A method for detecting the fire blight resistance trait of apples using a kit

Abstract

The present invention relates to a method for detecting the fire blight resistance trait of apples using a kit. The kit includes a mixed primer; the mixed primer includes a forward specific primer F-resistant, a forward specific primer F-susceptible, and a common reverse primer R; the detection method includes: extracting the genomic DNA of apple leaves; performing PCR amplification, detecting the fluorescence signal during the amplification using a fluorescence quantitative PCR instrument ABI-Q6 Flex to perform genotyping; and determining the fire blight resistance trait of apples. Using this method, apple fire blight resistance resources can be rapidly screened at the molecular level with high accuracy.

Description

[0001] This invention is a divisional application. The original Chinese patent application number is: 202410674361.8, the application date is: May 29, 2024, and the patent name at the time of application is: A KASP Marker Linked to the Fire Blight Resistance Trait of Apples and Its Application. Technical Field

[0002] This invention belongs to the field of apple molecular genetic breeding, and particularly relates to a method for detecting the fire blight resistance trait of apples using a kit. Background Art

[0003] Apples are plants of the genus Malus in the Rosaceae family, and are perennial deciduous trees. They are one of the world's four major fruits, and more than 80 countries and regions around the world are engaged in apple production. Apples play an important role in our diet. Not only as a source of dietary supplements, but also because they are rich in polyphenols and other nutrients and bioactive substances, which have a positive effect on preventing cardiovascular diseases and anti-aging. As the saying goes, "An apple a day keeps the doctor away." However, apple production is affected by various biotic and abiotic stresses. In particular, fire blight has a great impact on apple growth. The breeding of fire blight-resistant varieties has always been an important goal for apple breeders around the world.

[0004] Fire blight is a bacterial disease caused by Erwinia amylovora. It harms the flowers, buds, branches, trunks and rootstocks of fruit trees such as apples and pears, ultimately leading to the death of the tree body, a reduction in orchard yield, and even causing devastating disasters in severe cases. In recent years, with the spread of fire blight globally, fire blight diseases have successively appeared in apple orchards in Xinjiang, China. Due to its great harm and difficulty in prevention and control, screening fire blight-resistant resources and then breeding new fire blight-resistant varieties is an important way to prevent this disease. Molecular markers can shorten the breeding process, but currently, there is a lack of molecular markers linked to apple fire blight resistance. Therefore, it is very necessary to develop primers for molecular markers used to screen fire blight-resistant resources. Summary of the Invention

[0005] In view of the problems existing in the prior art, this invention provides a method for detecting the fire blight resistance trait of apples using a kit, which can be used to screen fire blight-resistant apple resources and has the advantages of high accuracy.

[0006] The technical solution of this invention to solve the above technical problems is as follows:

[0007] The present invention provides a primer set for detecting the fire blight resistance trait of apples. The primer set includes a forward specific primer F-resistant, a forward specific primer F-susceptible, and a common reverse primer R. The forward specific primer F-resistant includes the nucleotide sequence shown in SEQ ID NO:1. The forward specific primer F-susceptible includes the nucleotide sequence shown in SEQ ID NO:2. The common reverse primer R includes the nucleotide sequence shown in SEQ ID NO:3.

[0008] The beneficial effects of the present invention include: it can be used for the rapid screening of fire blight resistance in apple resources or hybrid offspring, is not affected by environmental factors, greatly reduces the workload of inoculation identification in the field or laboratory, improves the selection efficiency, and provides reference and convenience for the subsequent excavation of fire blight resistance genes. The present invention has the advantages of being fast, scalable, convenient for genotyping, high screening efficiency, and high accuracy.

[0009] Furthermore, the 5'-end of the forward specific primer F-resistant includes a FAM fluorescent linker sequence, and the FAM fluorescent linker sequence includes the nucleotide sequence shown in SEQ ID NO:4.

[0010] Furthermore, the 5'-end of the forward specific primer F-susceptible includes a VIC fluorescent linker sequence, and the VIC fluorescent linker sequence includes the nucleotide sequence shown in SEQ ID NO:5.

[0011] The beneficial effects of adopting the above scheme include: the above primer set has the advantages of being fast, scalable, convenient for genotyping, high screening efficiency, and high accuracy.

[0012] The present invention provides a kit for detecting the fire blight resistance trait of apples, including the above primer set. For example, the kit may further include one or several of genomic DNA, KASP working solution, negative control, positive control, and water.

