SSR core primer combination, kit and application for identifying camellia sinensis variety yue mian 5
By using SSR molecular marker technology and specific SSR core primer combinations, the problem of uncertainty in the identification of the tea variety Yueming No. 5 was solved, and efficient and accurate variety identification and detection were achieved.
Patent Information
- Application Number
- CN202510335954.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-21
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2045-03-21
AI Technical Summary
The existing methods for identifying the tea variety Yueming No. 5 are easily affected by the developmental stage, cultivation measures, the individual ability of the person identifying the variety, and the growth environment, resulting in high uncertainty in the identification results.
Using SSR molecular marker technology, five SSR core primer combinations (YM5.SSR-1L, YM5.SSR-1R, YM5.SSR-2L, YM5.SSR-2R, YM5.SSR-3L, and YM5.SSR-3R) were designed and used, combined with fluorescent reporter groups, and identified by PCR amplification and capillary electrophoresis.
It has enabled accurate identification of the tea variety Yueming No. 5, with reliable and intuitive results and high detection efficiency. It overcomes the uncertainty of external morphological identification, which is conducive to the promotion and protection of the variety.
Smart Images

Figure CN119913284B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of variety resource identification and germplasm innovation technology, and in particular to an SSR core primer combination, kit, and application for identifying the tea variety Yueming 5. Background Technology
[0002] Yueming No. 5 is a new tea variety with high theanine content, obtained through single-plant systematic selection from the Lingyun Baihao tea population in Guangxi. The dry matter of the steamed green tea sample (one bud and two leaves) from spring production contains 28.7% tea polyphenols, 8.7% amino acids (including 4.1% theanine), 3.7% soluble sugars, and 2.6% caffeine. It is suitable for making both black and white tea. The black tea produced has a rich, sweet and floral aroma, with a fresh and mellow taste; the white tea produced has a rich, downy floral aroma, with a fresh, mellow, and sweet taste. Theanine is an important flavor compound in tea, closely related to its freshness and sweetness. In addition, theanine has various physiological and health benefits, including sedation and calming effects. Selecting and promoting functional tea varieties with high theanine content is one of the important tasks of tea breeding in China.
[0003] In 2014, biochemical components of core tea germplasm resources in the Guangdong Tea Tree Resource Nursery were determined, and new functional tea varieties were bred. A new variety with high theanine content was selected from the introduced Guangxi Lingyun Baihao population and named Yueming No. 5. Cutting propagation was carried out in the same year. In 2015, a comparative trial was conducted in the nursery, using Danxia No. 1, a provincial-level superior variety selected from the Baihao tea population, as a control. From 2015 to 2017, a comprehensive evaluation of the tea's processing characteristics, agronomic traits, biological characteristics, and bud and leaf biochemical components (amino acids, theanine, tea polyphenols, caffeine, etc.) was conducted for three consecutive years. The comparative trial results showed that 'Yueming No. 5' had a higher theanine content than Danxia No. 1 and exhibited superior tea-making performance. Variety characteristics: The plant grows vigorously, is a small tree type, has a semi-open growth habit, and dense branching. Leaves are obliquely arranged, large-leaved, 16.2cm long and 4.9cm wide. Mature leaves are oblong-elliptic, green, slightly rolled back, with a raised surface, sharp and deep serrations, acuminate tip, and flat margin. New shoots and buds are green with dense pubescence and retain their tenderness well. The corolla is 3.7-4.1cm in diameter, with white petals. This is an early-maturing variety, harvested in early March, with 100 buds weighing 132.2g at the one-bud-three-leaf stage.
[0004] Currently, the identification of the Yueming No. 5 tea variety relies on the individual's understanding of Yueming No. 5 and its external morphological characteristics. The identification results are easily affected by factors such as the developmental stage, cultivation measures, the individual's ability, and the growth environment of Yueming No. 5, resulting in great uncertainty.
[0005] Molecular marker technology, with its high polymorphism, short testing cycle, and insensitivity to environmental influences, has become the future direction for variety identification and protection. Therefore, SSR molecular markers have good application prospects in variety specificity evaluation and protection. Summary of the Invention
[0006] To overcome the aforementioned defects and shortcomings in the existing technology, this invention provides an SSR core primer combination, kit, and application for identifying the tea variety Yueming 5.
