An SSR core primer combination, kit and application for identifying the tea tree variety "Danxia No. 2"
Through SSR core primer combination and PCR amplification technology, the uncertainty of tea tree variety identification was solved, and the rapid and accurate identification of "Danxia No. 2" tea tree variety was achieved, which improved the detection efficiency and reliability of the results.
Patent Information
- Application Number
- CN202510412816.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-03
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2045-04-03
AI Technical Summary
In the prior art, tea tree variety identification mainly relies on morphological characteristics and empirical judgment, and there is uncertainty, making it difficult to achieve rapid and effective variety identification.
Using SSR core primer combination, PCR amplification and capillary electrophoresis technology, a specific SSR core primer combination was screened for identification of tea tree variety "Danxia No. 2".
The rapid and accurate identification of the "Danxia No. 2" tea tree varieties has been achieved, the uncertainty based on morphological characteristics has been overcome, and the detection efficiency and reliability of the results have been improved.
Smart Images

Figure CN119913286B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of identification of variety resources and germplasm innovation, and particularly relates to an SSR core primer combination, a kit and an application for identifying the tea tree variety "Danxia No. 2". Background Art
[0002] "Danxia No. 2" is an excellent tea tree variety selected from the population of Renhua white-haired tea, belonging to small trees. Its characteristics are as follows: medium leaf type, semi-spreading tree posture, dense branching, neat germination, high density, plump buds and leaves, dark green leaf color, abundant pubescence, strong cold and drought resistance. The buds and leaves are rich in inclusions and are suitable for making famous and high-quality red and white teas. The made black tea has a beautiful appearance, covered with golden hairs, high and long-lasting floral fragrance, strong and refreshing taste, good aftertaste, and bright red soup color. The made white tea has a straight appearance, covered with white hairs, strong and mellow taste, and bright apricot-yellow soup color. It has strong stress resistance and wide adaptability.
[0003] Since tea trees are perennial woody plants with a long growth cycle, the current identification methods rely only on their morphological characteristics and the experience of the identifiers to judge and identify the authenticity of tea tree varieties, which are easily affected by the development stage, the identification ability of the identifiers, cultivation measures and environmental conditions, and there is great uncertainty. Therefore, in order to better manage the variety of "Danxia No. 2", it is particularly important to establish a set of rapid and effective identification methods for tea tree variety resources.
[0004] Molecular marker technology has become the future development direction of variety identification and protection due to its characteristics such as high polymorphism, short test period, and insensitivity to the environment. Among them, simple sequence repeat (SSR) has the advantages of codominance, good repeatability, easy detection, and simple operation. Therefore, SSR molecular markers have good application prospects in variety specificity evaluation and protection. Summary of the Invention
[0005] To overcome the above-mentioned defects and deficiencies in the prior art, the present invention provides an SSR core primer combination, a kit and an application for identifying the tea tree variety "Danxia No. 2".
[0006] The first object of the present invention is to provide an SSR core primer combination for identifying the tea tree variety "Danxia No. 2".
[0007] The second object of the present invention is to provide the application of the above SSR core primer combination in the preparation of an identification product for the tea tree variety "Danxia No. 2".
[0008] The third object of the present invention is to provide the application of a product containing the above SSR core primer combination in identifying the tea tree variety "Danxia No. 2".
[0009] The fourth object of the present invention is to provide a kit for identifying the tea tree variety "Danxia No. 2".
[0010] The fifth object of the present invention is to provide a method for identifying the tea tree variety "Danxia No. 2".
[0011] For achieving the above object, the present invention provides an SSR core primer combination for identifying the tea tree variety "Danxia No. 2", and the SSR core primer combination includes SSR core primers shown by nucleotide sequences of DX2.SSR-1-F, DX2.SSR-1-R, DX2.SSR-2-F, DX2.SSR-2-R, DX2.SSR-3-F and DX2.SSR-3-R; wherein: the primer sequence of DX2.SSR-1-F: GTCCCTACCAGAACCTTGGC; the primer sequence of DX2.SSR-1-R: GGAAGAGTGGTCTCCTGTGC; the primer sequence of DX2.SSR-2-F: TTCGCCATCATCACCACCAA; the primer sequence of DX2.SSR-2-R: TGAGCCTCTCCATTGCTTCG; the primer sequence of DX2.SSR-3-F: CGATCACCTCCTTCGTCACC; the primer sequence of DX2.SSR-3-R: TACCCCAAATCAGGCGATCC.