[0013] The beneficial effects of adopting the above scheme include: the above kit has the advantages of being fast, scalable, convenient for genotyping, high screening efficiency, and high accuracy.

[0014] The present invention provides the application of one or several of the above primer set and kit in breeding fire blight resistant varieties.

[0015] The beneficial effects of adopting the above scheme include: using one or several of the above primer set and kit can screen fire blight resistant apple resources at the molecular level, and has the advantages of being fast, scalable, convenient for genotyping, high screening efficiency, and high accuracy.

[0016] The present invention provides a method for detecting the fire blight resistance trait of apples, comprising the following steps: extracting the genomic DNA of apples, performing PCR amplification and genotyping on the genomic DNA of apples using the above primer set, and then determining the fire blight resistance trait of apples.

[0017] Further, the PCR amplification program includes: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 30 s, annealing at 61°C for 45 s, with a decrease of 0.6°C for each cycle, for 10 cycles, denaturation at 95°C for 30 s, annealing at 55°C for 45 s, for 35 cycles.

[0018] The beneficial effects of adopting the above solution include: The present invention has the advantages of being fast, scalable, convenient for genotyping, high screening efficiency, and high accuracy.

[0019] A method for detecting the fire blight resistance trait of apples using a kit according to the present invention, the kit comprising a mixed primer; the mixed primer includes a forward specific primer F-resistant, a forward specific primer F-susceptible, and a common reverse primer R; in the mixed primer, the concentration of the forward specific primer F-resistant is 12 mM / L, the concentration of the forward specific primer F-susceptible is 12 mM / L, and the concentration of the common reverse primer R is 30 mM / L; the forward specific primer F-resistant includes the nucleotide sequence shown in SEQ ID NO:1; the forward specific primer F-susceptible includes the nucleotide sequence shown in SEQ ID NO:2; the common reverse primer R includes the nucleotide sequence shown in SEQ ID NO:3; the 5' end of the forward specific primer F-resistant includes a FAM fluorescent linker sequence, and the FAM fluorescent linker sequence includes the nucleotide sequence shown in SEQ ID NO:4; the 5' end of the forward specific primer F-susceptible includes a VIC fluorescent linker sequence, and the VIC fluorescent linker sequence includes the nucleotide sequence shown in SEQ ID NO:5;

[0020] The method for detecting the fire blight resistance trait of apples using the kit comprises the following steps:

[0021] (1) Extracting the genomic DNA of apple leaves;

[0022] (2) Performing PCR amplification, detecting the fluorescence signal during the amplification process using a fluorescence quantitative PCR instrument ABI-Q6 Flex for genotyping;

[0023] (3) Determining the fire blight resistance trait of apples.

[0024] Further, in step (2), the PCR amplification reaction system includes: 50 ng of genomic DNA of apple leaves, 2.5 μL of 2×KASP Master mix, 0.07 μL of the mixed primer, and made up to 5 μL with ultrapure water.

[0025] Further, in step (2), the PCR amplification program includes: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 30 s, annealing at 61°C for 45 s, with a decrease of 0.6°C for each cycle, for 10 cycles, denaturation at 95°C for 30 s, annealing at 55°C for 45 s, for 35 cycles.

[0026] Further, in step (3), if the result shows blue or green, it indicates that the test objects are all apple materials resistant to fire blight. Among them, if the result shows blue, it indicates that the test object is a homozygous fire blight-resistant material; if the result shows green, it indicates that the test object is a heterozygous fire blight-resistant material.

[0027] If the result shows red, it indicates that the test object is a fire blight-susceptible material.

[0028] If the result shows purple, it indicates that the test object is a material with genotyping failure.

[0029] Among the above, blue corresponds to the genotype CC, green corresponds to the genotype TC, and red corresponds to the genotype TT.

[0030] The above-mentioned kit may also include KASP working solution, mixed primers, and ultrapure water; the KASP working solution can be 2×KASP Master mix.

[0031] The beneficial effects of adopting the above solution include: The present invention has the advantages of being fast, scalable, convenient for genotyping, high screening efficiency, and high accuracy. Description of the Drawings

[0032] Figure 1 For the indoor inoculation identification and evaluation of fire blight in apple resource branches. Among them, the left figure is the resistant resource (Starkrimson), and the right figure is the susceptible resource (Golden Delicious).