[0007] The first objective of this invention is to provide an SSR core primer combination for identifying the tea variety Yueming No. 5.
[0008] The second objective of this invention is to provide the application of the above-mentioned SSR core primer combination in the preparation of identification products of the tea variety Yueming No. 5.
[0009] A third objective of this invention is to provide the application of a product containing the above-described SSR core primer combination in the identification of the tea variety Yueming No. 5.
[0010] The fourth objective of this invention is to provide a reagent kit for identifying the tea variety Yueming No. 5.
[0011] The fifth objective of this invention is to provide a method for identifying the tea tree variety Yueming No. 5.
[0012] To achieve the above objectives, this invention provides an SSR core primer combination for identifying the tea cultivar Yueming 5. The SSR core primer combination comprises SSR core primers with nucleotide sequences YM5.SSR-1L, YM5.SSR-1R, YM5.SSR-2L, YM5.SSR-2R, YM5.SSR-3L, and YM5.SSR-3R; wherein: the primer sequence for YM5.SSR-1L is: CCTTGAGAGGGCAAGCTATTG; YM5.SS Primer sequences for R-1R: TGAAGGATTTATGTGGGCAGC; Primer sequences for YM5.SSR-2L: CAGCTGACCCACCACCTG; Primer sequences for YM5.SSR-2R: GGGTAGTCATGGCGGCAG; Primer sequences for YM5.SSR-3L: ACCCCAACACCGGTCTCT; Primer sequences for YM5.SSR-3R: ACGAGGATCCACCCTACCT.
[0013] The 5' end of the SSR core primer shown in nucleotide sequence YM5.SSR-1L, the 5' end of the SSR core primer shown in nucleotide sequence YM5.SSR-2L, and / or the 5' end of the SSR core primer shown in nucleotide sequence YM5.SSR-3L are labeled with fluorescent reporter groups.
[0014] The fluorescent reporter group is FAM, HEX, TAMRA, or ROX.
[0015] The application of the aforementioned SSR core primer combination in the preparation of identification products for the tea variety Yueming No. 5.
[0016] The application of the product of the SSR core primer combination in the identification of the tea variety Yueming No. 5.
[0017] A kit for identifying the tea variety Yueming No. 5, comprising the SSR core primer combination as described in any one of claims 1 to 3.
[0018] The kit also contains HSTAq DNA polymerase, dNTPs, 10×Buffer, positive control reference, negative control reference, and ultrapure water.
[0019] A method for identifying the tea variety Yueming No. 5, using the SSR core primer combination as described in any one of claims 1 to 3 or the kit as described in any one of claims 6 to 7.
[0020] A method for identifying the tea tree variety Yueming No. 5 includes the following steps:
[0021] S1. Extract genomic DNA from the tea plant sample to be tested;
[0022] S2. Using the genomic DNA extracted in step S1 as a template, perform PCR amplification using any of the SSR core primer combinations described in claims 1 to 3;
[0023] S3. Genuine the PCR amplification products obtained in step S2, and perform band discrimination on the genotyping results:
[0024] The SSR core primers with nucleotide sequences YM5.SSR-1L and YM5.SSR-1R amplified two characteristic bands of 209bp and 233bp, respectively. The SSR core primers with nucleotide sequences YM5.SSR-2L and YM5.SSR-2R amplified two characteristic bands of 194bp and 200bp, respectively. The SSR core primers with nucleotide sequences YM5.SSR-3L and YM5.SSR-3R amplified only one characteristic band of 285bp. This indicates that the tea sample being tested is Yueming No. 5. The presence of other bands indicates that the tea sample being tested is not Yueming No. 5.
[0025] The typing method described in step S3 involves capillary electrophoresis of the PCR amplification products. The total PCR amplification reaction volume is 10 μL, comprising: 1 μL of 10×Buffer I, 0.8 μL of 2.5 mM dNTPs, 0.6 μL of 2.5 μM upstream primer, 0.6 μL of 2.5 μM downstream primer, 0.1 μL of TAKARA HSTaq, 1 μL of DNA, and ddH2O to bring the total to 10 μL. The PCR amplification reaction conditions are: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, repeated 35 times; and a final extension at 60℃ for 30 min.