[0012] The 5' end of the SSR core primer shown by the nucleotide sequence DX2.SSR-1-F, the 5' end of the SSR core primer shown by the nucleotide sequence DX2.SSR-2-F and / or the 5' end of the SSR core primer shown by the nucleotide sequence DX2.SSR-3-F are labeled with a fluorescent reporter group.
[0013] The fluorescent reporter group is FAM, HEX, TAMRA or ROX.
[0014] Use of any of the above SSR core primer combinations in the preparation of an identification product for the tea tree variety "Danxia No. 2".
[0015] Use of a product containing any of the above SSR core primer combinations in identifying the tea tree variety "Danxia No. 2".
[0016] A kit for identifying the tea tree variety "Danxia No. 2", comprising any of the above SSR core primer combinations.
[0017] The kit further includes HSTaq DNA polymerase, dNTPs, 10× Buffer, positive control reference, negative control reference, and ultrapure water.
[0018] A method for identifying the tea tree variety "Danxia No. 2", which is identified by using any of the above SSR core primer combinations or kits.
[0019] The method described above includes the following steps:
[0020] S1. Extract the genomic DNA of the tea tree sample to be tested;
[0021] S2. Using the genomic DNA extracted in step S1 as a template, perform PCR amplification with any of the above SSR core primer combinations;
[0022] S3. Type the PCR amplification products obtained in step S2 and discriminate the bands of the typing results:
[0023] The SSR core primers with nucleotide sequences shown as DX2.SSR-1-F and DX2.SSR-1-R amplify two characteristic bands of 116 bp and 119 bp, the SSR core primers with nucleotide sequences shown as DX2.SSR-2-F and DX2.SSR-2-R amplify two characteristic bands of 187 bp and 193 bp, and the SSR core primers with nucleotide sequences shown as DX2.SSR-3-F and DX2.SSR-3-R only amplify one characteristic band of 145 bp, then it indicates that the tea tree sample to be tested is "Danxia No. 2"; the appearance of other bands indicates that the tea tree sample to be tested is not "Danxia No. 2".
[0024] The method for typing in step S3 described above is to perform capillary electrophoresis on the PCR amplification products; for PCR amplification, the total reaction system is 10 μL, including: 1 μL of 10×Buffer I, 0.8 μL of 2.5 mM dNTPs, 0.6 μL of 2.5 μM upstream primer, 0.6 μL of 2.5 μM downstream primer, 0.1 μL of TAKARA HSTaq, 1 μL of DNA, and ddH2O is added to make up 10 μL; the PCR amplification reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; finally, extension at 60°C for 30 min.
[0025] Advantages and effects of the present invention:
[0026] The present invention discloses an SSR core primer combination, kit and application for identifying the tea tree variety "Danxia No. 2". By using the SSR fluorescence labeling detection technology, the present invention screens out 3 pairs of SSR core primers, which can quickly identify and detect "Danxia No. 2" from other tea tree varieties. The SSR core primer combination disclosed by the present invention can identify the variety of "Danxia No. 2", overcoming the uncertainty of identification based on external morphological characteristics, with reliable and intuitive results, high detection efficiency, simple operation, and is also conducive to the popularization, utilization and protection of the variety of "Danxia No. 2". BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 Capillary electrophoresis bands of 23 tea tree varieties / lines amplified by the specific SSR core primers DX2.SSR-1-F and DX2.SSR-1-R in Example 1.
[0028] Figure 2 Capillary electrophoresis bands of 23 tea tree varieties / lines amplified by the specific SSR core primers DX2.SSR-2-F and DX2.SSR-2-R in Example 1.
[0029] Figure 3 Capillary electrophoresis bands of 23 tea tree varieties / lines amplified by the specific SSR core primers DX2.SSR-3-F and DX2.SSR-3-R in Example 1.