[0033] Figure 2 It is the genotyping map of the test resources in Example 2. Detailed Embodiments

[0034] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0035] The present invention utilizes the phenotypic resistance to fire blight of the natural population of apple germplasm resources, combines the resequencing data for GWAS (Genome-Wide Association Study) analysis, detects the polymorphisms of genetic variations (markers) of multiple individuals at the whole-genome level through GWAS analysis to obtain genotypes, and then conducts statistical analysis at the population level on the genotypes and observable traits (i.e., phenotypes). Genetic variations (markers) most likely to affect the trait are screened out according to the statistic or significant p-value, and genes related to trait variations are mined. SNPs linked to apple fire blight resistance are obtained through the above method and can be used as an auxiliary selection for apple fire blight resistance screening.

[0036] The primer set for detecting the apple fire blight resistance trait includes a forward specific primer F-resistant, a forward specific primer F-susceptible, and a common reverse primer R;

[0037] The nucleotide sequence of the forward specific primer F-resistant is 5’-TCTGTAACTTCGTATCTGACTCTGAC-3’ (SEQ ID NO:1);

[0038] The nucleotide sequence of the forward specific primer F-susceptible is 5’-TCTGTAACTTCGTATCTGACTCTGAT-3’ (SEQ ID NO:2);

[0039] The nucleotide sequence of the common reverse primer R is 5’-TGTTTCATTTCAAGTAGATGCTTCCG-3’ (SEQ ID NO:3).

[0040] Furthermore, when synthesizing the primers, the 5’ end of the forward specific primer F-resistant can be added with the FAM fluorescent linker sequence, and the FAM fluorescent linker sequence is 5’-GAAGGTGACCAAGTTCATGCT-3’ (SEQ ID NO:4); the 5’ end of the forward specific primer F-susceptible can be added with the VIC fluorescent linker sequence, and the VIC fluorescent linker sequence is 5’-GAAGGTCGGAGTCAACGGATT-3’ (SEQ ID NO:5).

[0041] That is: the complete sequence of the forward specific primer F-resistant is 5’- GAAGGTGACCAAGTTCATGCT TCTGTAACTTCGTATCTGACTCTGAC-3’ (SEQ ID NO:6);

[0042] The complete sequence of the forward specific primer F-susceptible is: 5’- GAAGGTCGGAGTCAACGGATT TCTGTAACTTCGTATCTGACTCTGAT-3’ (SEQ ID NO:7).

[0043] The present invention provides a kit for detecting the fire blight resistance trait of apples, including the above primer set. For example, the kit may further include one or several of genomic DNA, KASP working solution, negative control, positive control, and water.

[0044] The present invention provides the application of one or several of the above primer sets and kits in the breeding of fire blight-resistant varieties.

[0045] The present invention provides a method for screening the fire blight resistance trait of apples, including the following steps:

[0046] (1) Detection: Perform PCR amplification and genotyping on the detection object (i.e., the genomic DNA of the leaves of the apple resources to be detected) using the above primer set and / or kit.

[0047] (2) Result judgment: If the result shows blue (CC) or green (TC), it indicates that the detection object is a fire blight-resistant apple material. Among them, if the result shows blue (CC), it indicates that the detection object is a homozygous fire blight-resistant material; if the result shows green (TC), it indicates that the detection object is a heterozygous fire blight-resistant material. If the result shows red (TT), it indicates that the detection object is a fire blight-susceptible material. If the result shows purple, it indicates that the detection object is a material with genotyping failure.

[0048] Furthermore, the PCR amplification reaction system is 5 μL, including: 50 ng of genomic DNA, 2.5 μL of 2×KASP Master mix, 0.07 μL of the mixed primer, and made up to 5 μL with ultrapure water.

[0049] Furthermore, the mixed primer includes a forward specific primer F-resistant, a forward specific primer F-susceptible, and a common reverse primer R. The concentrations of both the forward specific primer F-resistant and F-susceptible are 12 mM / L, and the concentration of the common reverse primer R is 30 mM / L.

[0050] Furthermore, the PCR amplification program includes: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 30 s, annealing at 61°C for 45 s, with a decrease of 0.6°C for each cycle, for 10 cycles, denaturation at 95°C for 30 s, annealing at 55°C for 45 s, for 35 cycles.

[0051] Furthermore, after the PCR amplification reaction, it is detected using a fluorescence quantitative PCR instrument AB-Q6 Flex.

