SSR primer set for oat genetic diversity analysis and variety identification and its application

Abstract

The present invention belongs to the technical field of biological detection, and particularly relates to an SSR primer set for oat genetic diversity analysis and variety identification and its application. The present invention has developed 14 pairs of primers with strong polymorphism and stable amplification (the nucleotide sequences thereof are shown in SEQ ID NO.1-28) for oat genetic diversity analysis; by combining 4 pairs of the primers, DNA fingerprint codes of 48 oat varieties have been established, and the codes are unique; the 4 pairs of primers of the present invention can accurately and efficiently identify the authenticity of oat varieties, prevent fake and inferior varieties from entering the market, and at the same time provide a technical reference for the rational utilization of excellent germplasm in the process of oat variety breeding. Meanwhile, by analyzing the genetic relationships among various oat varieties, support can be provided for the protection and utilization of excellent oat germplasm resources.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and particularly relates to an SSR primer set for oat genetic diversity analysis and variety identification and its application. Background Art

[0002] Oat (Avena sativa L.) is an annual herbaceous plant of the genus Avena in the family Poaceae. Oat has an obvious effect of reducing low-density cholesterol and also has a certain effect of increasing serum high-density cholesterol, and the effect of reducing blood lipid is very obvious. Oat is also widely used in other industries, such as the cosmetics and pharmaceutical industries. Glucan has a good moisturizing effect and is often used as an ingredient in cosmetics. Oat is also a food base rich in fiber, and there are many types of processed foods. Oat food processing is mainly Western-style food, and there are few Chinese-style foods. In recent years, oats have been taken seriously due to their rich nutrition, and the breeding research of new oat varieties has developed rapidly. There is an urgent need for a method to quickly identify new oat varieties so as to confirm the varieties in time and implement protection.

[0003] SSR (Simple Sequence Repeats), also known as microsatellite DNA, is a DNA fragment composed of several (mostly 1-6) nucleotides tandemly repeated into dozens to hundreds of base sizes. During DNA replication, due to base mismatch, a change in one or several repeat units occurs, resulting in the generation of allelic variation. Since the two sides of SSR are conserved base sequences, primers can be designed for PCR amplification, and then the polymorphism information of these repeat sequences can be obtained for the differentiation of different species. SSR markers have the characteristics of rich polymorphism, co-dominant inheritance, good stability and repeatability, and simple and easy-to-operate technology, so they are widely used in the construction of fingerprint maps and the identification of variety authenticity.

[0004] At present, there is no report on an SSR primer set for identifying the authenticity of oat varieties and an SSR primer set for analyzing genetic diversity. Summary of the Invention

[0005] The purpose of the present invention is to overcome the disadvantages existing in the prior art and provide an SSR primer set for oat genetic diversity analysis and variety authenticity identification and its application. The 14 pairs of primers provided by the present invention can be used for variety authenticity identification and oat genetic diversity analysis. Combining 4 of the primers (primer YM-1 + primer YM-2 + primer YM-7 + primer YM-14) can quickly and accurately identify oat varieties, with short time consumption and low cost.

[0006] To achieve the above object, the present invention provides an SSR primer set for oat genetic diversity analysis. The primer set includes 14 pairs of primers, namely primer YM-1, primer YM-2, primer YM-3, primer YM-4, primer YM-5, primer YM-6, primer YM-7, primer YM-8, primer YM-9, primer YM-10, primer YM-11, primer YM-12, primer YM-13, and primer YM-14, and their nucleotide sequences are shown in SEQ ID NO.1-28.

[0007] The 14 pairs of primers of the present invention have the advantages of strong polymorphism and stable amplification.

[0008] The present invention also provides the application of the 14 pairs of primers in the genetic diversity analysis of oat varieties.

[0009] The present invention provides an SSR primer set for oat variety identification. The primer set includes 4 pairs of primers, namely primer YM-1, primer YM-2, primer YM-7, and primer YM-14, and their nucleotide sequences are as follows:

[0010] Primer YM-1:

[0011] F: AGCAGTACATACACATACACGC (SEQ ID No.1),

[0012] R: GGTAAAGCCTCTCACCAACC(SEQ ID No.2);

[0013] Primer YM-2:

[0014] F:CTCATGATGACGATGACGACG(SEQ ID No.3),

[0015] R:GGCTTCGTTCTCTTCCTTGG(SEQ ID No.4);

[0016] Primer YM-7:

[0017] F:GCAGATGATGACTACTTTCATGC(SEQ ID No.13),

[0018] R:CCACCATGGGATTAGTAGTTCC(SEQ ID No.14);

[0019] Primer YM-14:

[0020] F:GCAAGAGAGAGAGAGAGAGAGC(SEQ ID No.27),

[0021] R: TAAATAAAGAGGTGCCCATGGG (SEQ ID No.28).

