Fusobacterium nucleatum for treating acne

Abstract

The present invention provides fusobacterium nucleatum, or a lysate thereof, or a culture supernatant thereof for the prevention and / or treatment of bacterial infections. The invention also provides a pharmaceutical composition and a cosmetic composition containing the fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof. And a non-therapeutic use of fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof as an antibacterial agent.

Description

[0001] This application claims the benefit of European patent application EP22382821.1 filed on September 2, 2022. Technical Field

[0002] The present invention belongs to the field of medicine, in particular to the field of treating bacterial infections. The composition of the present invention is particularly useful for treating infections associated with Propionibacterium acnes, in particular acne vulgaris. Background Art

[0003] Cutibacterium acnes, formerly known as Propionibacterium acnes, is a Gram-positive bacterium that forms part of the normal microbiota of the skin, oral cavity, large intestine, conjunctiva and external auditory canal.

[0004] Propionibacterium acnes is also associated with pathological conditions such as acne vulgaris (acne) and is an important opportunistic pathogen. In this regard, Propionibacterium acnes has been described as playing a role in a variety of infections, such as dental infections, endocarditis, joint infections, central nervous system infections, eye infections, and sepsis. It is noteworthy that Propionibacterium acnes is known to cause a variety of postoperative and device-related infections, such as infections related to joint prostheses and artificial heart valves.

[0005] Acne is one of the most prevalent skin diseases and it usually affects young people. Almost 80% of adolescents suffer from acne. Acne is characterized by an overgrowth of Propionibacterium acnes, increased sebum secretion and abnormal growth of the epidermis and hair follicles. Acne causes significant problems because the resulting skin appearance can lead to anxiety, decreased self-esteem and, in extreme cases, depression.

[0006] Infections caused by P. acnes, including acne, are typically treated with antibiotics, which, while generally safe, often produce side effects, including nausea, fatigue, dizziness, vomiting, and photosensitivity. Equally important, the global prevalence of antibiotic-resistant P. acnes is increasing, resulting in reduced efficacy of current anti-P. acnes treatments.

[0007] Therefore, despite the many efforts made to date, there remains a need for new treatments for bacterial infections, particularly those associated with P. acnes, that are effective and do not cause undesirable secondary effects. Summary of the invention

[0008] The present inventors have unexpectedly discovered that Fusobacterium nucleatum produces extracellular metabolites that have significant antibacterial activity.

[0009] As shown in the examples below, Fusobacterium nucleatum cells or their culture supernatants have the ability to significantly inhibit bacterial growth, particularly the growth of Propionibacterium acnes, an important opportunistic bacterium that causes a range of infections. Importantly, Propionibacterium acnes is one of the causative agents of acne vulgaris, one of the most common skin diseases.

[0010] The following examples show that the antibacterial effect of Fusobacterium nucleatum is stronger than that of known probiotic bacterial species such as Bifidobacterium longum, Lactobacillus plantarum, Streptococcus salivarius, Lactobacillus rhamnosus (see Figure 3 ). In addition, after freeze-drying the supernatant, the inhibitory activity of Fusobacterium nucleatum was still maintained, which makes it highly suitable for long-term storage and facilitates its handling and use ( Figure 4 ).

[0011] Furthermore, the present inventors have found that the bacteriostatic capacity of Fusobacterium nucleatum is highly specific to Propionibacterium acnes, as it does not affect the growth of other species, in particular species that form the normal microbiota of the skin, such as Staphylococcus epidermidis (see Figure 2 ). Thus, in contrast to known antibacterial agents that also alter the beneficial microflora of the body, the present invention provides a treatment for bacterial infections that is effective and has reduced secondary effects. This is particularly important for anti-acne treatments, most of which currently cause important undesirable effects on the skin.

[0012] Advantageously, the antibacterial effects of Fusobacterium nucleatum can also be achieved via its cell-free supernatant, thereby reducing any risks associated with the use of live bacterial cells.

[0013] In summary, the present invention represents a significant advance in the field of antibacterial agents and treatment of bacterial infections.

[0014] Therefore, in a first aspect, the present invention provides Fusobacterium nucleatum, or a lysate thereof, or a culture supernatant thereof, for use in preventing and / or treating bacterial infections, particularly bacterial infections caused by or associated with Propionibacterium acnes.

