SNP molecular marker related to sesame seed oil content trait and application

Abstract

The application discloses a SNP molecular marker related to a sesame seed oil content character and application, and belongs to the biological technology field of sesame. The SNP molecular marker is located at 3669198bp of the 5th chromosome of a sesame genome; and the base of the SNP molecular marker is A or G. The application provides a SNP molecular marker related to a sesame seed oil content character and application, genotype detection can be carried out at a seedling stage, single plants with breeding targets are screened, excellent materials are avoided from being blindly removed due to thinning, thinning and other conditions, excellent offspring are as much as possible reserved, and breeding efficiency is improved.

Description

Technical Field

[0001] This invention relates to the field of sesame biotechnology, and in particular to a SNP molecular marker and its application related to the oil content trait of sesame seeds. Background Technology

[0002] Sesame oil is the most beloved oilseed in my country and even the world, and its raw material, sesame, also holds an important place in traditional Chinese culture. For example, "Sesame flowers bloom higher and higher" is an auspicious saying that everyone in my country knows and uses. However, phrases like "losing the watermelon to pick up sesame seeds" and "a minor official with a sesame seed" not only realistically reflect the "smallness" of sesame seeds, but also illustrate the numerous difficulties in sesame breeding and the improvement of high-yield varieties. Sesame is a healthy and distinctive oilseed crop that is widely cultivated in the world, with an oil content as high as 55%, and is known as the "Queen of Oils". my country has made important contributions to the development of the global sesame industry (Wang Ruiyuan. China has made important contributions to the development of the global sesame industry [J]. China Oils and Fats, 2019, 44(12):1-2).

[0003] Sesame seeds contain 48%–62% oil by dry weight, mainly composed of saturated and unsaturated fatty acids, including unsaturated fatty acids, oleic acid, and linoleic acid, as well as saturated fatty acids such as palmitic acid, stearic acid, and arachidic acid (Wang Xuede, Cui Yingde, Liu Ribin, et al. Determination and correlation analysis of fatty acid composition in sesame seeds [J]. China Oils and Fats, 2016, 41(1):95-99.). Among them, oleic acid and linoleic acid are the main components, accounting for about 85% of the total fatty acids (Li Xiaodan, Xiao Ling, Wu Gang, et al. Study on fatty acid accumulation pattern during sesame seed development [J]. Chinese Journal of Oil Crops, 2008, 30(1):84-89. Zhou Rong, Liu Pan, Li Donghua, et al. Cloning and functional verification of sesame stearate desaturase gene SiSAD [J]. Chinese Agricultural Science, 2019, 52(10):1678-1685.). The content and composition ratio of saturated and unsaturated fatty acids directly affect the quality of sesame oil. Oleic acid is a monounsaturated fatty acid with high oxidative stability. High-oleic acid products have a longer shelf life and higher nutritional value. They can lower low-density cholesterol and blood lipid levels, thus effectively preventing cardiovascular and cerebrovascular diseases (Wang Jingzi, Xu Guifa. The relationship between monounsaturated fatty acids and coronary heart disease [J]. Food and Drug, 2005, 7: 21-23.). Linoleic acid is an essential fatty acid for the human body. It can prevent arteriosclerosis, reduce cholesterol accumulation in the blood, and inhibit cancer, but its oxidative stability is not as good as oleic acid (Cao Shuwen, Yu Yanying, Wen Huiliang, et al. Study on the anti-breast cancer activity of conjugated linoleic acid isomers [J]. Acta Nutrimenta Sinica, 2001, 23(1): 28-31.). Improving fatty acid composition through molecular breeding to make the composition, content, and ratio of fatty acids more reasonable is one of the main goals of sesame variety improvement. The oil content and fatty acid composition of sesame are quantitative traits controlled by multiple genes. Through hybridization between different parents, germplasm materials with high oil content and other high-quality traits can be created.