[0022] The present invention also provides the application of the 4 pairs of primers in identifying oat varieties. The steps of the method for identifying oat varieties are as follows:

[0023] (1) Extract the DNA of the oat variety to be tested, and perform PCR amplification on the DNA of the oat variety to be tested with 4 pairs of primers (primer YM-1, primer YM-2, primer YM-7, and primer YM-14) respectively. The PCR reaction system is 50 μL, including 1 μL of genomic DNA, 2 μL of each upstream and downstream primer, 25 μL of 10×Es Taq MasterMix, and 20 μL of ddH2O. The PCR reaction procedure is: pre-denaturation at 94°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, cycle 30 times, and finally extension at 72°C for 10 min, and store at 4°C;

[0024] (2) According to the presence or absence and size of the bands detected by the Labchip macromolecule analysis system, compare the obtained fingerprint code of the oat variety to be tested with the characteristic fingerprint maps of 48 known oat varieties to determine the oat variety to be tested.

[0025] Compared with the prior art, the present invention has developed 14 pairs of primers with strong polymorphism and stable amplification for oat genetic diversity analysis, and developed 4 pairs of primers for the authenticity identification of oat varieties. The present invention combines the 4 pairs of primers to establish the DNA fingerprint codes of 48 oat varieties, and the codes are unique. The 4 pairs of primers of the present invention can be used to identify the authenticity of oat varieties, with high accuracy, short time consumption, high efficiency, and low cost, which can effectively prevent counterfeit and shoddy varieties from entering the market. At the same time, it also provides a technical reference for the rational utilization of excellent germplasms in the process of oat variety breeding. At the same time, by analyzing the genetic relationship between different oat varieties, it can provide support for the protection and utilization of excellent oat germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is the clustering diagram of 48 oat germplasm resources related to the present invention.

[0027] Figure 2 It is the result of amplifying 48 oat samples with the polymorphic primer YM-1 related to the present invention.

[0028] Figure 3 It is the LabChip macromolecule electrophoresis detection peak diagram obtained by amplifying the Linna material with the primer YM-1.

[0029] Figure 4 It is the LabChip macromolecule electrophoresis detection peak diagram obtained by amplifying the Meida material with the primer YM-1.

[0030] Figure 5 The LabChip macromolecule electrophoresis detection peak diagram amplified with primer YM-1 using the model material.

[0031] Figure 6 The LabChip macromolecule electrophoresis detection peak diagram amplified with primer YM-1 using the Aivo material. Detailed implementation manners

[0032] The present invention will be further described in detail below through specific embodiments in conjunction with the accompanying drawings.

[0033] Example 1: Primer set for oat genetic diversity analysis

[0034] 1. Test materials

[0035] The 48 oat varieties selected in the present invention are all taken from the oat germplasm resource nursery of Mengcao Ecological Environment (Group) Co., Ltd. in Hohhot, Inner Mongolia Autonomous Region. The basic information of the varieties is shown in Table 1.

[0036] Table 1 Oat germplasm resource information

[0037]

[0038]

[0039] 2. Genomic DNA extraction

[0040] For the above 48 oats, 24 plants were randomly selected from each variety for leaf DNA extraction, and the DNA of the 24 plants was mixed as the DNA sample of this variety. Specifically: Weigh 100 mg of leaf samples, and use the DNA extraction kit (NuClean Plant Genomic DNA Kit) of ComWin Biotech Co., Ltd. to extract genomic DNA. Use 1% agarose gel electrophoresis and a nucleic acid protein analyzer to measure the quality and concentration of DNA, and dilute the qualified DNA samples to 30 ng·µL -1 ; Mix the leaf DNA of 24 plants equally, and then dilute it to 30 ng·µL -1 , as the DNA sample of this variety.