[0015] This aspect can also be expressed as the use of Fusobacterium nucleatum, or its lysate, or its culture supernatant for the manufacture of a medicament for treating or preventing bacterial infection. This aspect can also be expressed as a method for treating or preventing bacterial infection, the method comprising administering a therapeutically effective amount of Fusobacterium nucleatum, or its lysate, or its culture supernatant and a pharmaceutically acceptable excipient or carrier to a subject in need.

[0016] In a second aspect, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof, and at least one pharmaceutically acceptable excipient and / or carrier.

[0017] In a third aspect, the present invention provides a pharmaceutical composition as defined in the second aspect for use as a medicament.

[0018] In a fourth aspect, the present invention provides a pharmaceutical composition as defined in the second aspect for use in preventing and / or treating bacterial infections, in particular bacterial infections caused by or associated with Propionibacterium acnes.

[0019] Non-pathogenic growth of Propionibacterium species has also been associated with cosmetic problems such as body odor.

[0020] Therefore, in a fifth aspect, the present invention provides a cosmetic composition comprising a cosmetically effective amount of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof, and at least one cosmetically acceptable excipient and / or carrier.

[0021] In a sixth aspect, the present invention provides a non-therapeutic use of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof in cosmetics.

[0022] In addition to therapeutics, inhibition of bacterial growth by Fusobacterium nucleatum also opens a window in the industrial field. It is known that Propionibacterium acnes can form biofilms, and bacterial biofilms can form on many surfaces, especially inanimate surfaces. In addition, Propionibacterium acnes has also been found to live as a plant endophyte.

[0023] Therefore, in a seventh aspect, the present invention provides a non-therapeutic use of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof as an antibacterial agent. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1Pictures of inhibition zones produced by the indicated bacteria (P. acnes or Fusobacterium nucleatum) on P. acnes cultures are shown. P. acnes were embedded in BMSA plates as described in the examples below. 10 μl of the indicated Fusobacterium nucleatum at a concentration of 50 OD / ml were spotted on the plates and incubated at 37°C in anaerobic conditions for 2 to 3 days. The dark area around Fusobacterium nucleatum corresponds to the P. acnes growth inhibition zone.

[0025] Figure 2 Pictures of inhibition zones generated by Fusobacterium nucleatum cells, reconstituted freeze-dried Fusobacterium nucleatum supernatant (SN), or control bacteria (P. acnes on P. acnes culture, E. coli on E. coli culture, E. faecalis on E. faecalis culture, and S. epidermidis on S. epidermidis culture) on the indicated cultures are shown. The dark area around the spotted Fusobacterium nucleatum cells or SN corresponds to the P. acnes growth inhibition zone.

[0026] Figure 3 A picture showing the inhibition zone produced by the indicated probiotics on a culture of P. acnes. The probiotic species were grown in MRS and 10 μl were spotted on DMSA plates containing P. acnes. The plates were incubated at 37°C in anaerobic conditions for 2 to 3 days. The abbreviations are Bifidobacterium longum, Lactobacillus plantarum, Streptococcus salivarius, Lactobacillus rhamnosus and Lactobacillus reuteri. The dark area around the spotted Fusobacterium nucleatum corresponds to the inhibition zone of P. acnes growth.

[0027] Figure 4 Pictures of inhibition zones produced by indicated bacterial cells (C) or reconstituted freeze-dried supernatants (SN) on P. acnes cultures are shown. Fusobacterium nucleatum and P. acnes (as control species) were grown in liquid BM. The culture (50 ml) was centrifuged and filtered to eliminate all cells, and freeze-dried and dissolved in 1 ml of water. 10 μl was spotted on DMSA plates containing P. acnes. The plates were incubated at 37° C. in anaerobic conditions for 2 to 3 days. The dark areas around the spotted Fusobacterium nucleatum cells or reconstituted freeze-dried supernatants correspond to the P. acnes growth inhibition zones. DETAILED DESCRIPTION

[0028] Unless otherwise stated, all terms used herein in this application should be understood with their common meanings known in the art. Other more specific definitions of certain terms as used in this application are described below, and are intended to be uniformly applied throughout the specification and claims unless otherwise expressly stated definitions provide broader definitions.

[0029] As used herein, the indefinite article "a" is synonymous with "at least one" or "one or more". Unless otherwise indicated, definite articles such as "the" used herein also include plural forms of nouns.