[0026] Advantages and effects of the present invention:
[0027] This invention discloses an SSR core primer combination, kit, and application for identifying the tea variety Yueming 5. Utilizing SSR fluorescent labeling detection technology, this invention screens and obtains three pairs of SSR core primers, which can rapidly identify and detect Yueming 5 from other tea varieties. The SSR core primer combination disclosed in this invention enables accurate identification of Yueming 5, overcoming the uncertainty of identification based on external morphological characteristics. The results are reliable and intuitive, with high detection efficiency and simple operation, while also facilitating the promotion, utilization, and protection of the Yueming 5 variety. Attached Figure Description
[0028] Figure 1 The capillary electrophoresis bands of 16 tea varieties / lines were amplified using the specific SSR core primers YM5.SSR-1L and YM5.SSR-1R in Example 1.
[0029] Figure 2 The capillary electrophoresis bands of 16 tea varieties / lines were amplified using the specific SSR core primers YM5.SSR-2L and YM5.SSR-2R in Example 1.
[0030] Figure 3 The capillary electrophoresis bands of 16 tea varieties / lines were amplified using the specific SSR core primers YM5.SSR-3L and YM5.SSR-3R in Example 1.
[0031] Figure 4 The capillary electrophoresis bands of 25 tea varieties / lines were amplified using the specific SSR core primers YM5.SSR-1L and YM5.SSR-1R in Example 2.
[0032] Figure 5 The capillary electrophoresis bands of 25 tea varieties / lines were amplified using the specific SSR core primers YM5.SSR-2L and YM5.SSR-2R in Example 2.
[0033] Figure 6 The capillary electrophoresis bands of 25 tea varieties / lines were amplified using the specific SSR core primers YM5.SSR-3L and YM5.SSR-3R in Example 2. Detailed Implementation
[0034] The present invention will be further illustrated below with reference to specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field.
[0035] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.
[0036] Example 1: Screening and obtaining specific primer sequences for Yueming No. 5
[0037] I. Experimental Methods
[0038] 1. SSR primer design
[0039] The genome sequence of the tea variety Tieguanyin was searched using MISA software (https: / / www.tea-pangenome.cn / ), and SSR loci were found in the genome sequence. 200 pairs of SSR primers were designed in batches using Primer 5.0 and synthesized by Beijing Yuewei Gene Technology Co., Ltd.
[0040] 2. Extraction of DNA from tea cultivars
[0041] Sixteen tea tree varieties / lines with similar kinship and phenotypes, including Yueming No. 5, Lingyun Baimao No. 4, Lingyun Baimao No. 7, Lingyun Baimao No. 10, and Lingyun Baimao No. 11, were initially screened. The specific tea tree varieties / lines used in the initial screening are shown in Table 1 (taken from the Guangdong Tea Tree Germplasm Resource Bank).
[0042] Table 1. Sixteen tea varieties / lines used in the preliminary screening.
[0043]
[0044] DNA was extracted from 16 tea varieties / lines used for preliminary screening (Table 1). The specific steps for DNA extraction are as follows:
[0045] a. Take tea tree leaves, add liquid nitrogen and grind them thoroughly. Weigh out about 100mg of the ground powder.
[0046] b. Quickly add 400 μL of buffer GPS and 10 μL of LNase A to the ground powder, vortex quickly to mix, and then place the centrifuge tube in a 65°C water bath for 15 min. During the water bath, invert the centrifuge tube several times to mix the sample.
[0047] c. Add 100 μg buffer GPA, vortex for 1 min, centrifuge at 12000 rpm for 5 min, transfer the supernatant to the CS filter column, then centrifuge at 12000 rpm for 1 min, and transfer the filtrate to a new centrifuge tube.
[0048] d. Add an equal volume of anhydrous ethanol and mix thoroughly. At this point, flocculent precipitate may appear.
[0049] e. Transfer the solution and flocculent precipitate obtained in the previous step to the RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 into the collection tube.
[0050] f. Add 550 μL of protein removal solution RD to the RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 into the collection tube.
[0051] g. Add 700 μL of washing buffer PW to the RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 into the collection tube.
[0052] h. Repeat step g.
[0053] i. Place the RNase-Free adsorption column CR2 back into the collection tube, centrifuge at 12000 rpm for 2 min, discard the collection tube, and then transfer the RNase-Free adsorption column CR2 to a new centrifuge tube and air dry at room temperature for 5-10 min.