[0041] 3. SSR primer design and screening

[0042] (1) Primer design

[0043] Based on the published genomic sequence information of hexaploid oat "OT3098" (Index of / pub / plants / release-57 / gff3 / avena_sativa_ot3098 (ebi.ac.uk)), the microsatellite search software krait was used to search for the whole-genome microsatellite sequences. The microsatellite search parameters were set as follows: mononucleotide repeat 10 times; the minimum number of dinucleotide and trinucleotide repeats was 6 times and 5 times respectively; the minimum number of tetranucleotide and pentanucleotide repeats was 5 times; the minimum number of hexanucleotide repeats was 5 times. A total of 765,514 microsatellite sequences were detected from the oat genome.

[0044] According to the analysis results of SSR loci in the oat genome, SSR loci located on different chromosomes and different nucleotide types were randomly selected, and the built-in Primer Premier 3.0 in the krait software was used to batch-design SSR primers. The primer design parameters were set as follows: primer length 18 - 27 bp, amplified product length 150 - 300 bp, GC content between 40% - 60%, annealing temperature (Tm value) between 55 - 63 °C. 40 pairs of primers were randomly selected and synthesized by Shanghai Sangon Biotech Co., Ltd.

[0045] (2)Primer screening

[0046] According to the 40 pairs of synthesized primers, 6 oat DNA samples were randomly selected (here, the genomic DNA of oat varieties numbered 1 - 6 was selected) for PCR amplification. The number of samples was set to 24, and the PCR reaction system was 50 µL, including 1 µL of genomic DNA, 2 µL of each upstream and downstream primer, 25 µL of 10×Es Taq MasterMix, and 20 µL of ddH2O. The PCR reaction program was: pre-denaturation at 94 °C for 3 min, denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 1 min, 30 cycles, and finally extension at 72 °C for 10 min, and preservation at 4 °C; the PCR products were electrophoresed through a biomacromolecule analyzer (Lab-Chip GX) to detect the presence and size of the bands, and primer sequences with more than 2 alleles, fragment size greater than 2 bp between different alleles, clear electrophoresis bands, good reproducibility, and high polymorphism were screened. A total of 14 pairs of primers were screened out. The primer sequences are shown in Table 2. A total of 116 allelic loci were detected from the 14 pairs of primers, and on average, each pair of primers could detect 8.28 allelic loci. Among them, the primers with the most loci were YM-6 and YM-8, with 13 loci, and the primers with the fewest loci were YM-10 and YM-13, with 3 polymorphic loci, and the PIC index was between 0.405 - 0.877.

[0047] Table 2 Information of 14 pairs of SSR primers

[0048]

[0049]

[0050] (3) Genetic Diversity Analysis of Oats Based on SSR Technology

[0051] Forty-eight oat varieties were subjected to PCR amplification using the 14 primer pairs in Table 2. The PCR reaction system and PCR reaction program were the same as above. Based on the genetic distances among the 48 materials, UPG-MA (unweighted pair group method with arithmetic mean) in DPS7.05 software was used for cluster analysis, and the effective number of alleles, Nei's gene diversity index, and Shannon information index were calculated using popgene32 software, and the primer PIC index was calculated using PIC software. The results are shown in Table 3.

[0052] The calculation results of the polymorphic band ratio (Table 3) showed that the average polymorphic band ratio of the 14 primer pairs amplifying 48 samples of oats was 95.67%. According to the calculation results of Nei's gene diversity index and Shannon information index, the total genetic diversities of oats were 0.2234 and 0.3824, respectively. The Nei's gene diversity index (H) of the 14 primer pairs amplifying 48 samples of oats ranged from 0.1347 to 0.3878, with an average of 0.2237; the Shannon information index (I) ranged from 0.1679 to 0.6400, with an average of 0.3672, and the effective number of alleles (Ne) ranged from 1.0834 to 1.8807. Among the 14 primer pairs, the Ne (1.8807), H (0.4559), and I (0.6400) of primer YM10 were at relatively high levels. In summary, the genetic diversity of the 48 oat varieties was at a medium level, and the primer polymorphism was good.

[0053] Table 3 Analysis of Genetic Diversity Parameters of 48 Oat Materials

[0054]

[0055] (4) Cluster Analysis

[0056] Based on the UPGMA cluster analysis of 48 oat varieties ( Figure 1 ), the genetic relationships among the 48 oat varieties were shown, and the 48 oat varieties exhibited relatively high genetic diversity.