[0030] Fusobacterium nucleatum (F. nucleatum) is a Gram-negative, non-spore-forming anaerobic bacterium. Fusobacterium nucleatum is an important member of the human oral commensal flora along with many other anaerobes. Fusobacterium nucleatum is often associated with the formation of dental plaque biofilms. Several commercially available and preserved strains of Fusobacterium nucleatum are available for use and can be used in the present invention, such as Fusobacterium nucleatum subsp. polymorphum strain ATCC10953.

[0031] As used herein, "culture supernatant" or "conditioned medium" refers to a culture medium in which Fusobacterium nucleatum cells have been cultured for a suitable period of time and into which the cells have secreted an active agent to a level sufficient to provide the desired biological activity, particularly inhibition of growth of Propionibacterium acnes. The culture supernatant may contain one or more soluble metabolites of the bacteria that can be used in the methods described herein. A person skilled in the art using their common sense will know which culture medium is suitable for culturing bacteria and how long to culture to obtain a supernatant with sufficient active metabolites. The culture supernatant can be obtained, for example, by settling, precipitating or centrifuging the cells in the culture. The supernatant can be filtered. The culture supernatant may contain one or more soluble metabolites.

[0032] As used herein, "lysate" refers to a sample of Fusobacterium nucleatum that has been subjected to lysis. The lysate may contain one or more soluble metabolites of the bacteria that can be used in the methods described herein. A variety of methods for performing lysis are known to those skilled in the art and are common knowledge. For example, lysis can occur by chemical or physical disruption, such as by adding osmotic agents or enzymes to the bacteria, or by applying physical pressure, such as by ultrasonic disruption. The bacteria can be washed prior to lysis. After lysis, the lysate can be filtered and / or sterilized to remove any remaining whole bacteria. The lysate can be suspended, for example, in an aqueous medium.

[0033] The term "bacterial infection" refers to a condition or disease associated with the proliferation of pathogenic bacteria on or in the body. Pathogenic bacteria may be opportunistic bacteria, i.e. bacteria that normally live in commensal form in the body (such as Propionibacterium acnes) but that may cause disease under certain circumstances (such as acne when hair follicles become blocked).

[0034] As used herein, "acne vulgaris" or "acne" refers to a skin condition that occurs when dead skin cells and oil from the skin clog the hair follicles. Acne can be classified as non-inflammatory acne (when there is no bacterial infection) and inflammatory acne (when the clogged pores have become infected with bacteria, particularly Propionibacterium acnes).

[0035] The term "pharmaceutically acceptable" as used herein relates to those compounds, materials, compositions and / or dosage forms that are suitable for contact with the tissues of a subject (e.g., a human) without excessive toxicity, irritation, allergic response, or other problems or complications (commensurate with a reasonable benefit / risk ratio) within the scope of sound medical judgment. Each carrier, excipient, etc. must also be "acceptable" in the sense that it is compatible with the other ingredients of the formulation. Suitable carriers, excipients, etc. can be found in standard pharmaceutical texts and include, for example, preservatives, coagulants, humectants, emollients, and antioxidants.

[0036] As used herein, the term "effective amount" means an amount of active agent high enough to deliver the desired benefit (treatment or prevention of disease), but low enough to avoid serious side effects within the scope of medical judgment.

[0037] The terms "cosmetically acceptable" or "dermatologically acceptable" have the same meaning and are used interchangeably herein. They refer to excipients or carriers that are suitable for use in contact with human skin without excessive toxicity, incompatibility, instability, allergic reactions, etc. The excipients or carriers used have an affinity for the skin, are well tolerated, stable, and are used in an amount sufficient to provide the desired consistency and ease of application. Appropriate excipients and / or carriers and their amounts can be readily determined by those skilled in the art, depending on the type of formulation being prepared, to provide the desired consistency and ease of application.

[0038] Examples of suitable excipients or carriers may include, but are not limited to, surfactants, vehicles, preservatives, propellants, pH adjusters, stabilizers, viscosity agents, skin conditioning agents, antioxidants, and mixtures thereof. The bacteria, lysates, or supernatants of the present invention may also be used for cosmetic purposes if the skin is considered free of any disease, but an unsightly appearance becomes apparent due to the presence of, for example, acne or whiteheads (without inflammation).

[0039] The term "inanimate surface" is to be understood as any surface other than the surface of a living body (ie skin, mucous membranes).

