume after mixing, add 0.7 times the volume of magnetic beads for purification. Let stand at room temperature for 5min; after instant centrifugation, place on the magnetic stand for 2-5min, discard the supernatant; add 160ul of newly configured 80% ethanol to rinse the magnetic beads and tube walls, discard the supernatant; repeat the above rinsing process once; instant centrifugation, then absorb the liquid, open the lid to dry, and then add 45ul of elution solution for elution. The Qubit concentration of the eluent is determined, and the total amount of the library should be no less than 50ng;

[0051] S9, sequencing process;

[0052] S10, sequencing data acquisition.

[0053] The PCR tube was placed on a PCR instrument and reacted at 25°C for 5 min, 42°C for 20 min, and 95°C for 5 min.

[0054] The sequencing process is carried out according to the instructions of the sequencing kit.

[0055] The sequencing data acquisition in S10 mainly includes fastq files and report files, bioinfo files, summaryreport files, etc.

[0056] Bioinformatics analysis process:

[0057] (1) File name generation command:

[0058] ls / home / lenovo / Desktop / 20230915|grep".gz"|sed's / .* / "&" / '>

[0059] files.txt

[0060] (2) Sequencing data splicing process:

[0061] #! / bin / bash

[0062] #Build bwa-mem2 index

[0063] bwa-mem2 index NC_045512.fa

[0064] # Create a list of file names

[0065] file_list=(

[0066] "FT100041811_L01_UDB-393.fq.gz"

[0067] "FT100041811_L01_UDB-394.fq.gz"

[0068] "FT100041811_L01_UDB-395.fq.gz"

[0069] "FT100041811_L01_UDB-396.fq.gz"

[0070] "FT100041811_L01_UDB-397.fq.gz"

[0071] "FT100041811_L01_UDB-398.fq.gz"

[0072] "FT100041811_L01_UDB-399.fq.gz"

[0073] "FT100041811_L01_UDB-400.fq.gz" )

[0075] #qc

[0076] mkdir qc

[0077] # Perform subsequent analysis on each sequencing data

[0078] for file in "${file_list[@]}"; do

[0079] data_name = ${file%.fq.gz} #Get the file name (excluding the extension)

[0080] echo "Start processing file: $file"

[0081] #Sequencing data quality control

[0082] #fastqc

[0083] fastqc -f fastq -o qc$file

[0084] #Sequencing data is spliced ​​with parameters

[0085] bwa-mem2 mem-t 12NC_045512.fa$file|samtools sort|samtools view-F 4-o${data_name}_consensus.bam

[0086] samtools mpileup-Ad 1000-BQ 0--reference NC_045512.fa${data_name}_consensus.bam|ivar consensus-p${data_name}_consensus-n N

[0087] echo "File $file processed."

[0088] done

[0089] (3) Sequence analysis after assembly: After obtaining the consensus.fa sequence, blast search was used to obtain the integrity of the whole genome sequence, evaluate the effect of targeted sequencing, and conduct in-depth analysis of pathogen typing.

[0090] (1) Zaru virus amplicon sequencing primer set, a total of 10 pairs of primers, primer information is as follows: SAV24-F1attctacccaattgagttcaacc SAV24-R1 tcacgcatRtcctgRaaca SAV24-F2tgYgaaggYatgcgcac

[0091] SAV24-R2 ccYtgggcatcYacatc

[0092] SAV24-F3 gaaggttcccgtggcaataATC SAV24-R3 tcccgtgtctgcatgtg

[0093] SAV24-4F gcatccctggccaactca

[0094] SAV24-4R atgggYtgtgtgcggat

[0095] SAV24-5F atggactcagaagacgtgc SAV24-5R gatcKgtgtgtgccMac

[0096] SAV24-6F caagtgagacacatgccc

[0097] SAV24-6R cagtcatcaccataBgtgtg SAV24-7F ggcatgccattcaccag SAV24-7Rtcctgcaaacatggcactc SAV24-8F gcaaccggagcaatcacc SAV24-8R CactcatgtcagcattggGSAV24-9F attgaaccaatcgcggg

[0098] SAV24-9R gcacctgtgaaccaagac

[0099] SAV24-10F ggYacacaccaactYcttgac SAV24-R10 GGctgcgatcgcttaatcg (2) Reverse transcription system and process.

[0100] Preparation of reverse transcription reaction solution

[0101]

[0102] Take a new 0.2mL PCR tube, mark the sample name, use a pipette to draw 10μL of the prepared reverse transcription reaction solution into the tube, then add 10μL of the RNA sample to be tested, pipette 10 times to mix, and centrifuge briefly to collect the reaction solution to the bottom of the tube. Place the PCR tube on the PCR instrument and react according to the conditions in the table;

[0103] Reverse transcription reaction conditions

[0104]

[0105] After the reaction was completed, the mixture was centrifuged for 10 seconds and the product was placed on ice for later use.

[0106] (3) Targeted amplification process

[0107] Preparation of PCR reaction solution

[0108]

[0109]

[0110] PCR reaction conditions

[0111]

[0112] (4) Library construction process: After the PCR product is purified, the library is constructed.

[0113] The library construction process is automatically completed by the library construction instrument according to the set process.

[0114] (4) Sequencing process

[0115] DNB preparation

[0116] According to the ratio of the required sequencing data volume, the corresponding volume of ligation products was mixed, and 15 ng of ligation products were required for each DNB preparation. DNB preparation was performed using the instructions of the BGI DNBSEQ One-Step DNB Preparation Kit (OS-DB) (Cat. No.: 1000026466).