[0052] The present invention also provides the application of the above primer set in screening fire blight-resistant materials of apple resources, which can quickly screen individuals resistant to fire blight in apple germplasm resources at the molecular level, with high accuracy, greatly improving the screening efficiency, and having the advantages of scalable operation and convenient genotyping.

[0053] In the present invention, unless otherwise specified, the experimental methods used are conventional experimental methods in the art. The materials, reagents, and instruments used are conventional materials, reagents, and instruments in the art, and can be obtained through commercial channels or prepared by conventional methods.

[0054] In the examples, 2×KASP Master mix was purchased from Shanghai LGC Company. The primers F-resistant, F-sensitive, and the common reverse primer R involved in the present invention were all synthesized by Shanghai Sangon Biotech Co., Ltd. The fire blight pathogen (Eriwinia amylovora) was a gift from Professor Hu Baishi of Nanjing Agricultural University. The public can obtain this strain only for non-commercial purposes to verify the experiments described in the examples of the present invention.

[0055] The following is an introduction through specific examples.

[0056] Example 1 Identification of Apple Resources Inoculated with Fire Blight Pathogen Indoors

[0057] The branches of 70 apple resources collected from the National Pear and Apple Germplasm Repository (Xingcheng) were subjected to indoor inoculation and identification evaluation of apple fire blight resistance.

[0058] The specific method for indoor inoculation and identification evaluation may include the following steps:

[0059] (1) Use the fire blight pathogen (Eriwinia amylovora) with the bacterial liquid numbered E.α6 for inoculation experiments at the Agricultural Science Institute of Bayingolin Mongol Autonomous Prefecture, Xinjiang. Inoculate the test strain on the nutrient agar supplemented with 5% (w) sucrose medium (NA + 5% sucrose) purchased from Shanghai Sangon Biotech Co., Ltd., and culture it at 28.5 °C for 36 h for activation. Pick a single colony into the NA + 5% sucrose culture solution, and culture it at 28.5 °C and 160 r·min -1 with shaking for 12 h until the bacterial liquid concentration reaches 1×10 7 CFD / mL, and the OD 600 is about 0.4.

[0060] The NA + 5% sucrose culture solution was purchased from Shanghai Sangon Biotech Co., Ltd., and no nutrient agar was added on the basis of the NA + 5% sucrose medium formula.

[0061] (2) Dip a toothpick into the bacterial liquid obtained in step (1), and use the toothpick to prick and inoculate the young branch on the main stem at the root of the second fully expanded leaf with obvious water droplet-like bacterial liquid on the toothpick.

[0062] (3) Place the inoculated young branches in 2% (mass percentage) sucrose water for culture, change the sucrose water every 24 h, and spray water mist to maintain humidity, and observe and record the length of the disease spots.

[0063] Disease index calculation: To reduce the influence of uneven lengths of young leaves and young branches, the lengths of the disease spots on the young leaves and young branches were normalized by dividing them by the longest disease spot length of each, and the normalized ratio was used as the grading value.

[0064] Grade 0: No lesion

[0065] Grade 1: The percentage of the disease spot length in the total length > 0 and ≤ 5%

[0066] Grade 3: The percentage of the disease spot length in the total length > 5% and ≤ 15%

[0067] Grade 5: The percentage of the disease spot length in the total length > 15% and ≤ 30%

[0068] Grade 7: The percentage of the disease spot length in the total length > 30% and ≤ 50%

[0069] Grade 9: The percentage of the disease spot length in the total length > 50%

[0070]

[0071] Subsequently, resistance evaluation was carried out. If the disease index was 0 - 5 (including the boundary values), it was considered highly resistant; if the disease index > 5 and ≤ 15, it was considered resistant; if the disease index > 15 and ≤ 30, it was considered moderately resistant; if the disease index > 30 and ≤ 60, it was considered moderately susceptible; if the disease index > 60 and ≤ 80, it was considered susceptible; if the disease index > 80, it was considered highly susceptible.

[0072] The results of the indoor inoculation identification and evaluation showed that among 70 apple resources, 32 resources had resistance to fire blight or above, and 38 resources were susceptible to fire blight ( Figure 2 and Table 1).