[0040] As indicated above, in a first aspect, the present invention provides Fusobacterium nucleatum, or a lysate thereof, or a culture supernatant thereof, for use in preventing and / or treating bacterial infections. In other words, the present invention provides Fusobacterium nucleatum cells, or a Fusobacterium nucleatum lysate, or a Fusobacterium nucleatum culture supernatant, for use in preventing and / or treating bacterial infections. Fusobacterium nucleatum cells may be provided in the form of a cell culture or in a purified form.

[0041] In a specific embodiment of the first aspect, the bacterial infection is caused by or associated with Propionibacterium acnes. In other words, the bacterial infection is associated with the pathogenic growth of Propionibacterium acnes. In a more specific embodiment, the bacterial infection caused by or associated with Propionibacterium acnes is selected from the group consisting of: acne vulgaris, eye infections (e.g., blepharitis and endophthalmitis), dental infections, skin infections (e.g., post-traumatic bacterial lethal granulomas), endocarditis, bone infections, joint infections, central nervous system infections (e.g., discitis or cerebrospinal fluid shunt infections), sepsis, postoperative infections, cerebrospinal fluid shunt infections, device-related infections, and combinations thereof.

[0042] In a specific embodiment of the first aspect, Fusobacterium nucleatum, or a lysate thereof, or a culture supernatant thereof is used to prevent and / or treat acne vulgaris. In a more specific embodiment, acne vulgaris is inflammatory acne.

[0043] In a particular embodiment of the first aspect, the Fusobacterium nucleatum is in the form of an isolated bacterial population, in particular an isolated bacterial strain.

[0044] In particular embodiments of the first aspect, the Fusobacterium nucleatum is alive, attenuated, inactivated or killed.

[0045] In a specific embodiment of the first aspect, the Fusobacterium nucleatum culture supernatant is a cell-free supernatant, and / or the Fusobacterium nucleatum lysate is a cell-free lysate.

[0046] In a specific embodiment of the first aspect, the lysate can be obtained by a method comprising, consisting essentially of or consisting of the following steps: a) culturing Fusobacterium nucleatum under suitable growth conditions, in particular anaerobic conditions, thereby producing a cell culture; and b) lysing the cell culture, thereby obtaining the lysate. For the purposes of the present invention, the expressions "obtainable", "obtained" and their equivalents are used interchangeably, and in any case, the expression "obtainable" includes the expression "obtained".

[0047] In a specific embodiment of the first aspect, the lysate can be obtained by a method comprising, consisting essentially of or consisting of the following steps: a) culturing Fusobacterium nucleatum under suitable growth conditions, particularly anaerobic conditions, thereby producing a cell culture; b) lysing the cell culture to obtain a lysate; and c) optionally, further subjecting the lysate of step (b) to a step selected from the group consisting of: dehydration, filtration, ultrafiltration, centrifugation, ultracentrifugation, precipitation, chromatography and a combination thereof.

[0048] In a specific embodiment of the first aspect, the Fusobacterium nucleatum supernatant can be obtained by a method comprising, consisting essentially of or consisting of the following steps: a) culturing Fusobacterium nucleatum in a culture medium under suitable growth conditions, particularly anaerobic conditions; and b) separating the culture medium from the Fusobacterium nucleatum cells, thereby obtaining a culture supernatant. In a more specific embodiment, the Fusobacterium nucleatum is cultured for a suitable period of time, particularly at least 12h, 24h, 48h, 60h or 72h. In an even more specific embodiment, the Fusobacterium nucleatum is cultured for about 48h. In a specific embodiment, the separation of the culture medium from the cells is performed by centrifugation and / or filtration. In another specific embodiment, the culture supernatant is further subjected to a step selected from the group consisting of: dehydration, filtration, ultrafiltration, centrifugation, ultracentrifugation, precipitation, chromatography and a combination thereof.

[0049] In a particular embodiment of the first aspect, the Fusobacterium nucleatum lysate or supernatant is sterilized, in particular filter sterilized.

[0050] In a specific embodiment of the first aspect, the Fusobacterium nucleatum strain is a non-pathogenic strain of Fusobacterium nucleatum. In a more specific embodiment, the Fusobacterium nucleatum strain is a probiotic strain.

[0051] In a specific embodiment of the first aspect, the Fusobacterium nucleatum, its lysate or its supernatant is concentrated and / or freeze-dried. In a more specific embodiment, it is reconstituted freeze-dried.