[0117] Sequencing

[0118] It is recommended to use the "SE100" sequencing kit and kit of the high-throughput sequencing kit for sequencing the DNB library. Perform double barcode sequencing and select the SE100+10+10 sequencing type to obtain sequencing data.

[0119] (5) Genome splicing process

[0120] The genome assembly code is as follows:

[0121] Data processing:

[0122] $mkdir SAV

[0123] $cd SAV

[0124] $ gunzip*.gz

[0125] Sequencing data quality control

[0126] $mkdir XX_fastqc

[0127] Create output directory

[0128] $fastqc-o XX_fastqc-t 10SAV_1.fastq

[0129] Sequencing data assembly

[0130] $nohup spades.py -k 21,33,55,77,99--careful--cov-cutoff auto-sNJ_kn8_map_sort.fastq-o NJ_kn8_map_output&

[0131] (6) Bioinformatics analysis is as follows

[0132] 1.Read quality control and host removal: Use SOAPnuke software to filter and quality control the raw data, use Bowtie2 to align the host sequence and remove the sequence in the alignment to generate Clean Data.

[0133] 2. Functional annotation: First, use MEGAHIT to perform k-mer-based assembly on the sequences that have completed quality control and host removal to generate contigs, and then use MetaGeneMark software to predict the gene sequences in Contigs. Use CD-HIT software to remove redundancy from the obtained genes, use Salmon software to calculate the relative abundance table of each gene, and then use DIAMOND software to align the de-redundant genes to databases such as eggNOG, KEGG, BacMet, CARD, COG, CAZy, Swiss-prot, etc. to complete gene function annotation.

[0134] 3. Species annotation: Use Kraken2 and self-built databases (screening NCBI NT database and UHGG database) to calculate the number of sequences of species contained in the sample, and then use Bracken2 to estimate the actual abundance of species in the sample to complete species annotation.

[0135] 4. Based on the gene abundance table, species abundance table and function abundance table, the distribution of genes, species and functions can be visualized, the sample Alpha diversity and group Beta diversity can be calculated, abundance clustering analysis, PCA, PLSDA, PCoA and NMDS dimensionality reduction analysis, sample clustering analysis, inter-group differences using Wilcoxon / Kruscal, LEfSe analysis and KEGG pathway enrichment analysis (Reportscore method) can be performed to explore the differences in species composition and functional composition between samples.

[0136] 5. In-depth association studies combined with environmental factors, pathological indicators or special phenotypes can provide a theoretical basis for further in-depth research and utilization of the species and functions of the samples.

[0137] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A method for whole genome sequencing of a virus, characterized in that include: S1, sample genome extraction: follow the instructions of the commercial kit to extract sample genomic RNA, and then construct the library after reverse transcription and targeted amplification; S2, N6 Buffer 4μL; RT Buffer 5μL; RT Enzyme Mix 1μL; Take a new 0.2mL PCR tube, mark the sample name, use a pipette to draw 10μL of the prepared reverse transcription reaction solution into the tube, then add 10μL of the RNA sample to be tested, pipette 10 times to mix, centrifuge instantly to collect the reaction solution to the bottom of the tube, and place the PCR tube on the PCR instrument; S3, targeted amplification, adding a targeted primer set and amplifying the whole viral genome according to the amplification conditions; S4, library construction; S5, interrupt product purification, add 48ul magnetic beads to the reaction tube (2), gently blow 10 times to mix thoroughly, and let stand at room temperature for 5min; centrifuge briefly and place on a magnetic stand for 2-5min, discard the supernatant; add 160ul of newly prepared 80% ethanol to rinse the magnetic beads and tube wall, invert the PCR tube twice and discard the supernatant; centrifuge briefly, then dry the liquid, open the lid to dry, and add 45ul of elution buffer to elute; S6, connector connection, all reagents are thawed in advance; connector connection system (30ul): Buffer 23ul Ligase 5ul Ligation Enhancer 2ul Connection conditions: 25℃, 10min Add 22ul TE and continue with the next steps; S7, ligation product purification, add 20ul magnetic beads, gently blow 10 times to mix completely. Stand at room temperature for 5min; centrifuge briefly and place on a magnetic stand for 2-5min, discard the supernatant; add 160ul of newly prepared 80% ethanol to rinse the magnetic beads and tube wall, discard the supernatant; repeat the above rinsing process once; centrifuge briefly, then absorb the liquid, open the lid to dry, and then add 51ul of eluent to elute. Determine the Qubit concentration of the eluent; S8, secondary purification of ligation products, library mixing, take the corresponding sample nucleic acid in proportion to the required sequencing data volume and mix them, the amount of nucleic acid after mixing should be no less than 100ng; calculate the volume after mixing, add 0.7 times the volume of magnetic beads for purification. Let stand at room temperature for 5min; after instant centrifugation, place on the magnetic stand for 2-5min, discard the supernatant; add 160ul of newly configured 80% ethanol to rinse the magnetic beads and tube walls, discard the supernatant; repeat the above rinsing process once; instant centrifugation, then absorb the liquid, open the lid to dry, and then add 45ul of elution solution for elution. The Qubit concentration of the eluent is determined, and the total amount of the library should be no less than 50ng; S9, sequencing process; S10, sequencing data acquisition.

2. The method for whole genome sequencing of a virus according to claim 1, characterized in that: The PCR tube was placed on a PCR instrument and reacted at 25°C for 5 min, 42°C for 20 min, and 95°C for 5 min.

3. The method for whole genome sequencing of a virus according to claim 2, characterized in that: The sequencing process is carried out according to the instructions of the sequencing kit.

4. The method for whole genome sequencing of a virus according to claim 3, characterized in that: The sequencing data acquisition in S10 mainly includes fastq files and report files, bioinfo files, summaryreport files, etc.

Images