[0054] j. Add 50-100 μL of elution buffer TB to the RNase-Free adsorption column CR2, incubate at room temperature for 3-5 min, centrifuge at 12000 rpm for 2 min, and collect the solution into a centrifuge tube to obtain tea tree genomic DNA.
[0055] 3. PCR amplification
[0056] Using the tea plant genomic DNA extracted in step 2 above as a template, PCR amplification was performed using SSR fluorescent labeling detection technology. The primers included an upstream primer labeled with a fluorescent reporter group at its 5' end (the fluorescent reporter group can be FAM, HEX, TAMRA, or ROX; FAM fluorescent labeling was used in this invention) and a downstream primer. PCR amplification guided by the upstream primer labeled with the fluorescent reporter group at its 5' end produced a fluorescent PCR product.
[0057] The PCR amplification reaction consisted of a total volume of 10 μL, including: 1 μL of 10×Buffer I, 0.8 μL of 2.5 mM dNTPs, 0.6 μL of 2.5 μM upstream primer, 0.6 μL of 2.5 μM downstream primer, 0.1 μL of TAKARA HSTaq, 1 μL of DNA, and ddH2O to bring the total volume to 10 μL.
[0058] The PCR amplification reaction conditions were as follows: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles; and finally 60℃ extension for 30 min.
[0059] 4. Subtype detection
[0060] Capillary electrophoresis detection: Add 9 μL of a mixture of molecular weight internal standard and formamide (volume ratio of 0.5:8.5) and 1.0 μL of PCR product to each well of a 96-well plate; denature at 95℃ for 3 min, and detect the genotype using a 3730XL DNA analyzer.
[0061] 5. Data Analysis
[0062] The raw data files obtained from the 3730XL DNA analyzer were imported into the Genemapper ID 3.2 analysis software for band discrimination analysis.
[0063] II. Experimental Results
[0064] Three pairs of specific SSR core primers were selected from 200 pairs of SSR primers: YM5.SSR-1L and YM5.SSR-1R, YM5.SSR-2L and YM5.SSR-2R, and YM5.SSR-3L and YM5.SSR-3R. The primer sequences are shown in Table 2.
[0065] Table 2. Specific SSR core primer sequences
[0066]
[0067] The statistical results of capillary electrophoresis bands amplified by these 3 pairs of specific SSR core primers from 16 tea varieties / lines (Table 1) are shown in Table 3 and . Figures 1-3 As shown, the results indicate that Yueming No. 5 exhibits characteristic bands, specifically:
[0068] (1) The specific SSR core primers YM5.SSR-1L and YM5.SSR-1R amplified two characteristic bands of 209bp and 233bp respectively;
[0069] (2) The specific SSR core primers YM5.SSR-2L and YM5.SSR-2R amplified two characteristic bands of 194bp and 200bp respectively;
[0070] (3) The specific SSR core primers YM5.SSR-3L and YM5.SSR-3R only amplified a characteristic band of 285bp.
[0071] The above results indicate that the three pairs of specific SSR core primers can amplify characteristic bands for the tea variety Yueming 5, thus allowing Yueming 5 to be distinguished from 15 other related and phenotypic tea varieties / lines.
[0072] Table 3. Statistical analysis of capillary electrophoresis bands of 16 tea varieties / lines using 3 pairs of specific SSR core primers.
[0073]
[0074] Example 2
[0075] Further validation of 3 pairs of specific SSR core primers
[0076] I. Experimental Methods
[0077] The three pairs of specific SSR core primers for identifying Yueming No. 5, YM5.SSR-1L and YM5.SSR-1R, YM5.SSR-2L and YM5.SSR-2R, and YM5.SSR-3L and YM5.SSR-3R, obtained from the screening, were further validated. Twenty-four tea tree varieties currently promoted and applied in production were selected and simultaneously amplified and detected with Yueming No. 5. The specific 25 tea tree varieties are shown in Table 4.
[0078] Table 4. 25 Tea Varieties Currently Promoted and Used in Production
[0079]
[0080] The methods for extracting DNA from tea plant varieties, PCR amplification, typing detection, and data analysis were performed in accordance with Example 1.