[0052] In a specific embodiment of the first aspect, Fusobacterium nucleatum is selected from the subspecies group consisting of Fusobacterium nucleatum subsp. polymorphum, Fusobacterium nucleatum subsp. nucleatum, Fusobacterium nucleatum subsp. vincentii, Fusobacterium nucleatum subsp. fusiforme, Fusobacterium nucleatum subsp. animalis, and combinations thereof. In a more specific embodiment, Fusobacterium nucleatum is not Fusobacterium nucleatum subsp. nucleatum. In an even more specific embodiment, Fusobacterium nucleatum is Fusobacterium nucleatum subsp. polymorphum.

[0053] In a specific embodiment of the first aspect, Fusobacterium nucleatum polymorphic subspecies is strain ATCC10953 or a mutant thereof that retains or enhances the ability of the parent strain to inhibit the growth of Propionibacterium acnes. In another specific embodiment, Fusobacterium nucleatum polymorphic subspecies is strain ATCC10953 or a mutant strain obtained from ATCC10953 strain that retains or enhances the ability of the parent strain to inhibit the growth of Propionibacterium acnes. In a more specific embodiment, strain ATCC10953 is a strain having a genome sequence of NCBI accession number NZ_AARG00000000, version NZ_AARG00000000.1.

[0054] The expert in the field will understand that using any strain as starting material, for example by spontaneous mutation or directed mutagenesis, it is generally possible to obtain mutants that retain the characteristics and related advantages described herein. Methods for obtaining mutants of a given bacterial strain are known in the art. The skilled person will also know how to use common knowledge to test the ability of the mutant strain to inhibit the growth of P. acnes, for example, by performing an inhibition zone assay as described in the examples below, i.e., pipetting the mutant strain onto a P. acnes culture and measuring the resulting inhibition zone.

[0055] In a particular embodiment of the first aspect, Fusobacterium nucleatum, or a lysate thereof, or a culture supernatant thereof, is for use in a combination therapy with an antibiotic or an anti-inflammatory agent. Antibiotics and anti-inflammatory agents that can be used in the present invention, in particular for the treatment of Propionibacterium acnes infections, are well known to those skilled in the art and form part of the common general knowledge.

[0056] In another aspect, the present invention provides Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof for use in treating a disease or condition caused by or associated with Propionibacterium acnes, in particular acne vulgaris.

[0057] In another aspect, the present invention provides Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof for use in treating a disease or condition caused by or associated with Propionibacterium acnes, in particular a Propionibacterium acnes infection.

[0058] As described above, in the second aspect, the present invention also provides a pharmaceutical composition comprising a therapeutically effective amount of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof, and at least one pharmaceutically acceptable excipient and / or carrier. All embodiments described above for the first aspect regarding Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof are also intended to apply to this second aspect.

[0059] In a specific embodiment of the second aspect, the pharmaceutical composition further comprises a bacterium of a species other than Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof. In a more specific embodiment, the pharmaceutical composition comprises a probiotic other than Fusobacterium nucleatum.

[0060] As mentioned above, in the third aspect, the invention provides the pharmaceutical composition of the second aspect, which is used as a medicine. In the fourth aspect, the invention provides the pharmaceutical composition of the second aspect, which is used for use in preventing and / or treating bacterial infections. All embodiments of the first aspect about preventing and / or treating bacterial infections are also intended to be applicable to the fourth aspect of the present invention.

[0061] This aspect can also be expressed as the use of the pharmaceutical composition of the present invention in the manufacture of a medicament for treating or preventing bacterial infection. This aspect can also be expressed as a method for treating or preventing bacterial infection, the method comprising administering a therapeutically effective amount of the pharmaceutical composition of the present invention to a subject in need thereof.

[0062] In a particular embodiment of the fourth aspect, the preventing and / or treating comprises administering the pharmaceutical composition in a dose that results in an inhibition or reduction in the growth of P. acnes.

[0063] As indicated above, in a fifth aspect, the present invention provides a cosmetic composition comprising a cosmetically effective amount of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof, and at least one cosmetically acceptable excipient and / or carrier. In a specific embodiment, the cosmetic composition is a deodorant cosmetic composition.