[0073] Table 1 Disease resistance evaluation and amplification of 70 apple resources

[0074]

[0075]

[0076]

[0077] Example 2 KASP marker genotyping screening of apple resources

[0078] The experimental materials were the same as those in Example 1. Leaves of the above 70 apple resources were collected, genomic DNA was extracted using a kit (Tiangen, DP321 - 03), PCR amplification was carried out, and a fluorescence quantitative PCR instrument ABI - Q6 Flex was used to directly detect the fluorescence signal during the amplification process for genotyping.

[0079] The PCR amplification reaction system includes: 50 ng of genomic DNA, 2.5 μL of 2×KASP Master mix, 0.07 μL of mixed primers, and ultrapure water is added to make up to 5 μL.

[0080] Among them, the mixed primers include the forward specific primer F-resistant, the forward specific primer F-sensitive, and the common reverse primer R; in the mixed primers, the concentration of the forward specific primer F-resistant is 12 mM / L, the concentration of the forward specific primer F-sensitive is 12 mM / L, and the concentration of the common reverse primer R is 30 mM / L.

[0081] The PCR amplification program includes: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 30 s, annealing at 61°C for 45 s, with a decrease of 0.6°C for each cycle, for 10 cycles, denaturation at 95°C for 30 s, annealing at 55°C for 45 s, for 35 cycles.

[0082] Experimental results: Genotypes were obtained for 69 out of 70 apple resources. Among them, there were 33 TT genotypes, 22 TC genotypes, and 14 CC genotypes. Combining the analysis with the above phenotypic results, it was found that the overall identification accuracy rate was 81.42%, the accuracy rate for resistant resources was 87.50%, and the accuracy rate for susceptible resources was 76.32% ( Figure 2 and Table 1).

[0083] The above describes the present invention and its implementation manners, and such description is not restrictive; generally speaking, if those of ordinary skill in the art are inspired by it and, without departing from the purpose of the present invention, design similar structural manners and embodiments to this technical solution without creative efforts, they shall fall within the protection scope of the present invention.

Claims

1. A method for detecting the fire blight resistance trait of apples using a kit, characterized in that, The kit includes a mixed primer; the mixed primer includes a forward specific primer F-anti, a forward specific primer F-sense, and a common reverse primer R; in the mixed primer, the concentration of the forward specific primer F-anti is 12 mM / L, the concentration of the forward specific primer F-sense is 12 mM / L, and the concentration of the common reverse primer R is 30 mM / L; the forward specific primer F-anti includes the nucleotide sequence shown in SEQ ID NO:1; the forward specific primer F-sense includes the nucleotide sequence shown in SEQ ID NO:2; the common reverse primer R includes the nucleotide sequence shown in SEQ ID NO:3; the 5' end of the forward specific primer F-anti includes a FAM fluorescence linker sequence, and the FAM fluorescence linker sequence includes the nucleotide sequence shown in SEQ ID NO:4; the 5' end of the forward specific primer F-sense includes a VIC fluorescence linker sequence, and the VIC fluorescence linker sequence includes the nucleotide sequence shown in SEQ ID NO:5; The method for detecting the fire blight resistance trait of apples using the kit includes the following steps: (1) Extract the genomic DNA of apple leaves; (2) PCR amplification, using a fluorescence quantitative PCR instrument ABI-Q6 Flex to detect fluorescence signals during the amplification process for genotyping; (3) Determine the fire blight resistance trait of apples.

2. The method according to claim 1, wherein In step (2), the PCR amplification reaction system includes: 50 ng of apple leaf genomic DNA, 2.5 μL of 2×KASP Master mix, 0.07 μL of the mixed primer, and ultra-pure water is added to make up to 5 μL.

3. The method according to claim 1 or 2, characterized in that In step (2), the PCR amplification program includes: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 30 s, annealing at 61°C for 45 s, with a decrease of 0.6°C for each cycle, for 10 cycles, denaturation at 95°C for 30 s, annealing at 55°C for 45 s, for 35 cycles.

4. The method according to claim 1 or 2, characterized in that, In step (3), if the result shows blue or green, it indicates that the test objects are all apple materials resistant to fire blight. Among them, if the result shows blue, it indicates that the test object is a homozygous fire blight-resistant material; if the result shows green, it indicates that the test object is a heterozygous fire blight-resistant material; If the result shows red, it indicates that the test object is a fire blight-susceptible material; If the result shows purple, it indicates that the test object is a material with failed genotyping; Among the above, blue corresponds to the genotype CC, green corresponds to the genotype TC, and red corresponds to the genotype TT.

Images