[0081] II. Experimental Results
[0082] The statistical results of capillary electrophoresis bands amplified from 25 tea varieties using 3 pairs of specific SSR core primers (Table 4) are shown in Table 5. Figures 4-6 As shown, the results indicate that only Yueming No. 5 exhibited the characteristic bands, specifically:
[0083] (1) The specific SSR core primers YM5.SSR-1L and YM5.SSR-1R amplified two characteristic bands of 209bp and 233bp respectively;
[0084] (2) The specific SSR core primers YM5.SSR-2L and YM5.SSR-2R amplified two characteristic bands of 194bp and 200bp respectively;
[0085] (3) The specific SSR core primers YM5.SSR-3L and YM5.SSR-3R only amplified a characteristic band of 285bp.
[0086] The above results indicate that the three pairs of specific SSR core primers can amplify specific alleles for the tea variety Yueming No. 5, thus distinguishing Yueming No. 5 from the other 24 tea varieties currently being promoted and applied in production.
[0087] Table 5. Statistical analysis of capillary electrophoresis bands of 25 promoted and applied tea varieties.
[0088]
[0089] Example 3
[0090] A method for identifying Yueming No. 5 using a specific SSR core primer combination
[0091] 1. DNA was extracted from the tea cultivar Yueming No. 5 according to the method in Example 1;
[0092] 2. Using the DNA extracted in step 1 as a template, PCR amplification was performed using three pairs of specific SSR core primers: YM5.SSR-1L and YM5.SSR-1R, YM5.SSR-2L and YM5.SSR-2R, and YM5.SSR-3L and YM5.SSR-3R. The sequences of the three pairs of specific SSR core primers are as follows, wherein the 5' end of the upstream primer is labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA, or ROX; HEX fluorescent labeling is used in this invention):
[0093] YM5.SSR-1L:CCTTGAGAGGGCAAGCTATTG;
[0094] YM5.SSR-1R:TGAAGGATTTATGTGGGCAGC;
[0095] YM5.SSR-2L:CAGCTGACCACCACCTG;
[0096] YM5.SSR-2R: GGGTAGTCATGGCGGCAG;
[0097] YM5.SSR-3L:ACCCACACACCGGTCTCT;
[0098] YM5.SSR-3R: ACGAGGATCCACCCTACCT;
[0099] The PCR amplification method was performed according to Example 1:
[0100] The PCR products obtained in step 2 were subjected to genotyping and data analysis, and the genotyping and data analysis methods were performed in accordance with Example 1.
[0101] 4. Result Interpretation:
[0102] If the amplification products of the three pairs of specific SSR core primers show the following characteristic bands, it indicates that the tea variety being tested is Yueming No. 5; if the following characteristic bands do not appear, it indicates that the tea variety being tested is not Yueming No. 5:
[0103] (1) The specific SSR core primers YM5.SSR-1L and YM5.SSR-1R amplified two characteristic bands of 209bp and 233bp respectively;
[0104] (2) The specific SSR core primers YM5.SSR-2L and YM5.SSR-2R amplified two characteristic bands of 194bp and 200bp respectively;
[0105] (3) The specific SSR core primers YM5.SSR-3L and YM5.SSR-3R only amplified a characteristic band of 285bp.
[0106] Example 4
[0107] A reagent kit for identifying the tea variety Yueming No. 5
[0108] I. Composition
[0109] (1) Three pairs of specific SSR core primers, wherein the 5' end of the upstream primer is labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA or ROX, and HEX fluorescent labeling is used in this invention):
[0110] YM5.SSR-1L:CCTTGAGAGGGCAAGCTATTG;
[0111] YM5.SSR-1R:TGAAGGATTTATGTGGGCAGC;
[0112] YM5.SSR-2L:CAGCTGACCACCACCTG;
[0113] YM5.SSR-2R: GGGTAGTCATGGCGGCAG;
[0114] YM5.SSR-3L:ACCCACACACCGGTCTCT;
[0115] YM5.SSR-3R: ACGAGGATCCACCCTACCT;
[0116] (2) HSTaq DNA polymerase, dNTPs, 10×Buffer, positive control reference, negative control reference, ultrapure water.
[0117] II. Instructions for Use
[0118] The detection and result interpretation were performed according to the method in Example 3.