[0057] Example 2: Primer Sets for Oat Variety Identification

[0058] 1. Primer Combinations

[0059] The present invention combines 14 pairs of primers in Example 1 to provide a set of 4 pairs of SSR primers for distinguishing oat varieties (primer YM-1 + primer YM-2 + primer YM-7 + primer YM-14). The nucleotide sequences of the forward and reverse primers of the 4 pairs of oat SSR primers are shown in Table 4. The number of polymorphic sites of primer YM-1 is 7, the number of polymorphic sites of primer YM-2 is 5, the number of polymorphic sites of primer YM-7 is 7, and the number of polymorphic sites of primer YM-14 is 9.

[0060] Table 4 SSR primer combinations for identifying oat varieties

[0061]

[0062] 2. Construction of oat fingerprint map

[0063] Use the 4 pairs of primers in Table 4 to perform PCR detection on 48 oat varieties (Table 1). The PCR reaction system and PCR reaction program are the same as in Example 1. Interpret the electrophoresis results of the biomacromolecule analyzer (Lab-Chip GX). Each pair of primers can produce clear bands for the tested oat samples. For example, Figure 2 is the electrophoresis result of primer YM-1, showing polymorphism among different tested samples and can be used for variety discrimination. After statistics, all varieties can be distinguished by these 4 pairs of primers (primer YM-1 + primer YM-2 + primer YM-7 + primer YM-14). The present invention constructs the fingerprint map of its varieties. According to the presence or absence and size of the bands detected by the Labchip macromolecule analysis system, and using the assignment method, assign "1" to the samples with bands, "0" to the samples without bands, and "-" to the missing values. Finally, a "0-1" matrix is formed. Generate a 0-1 matrix according to the loci and band sizes, and thus obtain the DNA fingerprint codes of 48 oat varieties represented by 0-1. Each oat variety has a fingerprint code containing 4 locus information, which is unique. Each fingerprint code can be used as an identifier for a variety. Figures 3 - 6The LabChip macromolecule electrophoresis detection peak map obtained by amplifying four oat varieties, namely Linna, Meida, Kaimo, and Aivo, with primer YM-1. Table 5 shows the DNA fingerprint map information of 10 oat varieties at 4 amplification sites. Taking primer YM-1 as an example, its DNA fingerprint information consists of seven digits, indicating that the number of alleles amplified by YM-1 on 48 oats is 7, and the fragment sizes are 131, 134, 138, 150, 160, 163, and 166 respectively. The fingerprint information of Bayou / YM-1 is 1100001, indicating that this primer can amplify fragments with band sizes of 131, 134, and 166 on the Bayou variety; the alleles amplified by YM-2 are 5, and the fragment sizes are 119, 121, 123, 125, and 154 respectively; the alleles amplified by YM-7 are 7, and the fragment sizes are 170, 172, 174, 176, 178, 180, and 184 respectively; the alleles amplified by YM-14 are 9, and the fragment sizes are 98, 105, 114, 122, 127, 134, 138, 145, and 158 respectively; the fingerprint information of Bayou / YM-2 is 01001, indicating that this primer can amplify fragments with band sizes of 121 and 154 on the Bayou variety; the fingerprint information of Bayou / YM-7 is 0100000, indicating that this primer can amplify a fragment with a band size of 172 on the Bayou variety; the fingerprint information of Bayou / YM-14 is 111010100, indicating that this primer can amplify fragments with band sizes of 98, 105, 114, 122, and 134 on the Bayou variety; the fingerprint information of Meida / YM-1 is 0000001, indicating that this primer can amplify a fragment with a band size of 166 on the Bayou variety; the fingerprint information of Meida / YM-2 is 10011, indicating that this primer can amplify fragments with band sizes of 119, 125, and 154 on the Bayou variety; and so on for other fingerprint information.

[0064] According to this method, a "0-1" array DNA fingerprint map library of 48 oat varieties at 4 amplification sites was finally constructed, as shown in Table 6 for details.

[0065] Table 5 DNA fingerprint map information of 10 oat varieties at 4 amplification sites

[0066]

[0067] Table 6 Fingerprint codes of 48 oat varieties

[0068]

[0069]

[0070]

[0071]

[0072] As can be seen from Table 6, the fingerprint codes of 48 oat varieties are different from each other and are unique, indicating that 4 pairs of primers can be used to distinguish the above 48 oat varieties.