[0004] With the publication of the sesame reference genome sequence and the construction of the sesame genetic linkage map, QTL analysis and gene discovery of important agronomic traits of sesame, including oil content, have been carried out (Wang L, Yu S, Tong C, et al. Genome sequencing of the high oil crop sesame provides insight into oil biosynthesis[J]. Genome Biol, 2014, 15(2): R39.). Wei Wenliang et al., through the association analysis of oil content of 216 core sesame varieties, repeatedly detected 8 molecular markers in two years, with a total variance explained of 28.46% and 38.01%, and a variance explained range of 2.95% to 6.03%. Another 15 molecular markers were only detected in one year, with a variance explained range of 3.06% to 5.18% (Wei Wenliang, Zhang Yanxin, Lü Haixia, et al. Association analysis of sesame resource population structure and oil content[J]. Chinese Agricultural Science, 2012, 45(10): 1895-1903). Wu Kun et al. conducted sesame quality trait tests on a RIL population containing 224 lines and obtained 5 QTLs related to oil content, which were distributed on linkage groups LG1, LG2, LG5, LG9 and LG16, and could explain 6.5% to 10.1% of the phenotypic variation (Wu Kun, Wu Wenxiong, Yang Minmin, et al. QT localization analysis of oil, protein and sesamin content in white sesame seeds [J]. Acta Agronomica Sinica, 2017, 43(7):1003-1011). Zhou Rong et al. constructed a RIL population containing 548 lines using Zhongzhi 13 and ZZM2748 as parents. By analyzing the oil content, oleic acid, linoleic acid, palmitic acid, and stearic acid content of the population under different environments, a total of 50 QTLs were detected that were significantly correlated with the above five quality traits (Zhou Rong, Xu Fangtao, Sheng Chen, et al. QTL analysis of sesame oil content and fatty acid content [J]. Chinese Journal of Oil Crops, 2021, 43(6):1042-1051). In summary, there are still few studies on gene loci related to sesame oil content and fatty acids. The genetic improvement of sesame oil content and fatty acids is still at the level of conventional breeding techniques, lacking gene loci and molecular markers for oil content and fatty acids, which limits the breeding process. Summary of the Invention

[0005] The purpose of this invention is to provide an SNP molecular marker and its application related to the oil content trait of sesame seeds, so as to solve the problems existing in the prior art.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] One of the technical solutions of this invention is an SNP molecular marker related to the oil content trait of sesame seeds, wherein the SNP molecular marker is located at 3669198 bp on chromosome 5 of the sesame genome; the reference gene version is Sesamum_indicum:Zhongzhi13_v2.0;

[0008] The SNP molecular marker has a base of A or G.

[0009] The second technical solution of the present invention is a method for identifying the oil content of sesame seeds using the SNP molecular marker. The method involves detecting the genotype of the corresponding single nucleotide polymorphism site of the SNP molecular marker in the genomic DNA of the sesame seed to be identified. The oil content of sesame seeds with genotype AA is significantly higher than that of individuals with genotype GG.

[0010] The third technical solution of this invention is the application of the SNP molecular marker in breeding of traits related to oil content in sesame seeds.

[0011] The fourth technical solution of the present invention is the application of the SNP molecular marker in the identification or auxiliary identification of traits related to oil content in sesame seeds.

[0012] The fifth technical solution of the present invention is the application of the SNP molecular marker in the preparation of products for identifying or assisting in the identification of traits related to oil content in sesame seeds.

[0013] Based on the above technical solution, the present invention has the following technical effects:

[0014] This invention provides an SNP molecular marker and its application related to the oil content trait of sesame seeds. Genotyping can be performed during the seedling stage to screen individual plants with breeding objectives. This avoids the blind removal of superior materials due to conditions such as thinning and thinning, and retains as many superior offspring as possible, thereby improving breeding efficiency. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 This is the QTL location result.

[0017] Figure 2 The average oil content of individual plants with different genotypes in the experimental population and the significance of their differences were determined.

[0018] Figure 3 To verify the average oil content of individual plants with different genotypes in the population and the significance of their differences. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0025] This invention provides an SNP molecular marker associated with the oil content trait of sesame seeds. The SNP molecular marker is located at 3669198 bp on chromosome 5 of the sesame genome; the reference gene version is Sesamum_indicum:Zhongzhi13_v2.0.

[0026] The SNP molecular marker has a base of A or G.

[0027] In some specific implementations, the SNP molecular markers include genotypes AA, GG, and AG.

[0028] This invention also provides a method for identifying the oil content of sesame seeds using the SNP molecular marker. The method detects the genotype of the corresponding single nucleotide polymorphism site of the SNP molecular marker in the genomic DNA of the sesame seed to be identified. The oil content of sesame seeds with genotype AA is significantly higher than that of individuals with genotype GG.

[0029] This invention also provides the application of the SNP molecular marker in breeding for traits related to oil content in sesame seeds.

[0030] This invention also provides the application of the SNP molecular marker in identifying or assisting in the identification of traits related to oil content in sesame seeds.

[0031] This invention also provides the application of the SNP molecular marker in the preparation of products for identifying or assisting in the identification of traits related to oil content in sesame seeds.

[0032] In some specific implementations, the sesame includes Jizhi No. 1, Linzhi No. 6, and offspring bred from the two as parents.