[0030] Figure 4 Capillary electrophoresis bands of 30 tea tree varieties / lines amplified by the specific SSR core primers DX2.SSR-1-F and DX2.SSR-1-R in Example 2.
[0031] Figure 5 Capillary electrophoresis bands of 30 tea tree varieties / lines amplified by the specific SSR core primers DX2.SSR-2-F and DX2.SSR-2-R in Example 2.
[0032] Figure 6 Capillary electrophoresis bands of 30 tea tree varieties / lines amplified by the specific SSR core primers DX2.SSR-3-F and DX2.SSR-3-R in Example 2. DETAILED DESCRIPTION OF THE INVENTION
[0033] The following specific examples are used to further illustrate the present invention, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the technical field.
[0034] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.
[0035] Example 1 Obtaining of Specific Primer Sequences of "Danxia 2"
[0036] I. Experimental Methods
[0037] 1. SSR Primer Design
[0038] The MISA software was used to retrieve the genomic sequences in the tea tree genomic database (http: / / tpia.teaplants.cn / ), and SSR loci in the genomic sequences were retrieved. 200 pairs of SSR primers were designed in batches using Primer 5.0, and the primers were synthesized by Beijing Yuewei Gene Technology Co., Ltd.
[0039] 2. Extraction of DNA from Tea Tree Varieties
[0040] Twenty-three tea tree varieties / lines with similar genetic relationships and phenotypes such as "Danxia 2", "Danxia 1", and "Danxia 4" were preliminarily screened. The specific tea tree varieties / lines used for the preliminary screening are shown in Table 1 (obtained from the Tea Tree Germplasm Resource Bank of Guangdong Province).
[0041] Table 1 Twenty-three Tea Tree Varieties / Lines Used for Preliminary Screening
[0042]
[0043] DNA was extracted from the 23 tea tree varieties / lines (Table 1) used for the preliminary screening. The specific steps for DNA extraction are as follows:
[0044] a) Add liquid nitrogen to tea tree leaves and grind them thoroughly, and weigh about 100 mg of the ground powder.
[0045] b) Quickly add 400 μL of buffer GPS and 10 μL of RNase A to the ground powder, quickly vortex and mix well, then place the centrifuge tube in a 65°C water bath for 15 min, and invert the centrifuge tube several times during the water bath to mix the samples.
[0046] c) Add 100 μL of buffer GPA, vortex for 1 min, centrifuge at 12000 rpm for 5 min, transfer the supernatant to the filter column CS, then centrifuge at 12000 rpm for 1 min, and transfer the filtrate to a new centrifuge tube.
[0047] d) Add an equal volume of absolute ethanol and mix well. At this time, flocculent precipitates may appear.
[0048] e) Transfer the solution and flocculent precipitates obtained in the previous step to the RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 min, pour out the waste liquid, and place the RNase-Free adsorption column CR2 in the collection tube.
[0049] f) Add 550 μL of deproteinization solution RD to the RNase-Free adsorption column CR2, centrifuge at 12,000 rpm for 1 min, pour off the waste liquid, and place the RNase-Free adsorption column CR2 into the collection tube.
[0050] g) Add 700 μL of washing solution PW to the RNase-Free adsorption column CR2, centrifuge at 12,000 rpm for 1 min, pour off the waste liquid, and place the RNase-Free adsorption column CR2 into the collection tube.
[0051] h) Repeat step g.
[0052] i) Place the RNase-Free adsorption column CR2 back into the collection tube, centrifuge at 12,000 rpm for 2 min, discard the collection tube, then transfer the RNase-Free adsorption column CR2 to a new centrifuge tube and air dry at room temperature for 5 - 10 min.
[0053] j) Add 50 - 100 μL of elution buffer TB to the RNase-Free adsorption column CR2, let it stand at room temperature for 3 - 5 min, centrifuge at 12,000 rpm for 2 min, and collect the solution into a centrifuge tube to obtain the tea tree genomic DNA.