[0119] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. Identification of the SSR core primer combination for the tea variety Yueming 5, characterized in that, The SSR core primer set includes SSR core primers with nucleotide sequences YM5.SSR-1L, YM5.SSR-1R, YM5.SSR-2L, YM5.SSR-2R, YM5.SSR-3L, and YM5.SSR-3R; wherein: the primer sequence of YM5.SSR-1L is: CCTTTGAGAGGGCAAGCTATTG; the primer sequence of YM5.SSR-1R is: TGAAGGATTTATGTGGGCAGC; the primer sequence of YM5.SSR-2L is: CAGCTGACCCACCACCTG; the primer sequence of YM5.SSR-2R is: GGGTAGTCATGGCGGCAG; the primer sequence of YM5.SSR-3L is: ACCCCAACACCGGTCTCT; and the primer sequence of YM5.SSR-3R is: ACGAGGATCCACCCTACCT.
2. The SSR core primer combination according to claim 1, characterized in that, The 5' end of the SSR core primer shown in nucleotide sequence YM5.SSR-1L, the 5' end of the SSR core primer shown in nucleotide sequence YM5.SSR-2L, and / or the 5' end of the SSR core primer shown in nucleotide sequence YM5.SSR-3L are labeled with fluorescent reporter groups.
3. The SSR core primer combination according to claim 2, characterized in that, The fluorescent reporter group is FAM, HEX, TAMRA, or ROX.
4. The application of the SSR core primer combination according to any one of claims 1 to 3 in the preparation of identification products of the tea variety Yueming No.
5.
5. The application of a product containing any one of the SSR core primer combinations described in claims 1 to 3 in the identification of the tea variety Yueming No. 5, characterized in that, When the SSR core primers with nucleotide sequences YM5.SSR-1L and YM5.SSR-1R amplify two characteristic bands of 209bp and 233bp, and the SSR core primers with nucleotide sequences YM5.SSR-2L and YM5.SSR-2R amplify two characteristic bands of 194bp and 200bp, and the SSR core primers with nucleotide sequences YM5.SSR-3L and YM5.SSR-3R amplify only one characteristic band of 285bp, it indicates that the tea sample to be tested is Yueming No. 5; the appearance of other bands indicates that the tea sample to be tested is not Yueming No.
5.
6. A reagent kit for identifying the tea variety Yueming No. 5, characterized in that, It includes the SSR core primer combination as described in any one of claims 1 to 3.
7. The reagent kit according to claim 6, characterized in that, The kit also contains HSTAq DNA polymerase, dNTPs, 10×Buffer, positive control reference, negative control reference, and ultrapure water.
8. A method for identifying the tea tree variety Yueming No. 5, characterized in that, Identification was performed using any of the SSR core primer combinations described in claims 1-3 or any of the kits described in claims 6-7. If the SSR core primers with nucleotide sequences YM5.SSR-1L and YM5.SSR-1R amplified two characteristic bands of 209bp and 233bp, and the SSR core primers with nucleotide sequences YM5.SSR-2L and YM5.SSR-2R amplified two characteristic bands of 194bp and 200bp, and the SSR core primers with nucleotide sequences YM5.SSR-3L and YM5.SSR-3R amplified only one characteristic band of 285bp, then the tea sample to be tested was identified as Yueming No.
5. The presence of other bands indicated that the tea sample to be tested was not Yueming No.
5.
9. The method according to claim 8, characterized in that, Includes the following steps: S1. Extract genomic DNA from the tea plant sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, perform PCR amplification using any of the SSR core primer combinations described in claims 1 to 3; S3. The PCR amplification products obtained in step S2 are genotyped, and the genotype results are analyzed for band differentiation.
10. The method according to claim 9, characterized in that, The typing method described in step S3 is to perform capillary electrophoresis on the PCR amplification products; The PCR amplification reaction consisted of a total volume of 10 μL, including: 1 μL of 10×Buffer I, 0.8 μL of 2.5 mM dNTPs, 0.6 μL of 2.5 μM upstream primer, 0.6 μL of 2.5 μM downstream primer, 0.1 μL of TAKARA HSTaq, 1 μL of DNA, and ddH2O to bring the total to 10 μL. The PCR amplification conditions were: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles; and a final extension at 60℃ for 30 min.
Citation Information
Patent Citations
Core SNP marker developed based on KASP technology and used for tea tree variety identification
CN113832243A
SSR (Simple Sequence Repeat) core primer combination and kit for identifying tea tree variety 'Yinghong No.9' and application of SSR core primer combination and kit
CN118186143A