[0033] Example 1

[0034] The discovery of SNPs

[0035] 1. A hybrid combination was constructed using Jizhi No. 1 (oil content 51.31%) as the female parent and Linzhi No. 6 (oil content 50.44%) as the male parent. Hybridization was completed in Shijiazhuang, Hebei Province in the summer of 2020. F1 plants were then planted in Sanya, Hainan Province in the winter of the same year, self-pollinated, and F2 plants were harvested. In the summer of 2021, these F2 plants were planted in Shijiazhuang, Hebei Province, resulting in 169 individual plants, managed using conventional field methods. The seed coat oil content of the parents and individual F2 plants was determined using near-infrared spectroscopy.

[0036] 2. DNA was extracted from the parental lines and F2 single plants using the CTAB method. DNA integrity was detected by agarose gel electrophoresis, and DNA concentration was determined using NanoDrop 2000.

[0037] 3. SNPs of the population were developed using resequencing technology. The experimental procedure was performed according to the standard protocol provided by Illumina, including sample quality testing, library construction, library quality testing, and library sequencing.

[0038] 4. The data from the machine were filtered according to the data analysis method of LI et al. (High-density genetic linkage map construction by F2 populations and QTL analysis of early-maturity traits in upland cotton (Gossypium hirsutum L.). Plos One, 2017, 12(8):e0182918.) and the high-quality sequences were aligned to the sesame reference genome (Wang LH, Yu S, Tong CB, et al. Genome sequencing of the high oil crops esame provides insight into oil biosynthesis[J]. Genome Biology, 2014, 15(2):1-13.) using BWA (0.7.17) software (Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics, 2009, 25(14):1754-1760.). SNP markers were identified using GATK (4.0.11.0) software (The genome analysis toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Research, 2010, 20: 1297-1303.).

[0039] 5. First, filter the following low-quality reads: remove adapter sequences; remove reads with an uncertain base type ratio greater than 10%; remove reads containing more than 50% low-quality bases. The filtered high-quality reads are then used to detect SNPs using GATK software, and then genetic maps are constructed using MSTMap (the minimum spanning tree map, version update 2015) software, with LOD values ​​ranging from 4.0 to 20.0.

[0040] 6. Combining genetic mapping and fiber quality data, QTLs were located using the ICIM program in QTLIciMapping 4.0 software, with parameters Step = 1 cM, PIN = 0.001, and LOD values ​​determined by 1000 iterations. The results identified three QTLs on chromosome 5 with contribution rates ranging from 8.308% to 10.441%. Figure 1(Table 1).

[0041] Table 1

[0042]

[0043] 7. Based on genomic location, the three QTLs are located on chromosome 5 at 3.67–4.02 Mb, and there is a 14-base difference between the maternal and paternal materials.

[0044] The F2 population was divided into groups based on parental genotypes (maternal genotype AA, paternal genotype GG). Groups with the same genotype as the maternal parent were designated as group a, those with the same genotype as the paternal parent as group b, and heterozygous genotypes (AG) as group h. The results showed that the SNP at 3669198 bp on chromosome 5 of the sesame genome (Sesamum_indicum:Zhongzhi13_v2.0, chr5) effectively distinguished the oil content of the populations. The average oil content of F2 seeds from group a (maternal genotype AA) was 49.62%, while that from group b (paternal genotype GG) was 47.87%, a difference of approximately 2%, reaching a significant level (0.05). The oil content of F2 seeds from group h (genotype AG) was 48.56%, falling between the two homozygous genotypes. Figure 2 This demonstrates that the base AA at 3669198bp on chromosome 5 is highly effective in identifying high oil content in sesame seeds, while GG is highly effective in identifying low oil content in sesame seeds.

[0045] The sequence 50 bp upstream and downstream of this SNP site is SEQ ID NO.1: GTTTATTCAGAGGAAAAA CCATGCAGGCAAATAGAAAACGGAACGATTTAG[A]TTGAAATTTTCCTGTCCTGACTTTTTCTGATTATATCTATAATAGAATCT.

[0046] Example 2

[0047] SNP verification

[0048] 1. A hybrid combination was constructed using 201029-0-9-3-0-9-1 (oil content 51.31%) as the female parent and ZZM00254 (oil content 50.44%) as the male parent. Hybridization was completed in Shijiazhuang, Hebei Province in the summer of 2022. F1 plants were then planted in Sanya, Hainan Province in the winter of the same year, self-pollinated, and F2 plants were harvested. In the summer of 2023, these F2 plants were planted in Shijiazhuang, Hebei Province, resulting in 127 individual plants, managed using conventional field methods. The seed coat oil content of the parents and individual F2 plants was investigated.

[0049] 2. DNA was extracted from the parental lines and F2 single plants using the CTAB method. DNA integrity was detected by agarose gel electrophoresis, and DNA concentration was determined using NanoDrop 2000.