[0054] 3. PCR Amplification
[0055] Using the tea tree genomic DNA extracted in step 2 above as a template, perform PCR amplification using the SSR fluorescence labeling detection technique. The primers include an upstream primer labeled with a fluorescent reporter group at the 5' end (the fluorescent reporter group is FAM, HEX, TAMRA, or ROX, and FAM fluorescence labeling is used in the present invention) and a downstream primer. PCR amplification guided by the upstream primer labeled with a fluorescent reporter group at the 5' end produces a fluorescent PCR product.
[0056] Among them, for PCR amplification, the total reaction system is 10 μL, including: 1 μL of 10×Buffer I, 0.8 μL of 2.5 mM dNTPs, 0.6 μL of 2.5 μM upstream primer, 0.6 μL of 2.5 μM downstream primer, 0.1 μL of TAKARA HSTaq, 1 μL of DNA, and ddH2O to make up to 10 μL.
[0057] The PCR amplification reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.
[0058] 4. Genotyping Detection
[0059] Capillary electrophoresis detection: Add 9 μL of the mixture of molecular weight internal standard and formamide (volume ratio 0.5:8.5) and 1.0 μL of PCR product to each well of a 96-well plate; denature at 95 °C for 3 min, and perform genotyping detection using a 3730XL DNA analyzer.
[0060] 5. Data analysis
[0061] Import the original data file obtained by 3730XL DNA analyzer into the analysis software genemapper ID 3.2 for band discrimination analysis.
[0062] II. Experimental results
[0063] Three pairs of specific SSR core primers were screened out from 200 pairs of SSR primers, namely DX2.SSR-1-F, DX2.SSR-1-R, DX2.SSR-2-F, DX2.SSR-2-R, DX2.SSR-3-F, and DX2.SSR-3-R. The primer sequences are shown in Table 2.
[0064] Table 2 Specific SSR core primer sequences
[0065]
[0066] The capillary electrophoresis band statistical results of these 3 pairs of specific SSR core primers amplifying 22 tea tree varieties / lines (Table 1) are shown in Table 3 and Figures 1 to 3 as follows. The results show that "Danxia No. 2" showed characteristic bands, specifically:
[0067] (1) The specific SSR core primers DX2.SSR-1-F and DX2.SSR-1-R amplified two characteristic bands of 116 bp and 119 bp;
[0068] (2) The specific SSR core primers DX2.SSR-2-F and DX2.SSR-2-R amplified two characteristic bands of 187 bp and 193 bp;
[0069] (3) The specific SSR core primers DX2.SSR-3-F and DX2.SSR-3-R amplified a characteristic band of 145 bp.
[0070] The above results indicate that the 3 pairs of specific SSR core primers can amplify characteristic bands for the tea tree variety "Danxia No. 2", so "Danxia No. 2" can be distinguished from the other 22 closely related and phenotypically similar tea tree varieties / lines.
[0071] Table 3 Capillary electrophoresis band statistics of 3 pairs of specific SSR core primers for 23 tea tree varieties / lines
[0072]
[0073] Example 2
[0074] Further verification of 3 pairs of specific SSR core primers
[0075] I. Experimental method
[0076] Further verification was carried out on the 3 pairs of specific SSR core primers DX2.SSR-1-F and DX2.SSR-1-R, DX2.SSR-2-F and DX2.SSR-2-R, DX2.SSR-3-F and DX2.SSR-3-R for identifying 'Danxia No. 2'. Twenty-nine tea tree varieties currently promoted and applied in production were selected for amplification detection simultaneously with 'Danxia No. 2'. The specific 30 tea tree varieties are shown in Table 4.
[0077] Table 4 30 tea tree varieties currently promoted and applied in production
[0078]
[0079] The methods for extracting DNA of tea tree varieties, PCR amplification, genotyping detection and data analysis were carried out in accordance with Example 1.
[0080] II. Experimental results
[0081] The capillary electrophoresis band statistical results of amplifying 30 tea tree varieties (Table 4) with 3 pairs of specific SSR core primers are shown in Table 5 and Figures 4 to 6 as follows. The results show that only 'Danxia No. 2' showed characteristic bands, specifically:
[0082] (1) The specific SSR core primers DX2.SSR-1-F and DX2.SSR-1-R amplified two characteristic bands of 116 bp and 119 bp;
[0083] (2) The specific SSR core primers DX2.SSR-2-F and DX2.SSR-2-R amplified two characteristic bands of 187 bp and 193 bp;
[0084] (3) The specific SSR core primers DX2.SSR-3-F and DX2.SSR-3-R amplified a characteristic band of 145 bp.