[0073] Example 3: Method for Identifying Oat Varieties

[0074] 1. Extract the DNA of the oat variety to be tested, and perform PCR amplification on the DNA of the oat variety to be tested with the 4 pairs of primers for constructing fingerprint codes in Example 2; the PCR reaction system is 50 µL, including 1 µL of genomic DNA, 2 µL of each of the upstream and downstream primers, 25 µL of 10×Es Taq MasterMix, and 20 µL of ddH2O. The PCR reaction procedure is: pre-denaturation at 94°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, cycle 30 times, finally extension at 72°C for 10 min, and preservation at 4°C.

[0075] 2. According to the presence or absence and size of the detected bands by the Labchip macromolecule analysis system, compare the obtained fingerprint code of the oat variety to be tested with the characteristic fingerprint maps of the above 48 oat varieties to determine the oat variety to be tested.

Claims

1. An SSR primer set for oat genetic diversity analysis, characterized in that: The primer set includes 14 pairs of primers, namely primer YM-1, primer YM-2, primer YM-3, primer YM-4, primer YM-5, primer YM-6, primer YM-7, primer YM-8, primer YM-9, primer YM-10, primer YM-11, primer YM-12, primer YM-13 and primer YM-14, and their nucleotide sequences are shown in SEQ ID NO.1-28.

2. An SSR primer set for oat variety identification, characterized in that: The primer set includes 4 pairs of primers, namely primer YM-1, primer YM-2, primer YM-7 and primer YM-14, and their nucleotide sequences are as follows: Primer YM-1: F: AGCAGTACATACACATACACGC, R: GGTAAAGCCTCTCACCAACC; Primer YM-2: F:CTCATGATGACGATGACGACG, R:GGCTTCGTTCTCTTCTCTGG; Primer YM-7: F:GCAGATGATGACTACTTTCATGC, R:CCACCATGGGATTAGTAGTTCC; Primer YM-14: F:GCAAGAGAGAGAGAGAGAGAGAGC, R:TAAATAAAGAGGTGCCCATGGG.

3. The use of the four pairs of primers according to claim 2 in identifying oat varieties, characterized in that: The oat varieties are Bayou, Linna, Sweet Oats, Meida, Kaimo, Aiwo, Baishi, Aibo, Furuizhi, Fuxing, Sun God, Leader, Qinghai 444, Mengshiyan No. 1, Qingyin No. 2, Mengshiyan No. 6, Baiyan No. 7, Arshan, Qingyin No. 1, Oats No. 10, Must, Mengnong Dayan No. 1, Longyan No. 1, Bayou No. 18, ZX-1129, Bayan No. 7, ZX-45 02, Longyan No. 4, Tianyan No. 2, Wuzhai Sanfensan, Bayou No. 14, Beile, Longyan No. 3, Big Oatmeal, 261, Baiyan No. 17, Baiyan No. 19, Baiyan No. 21, Wuyan No. 3, ZX-8242, Peel Oats P-4239-2212201709, Mufeng, Bayou No. 20, Bayou No. 8, Jiayan No. 2, Caoyou No. 1, Mengyan No. 3 and ZX-1187.

4. The use of the four pairs of primers in identifying oat varieties according to claim 3, characterized in that: The steps of the method for identifying oat varieties are as follows: (1) Extracting DNA of the oat variety to be tested, and using primers YM-1, YM-2, YM-7, and YM-14 to perform PCR amplification on the DNA of the oat variety to be tested, respectively; (2) Based on the presence and size of the detection bands detected by the Labchip macromolecular analysis system, the obtained fingerprint code of the oat variety to be tested is compared with the characteristic fingerprint maps of known oat varieties to determine the oat variety to be tested.

5. The use of the four pairs of primers according to claim 4 in identifying oat varieties, characterized in that: The PCR reaction system was 50 µL, including 1 µL of genomic DNA, 2 µL of upstream and downstream primers, 25 µL of 10×Es Taq MasterMix, and 20 µL of ddH2O. The PCR reaction program was as follows: pre-denaturation at 94°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 30 cycles, and finally extension at 72°C for 10 min, and storage at 4°C.

Images