[0050] 3. SNPs of the population were developed using resequencing technology. The experimental procedure was performed according to the standard protocol provided by Illumina, including sample quality testing, library construction, library quality testing, and library sequencing.

[0051] 4. The data from the machine were filtered according to the data analysis method of LI et al. (High-density genetic linkage map construction by F2 populations and QTL analysis of early-maturity traits in upland cotton (Gossypium hirsutum L.). Plos One, 2017, 12(8):e0182918.) and the high-quality sequences were aligned to the sesame reference genome (Wang LH, Yu S, Tong CB, et al. Genome sequencing of the high oil crops esame provides insight into oil biosynthesis[J]. Genome Biology, 2014, 15(2):1-13.) using BWA (0.7.17) software (Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics, 2009, 25(14):1754-1760.). SNP markers were identified using GATK (4.0.11.0) software (The genome analysis toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Research, 2010, 20: 1297-1303.).

[0052] 5. The bases at position 3669198 on chromosome 5 of F2 individual plants were detected, and the F2 population was genotyped according to the parental genotypes. The results showed that the average seed oil content of F2 individual plants with the same maternal genotype AA (i.e., group a) was 49.51%, while the average seed oil content of F2 individual plants with the same paternal genotype GG (i.e., group b) was 48.23%, a difference of approximately 1.3%, reaching a significant level of 0.05. The average seed oil content of heterozygous genotype AG individual plants (i.e., group h) was 48.88%, falling between the two homozygous genotypes. Figure 3 This proves that the AA base at position 3669198 on chromosome 5 can identify high oil content in sesame seeds, while the GG base can identify low oil content in sesame seeds.

[0053] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A method for identifying the oil content of sesame seeds using SNP molecular markers related to the oil content trait of sesame seeds, characterized in that, The SNP molecular marker is located at 3669198 bp on chromosome 5 of the sesame genome; the reference gene version is Sesamum_indicum:Zhongzhi13_v2.0; The base of the SNP molecular marker is A or G; the SNP molecular marker has genotypes AA, GG and AG; The genotypes of the SNP molecular markers and corresponding single nucleotide polymorphism sites in the genomic DNA of the sesame seed to be identified were detected. The oil content of sesame seeds with genotype AA was significantly higher than that of individuals with genotype GG. The sesame varieties mentioned include Jizhi No. 1, Linzhi No. 6, and their offspring selected from the parents.

2. The application of reagents for detecting SNP molecular markers related to oil content in sesame seeds in breeding for traits related to oil content in sesame seeds, characterized in that, The SNP molecular marker is located at 3669198 bp on chromosome 5 of the sesame genome; the reference gene version is Sesamum_indicum:Zhongzhi13_v2.0; The base of the SNP molecular marker is A or G; the SNP molecular marker has genotypes AA, GG and AG; The genotypes of the SNP molecular markers and corresponding single nucleotide polymorphism sites in the genomic DNA of the sesame seed to be identified were detected. The oil content of sesame seeds with genotype AA was significantly higher than that of individuals with genotype GG. The sesame varieties mentioned include Jizhi No. 1, Linzhi No. 6, and their offspring selected from the parents.

3. The application of reagents for detecting SNP molecular markers related to oil content in sesame seeds in the identification or auxiliary identification of oil content-related traits in sesame seeds, characterized in that, The SNP molecular marker is located at 3669198 bp on chromosome 5 of the sesame genome; the reference gene version is Sesamum_indicum:Zhongzhi13_v2.0; The base of the SNP molecular marker is A or G; the SNP molecular marker has genotypes AA, GG and AG; The genotypes of the SNP molecular markers and corresponding single nucleotide polymorphism sites in the genomic DNA of the sesame seed to be identified were detected. The oil content of sesame seeds with genotype AA was significantly higher than that of individuals with genotype GG. The sesame varieties mentioned include Jizhi No. 1, Linzhi No. 6, and their offspring selected from the parents.

4. The application of reagents for detecting SNP molecular markers related to the oil content trait of sesame seeds in the preparation of products for identifying or assisting in the identification of traits related to oil content in sesame seeds, characterized in that, The SNP molecular marker is located at 3669198 bp on chromosome 5 of the sesame genome; the reference gene version is Sesamum_indicum:Zhongzhi13_v2.0; The base of the SNP molecular marker is A or G; the SNP molecular marker has genotypes AA, GG and AG; The genotypes of the SNP molecular markers and corresponding single nucleotide polymorphism sites in the genomic DNA of the sesame seed to be identified were detected. The oil content of sesame seeds with genotype AA was significantly higher than that of individuals with genotype GG. The sesame varieties mentioned include Jizhi No. 1, Linzhi No. 6, and their offspring selected from the parents.

Images