[0085] The above results show that the 3 pairs of specific SSR core primers can amplify specific allelic loci for the tea tree variety 'Danxia No. 2'. Therefore, 'Danxia No. 2' can be distinguished from the other 29 tea tree varieties currently promoted and applied in production.
[0086] Table 5 Statistical results of capillary electrophoresis bands of 30 promoted tea tree varieties
[0087]
[0088] Example 3
[0089] A method for identifying "Danxia No. 2" using a specific SSR core primer combination
[0090] 1. Extract the DNA of the tea cultivar "Danxia No. 2" according to the method of Example 1;
[0091] 2. Using the DNA extracted in step 1 as a template, perform PCR amplification with 3 pairs of specific SSR core primers DX2.SSR-1-F and DX2.SSR-1-R, DX2.SSR-2-F and DX2.SSR-2-R, DX2.SSR-3-F and DX2.SSR-3-R. The sequences of the 3 pairs of specific SSR core primers are as follows, where the 5' end of the upstream primer is labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA or ROX, and HEX fluorescence labeling is used in the present invention):
[0092] DX2.SSR-1-F: GTCCCTACCAGAACCTTGGC;
[0093] DX2.SSR-1-R: GGAAGAGTGGTCTCCTGTGC;
[0094] DX2.SSR-2-F: TTCGCCATCATCACCACCAA;
[0095] DX2.SSR-2-R: TGAGCCTCTCCATTGCTTCG;
[0096] DX2.SSR-3-F: CGATCACCTCCTTCGTCACC;
[0097] DX2.SSR-3-R: TACCCCAAATCAGGCGATCC.
[0098] 3. The PCR amplification method is carried out according to Example 1:
[0099] Perform genotyping detection and data analysis on the PCR products obtained in step 2. Both the genotyping detection and data analysis methods are carried out according to Example 1.
[0100] 4. Result interpretation:
[0101] If the amplification products of the 3 pairs of specific SSR core primers respectively show the following characteristic bands, it indicates that the tea cultivar to be tested is "Danxia No. 2"; if the following characteristic bands do not appear respectively, it indicates that the tea cultivar to be tested is not "Danxia No. 2":
[0102] (1) The specific SSR core primers DX2.SSR-1-F and DX2.SSR-1-R amplified two characteristic bands of 116 bp and 119 bp;
[0103] (2) The specific SSR core primers DX2.SSR-2-F and DX2.SSR-2-R amplified two characteristic bands of 187 bp and 193 bp;
[0104] (3) The specific SSR core primers DX2.SSR-3-F and DX2.SSR-3-R amplified a characteristic band of 145 bp.
[0105] Example 4
[0106] A kit for identifying the tea cultivar "Danxia No. 2"
[0107] I. Composition
[0108] (1) 3 pairs of specific SSR core primers, with the 5' ends of the upstream primers labeled with fluorescent reporter groups (the fluorescent reporter groups can be FAM, HEX, TAMRA or ROX, and HEX fluorescence labeling is used in the present invention):
[0109] DX2.SSR-1-F: GTCCCTACCAGAACCTTGGC;
[0110] DX2.SSR-1-R: GGAAGAGTGGTCTCCTGTGC;
[0111] DX2.SSR-2-F: TTCGCCATCATCACCACCAA;
[0112] DX2.SSR-2-R: TGAGCCTCTCCATTGCTTCG;
[0113] DX2.SSR-3-F: CGATCACCTCCTTCGTCACC;
[0114] DX2.SSR-3-R: TACCCCAAATCAGGCGATCC.
[0115] (2) HSTaq DNA polymerase, dNTPs, 10× Buffer, positive control reference, negative control reference, ultrapure water.
[0116] II. Usage method
[0117] Detect and interpret the results according to the method of Example 3.
[0118] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.
Claims
1. An SSR core primer combination for identifying the tea variety "Danxia No. 2", characterized in that: The SSR core primer combination comprises SSR core primers represented by nucleotide sequences of DX2.SSR-1-F, DX2.SSR-1-R, DX2.SSR-2-F, DX2.SSR-2-R, DX2.SSR-3-F and DX2.SSR-3-R; wherein: the primer sequence of DX2.SSR-1-F is GTCCCTACCAGAACCTTGGC; the primer sequence of DX2.SSR-1-R is GGAAGAGTGGTCTCCTGTGC; the primer sequence of DX2.SSR-2-F is TTCGCCATCATCACCACCAA; the primer sequence of DX2.SSR-2-R is TGAGCCTCTCCATTGCTTCG; the primer sequence of DX2.SSR-3-F is CGATCACCTCCTTCGTCACC; the primer sequence of DX2.SSR-3-R is TACCCCAAATCAGGCGATCC.
2. The SSR core primer combination according to claim 1, characterized in that The 5' end of the SSR core primer shown in the nucleotide sequence DX2.SSR-1-F, the 5' end of the SSR core primer shown in the nucleotide sequence DX2.SSR-2-F and / or the 5' end of the SSR core primer shown in the nucleotide sequence DX2.SSR-3-F is labeled with a fluorescent reporter group.
3. The SSR core primer combination according to claim 2, characterized in that The fluorescent reporter group is FAM, HEX, TAMRA or ROX.
4. Use of the SSR core primer combination described in any one of claims 1 to 3 in preparing an identification product of the tea variety "Danxia No. 2".
5. Use of a product comprising the SSR core primer combination according to any one of claims 1 to 3 in identifying the tea variety "Danxia No. 2", characterized in that: When the SSR core primers shown by the nucleotide sequences DX2.SSR-1-F and DX2.SSR-1-R amplify two characteristic bands of 116bp and 119bp, the SSR core primers shown by the nucleotide sequences DX2.SSR-2-F and DX2.SSR-2-R amplify two characteristic bands of 187bp and 193bp, and the SSR core primers shown by the nucleotide sequences DX2.SSR-3-F and DX2.SSR-3-R amplify only one characteristic band of 145bp, it indicates that the tea tree sample to be tested is "Danxia No. 2"; the appearance of other bands indicates that the tea tree sample to be tested is not "Danxia No. 2".
6. A kit for identifying the tea variety "Danxia No. 2", characterized in that: Comprising the SSR core primer combination described in any one of claims 1 to 3.
7. The kit according to claim 6, characterized in that The kit also includes HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference substance, a negative control reference substance and ultrapure water.
8. A method for identifying the tea variety "Danxia No. 2", characterized in that: Identification is performed using the SSR core primer combination described in any one of claims 1 to 3 or the kit described in any one of claims 6 to 7. When the SSR core primers represented by the nucleotide sequences DX2.SSR-1-F and DX2.SSR-1-R amplify two characteristic bands of 116 bp and 119 bp, the SSR core primers represented by the nucleotide sequences DX2.SSR-2-F and DX2.SSR-2-R amplify two characteristic bands of 187 bp and 193 bp, and the SSR core primers represented by the nucleotide sequences DX2.SSR-3-F and DX2.SSR-3-R amplify only one characteristic band of 145 bp, it indicates that the tea tree sample to be tested is "Danxia No. 2"; the appearance of other bands indicates that the tea tree sample to be tested is not "Danxia No. 2".
9. The method according to claim 8, characterized in that The following steps are involved: S1. Extracting genomic DNA from the tea tree sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, PCR amplification is performed using the SSR core primer combination described in any one of claims 1 to 3; S3. Typing the PCR amplification product obtained in step S2, and performing band identification on the typing results.
Citation Information
Patent Citations
SSR (Simple Sequence Repeat) core primer combination and kit for identifying tea tree variety 'swan goose 12' and application of SSR core primer combination and kit
CN119662900A
SSR (Simple Sequence Repeat) core primer combination for identifying tea tree variety Danxia No.1, kit and application
CN119685523A