[0064] In a specific embodiment of the second and fifth aspects, the pharmaceutical composition or cosmetic composition is formulated for topical use, in particular in a form selected from the group consisting of creams, gels, oils, emulsions, sprays, gauze, patches, bandages, lotions, mousses, ointments, pastes, liquid preparations for extemporaneous preparations, and mixtures thereof.

[0065] In a particular embodiment of the second or fifth aspect, the pharmaceutical composition or the cosmetic composition is formulated for oral administration, in particular as a solid formulation, optionally in the form of a pill, capsule, tablet, granular powder.

[0066] As mentioned above, in the sixth aspect, the present invention also provides a non-therapeutic use of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof in cosmetics.

[0067] In a specific embodiment of the sixth aspect, the non-therapeutic use is for treating non-inflammatory acne. In another specific embodiment of the sixth aspect, the non-therapeutic use is for reducing body odor.

[0068] In a seventh aspect, the present invention provides a non-therapeutic use of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof as an antibacterial agent.

[0069] In a specific embodiment of the seventh aspect, the use of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof is an in vitro non-therapeutic use.

[0070] In a specific embodiment of the seventh aspect, the use of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof is for inhibiting the growth of Propionibacterium acnes.

[0071] In a specific embodiment of the seventh aspect, the use of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof is as an antibacterial agent on a non-living surface or in a plant.

[0072] Throughout the specification and claims, the word "comprising" and variations of the word are not intended to exclude other technical features, additives, components or steps. In addition, the word "comprising" covers the situation of "consisting of ...". Other objects, advantages and features of the present invention will become apparent to those skilled in the art after examining the description, or can be learned by the practice of the present invention. The following examples and drawings are provided in an illustrative manner, and they are not intended to limit the present invention. The figure marks associated with the drawings and placed in brackets in the claims are only intended to increase the understandability of the claims and should not be interpreted as limiting the scope of the claims. In addition, the present invention covers all possible combinations of the specific and preferred embodiments described herein.

[0073] For reasons of completeness, various aspects of the invention are set out in the following numbered clauses:

[0074] 1. Fusobacterium nucleatum, or a lysate thereof, or a culture supernatant thereof, for use in preventing and / or treating bacterial infection.

[0075] 2. The Fusobacterium nucleatum for use according to clause 1, or a lysate thereof, or a culture supernatant thereof, wherein the bacterial infection is caused by or associated with Propionibacterium acnes.

[0076] 3. The Fusobacterium nucleatum for use according to any one of clauses 1-2, or a lysate thereof, or a culture supernatant thereof, wherein the bacterial infection caused by or associated with Propionibacterium acnes is selected from the group consisting of: acne vulgaris, eye infection, dental infection, skin infection, endocarditis, bone infection, joint infection, central nervous system infection, sepsis, postoperative infection, device-related infection, and combinations thereof.

[0077] 4. The Fusobacterium nucleatum for use according to any one of clauses 1 to 3, or a lysate thereof, or a culture supernatant thereof, for preventing and / or treating acne vulgaris.

[0078] 5. The Fusobacterium nucleatum, or a lysate thereof, or a culture supernatant thereof for use according to any one of clauses 1 to 4, wherein the Fusobacterium nucleatum culture supernatant is a cell-free supernatant, and / or the Fusobacterium nucleatum lysate is a cell-free lysate.

[0079] 6. The Fusobacterium nucleatum for use according to any one of clauses 1 to 5, or a lysate thereof, or a culture supernatant thereof, wherein the lysate can be obtained by a method comprising the following steps:

[0080] a) cultivating the Fusobacterium nucleatum under suitable growth conditions, in particular anaerobic conditions, thereby producing a cell culture; and

[0081] b) lysing the cell culture, thereby obtaining the lysate.

[0082] 7. The Fusobacterium nucleatum for use according to any one of clauses 1 to 6, or a lysate thereof, or a culture supernatant thereof, wherein the culture supernatant is obtainable by a method comprising the following steps:

[0083] a) cultivating the Fusobacterium nucleatum in a culture medium under suitable growth conditions, in particular anaerobic conditions; and

[0084] b) separating the culture medium from the Fusobacterium nucleatum to obtain the culture supernatant.

[0085] 8. The Fusobacterium nucleatum for use according to any one of clauses 1 to 7, or a lysate thereof, or a culture supernatant thereof, wherein the Fusobacterium nucleatum is selected from the subspecies group consisting of: Fusobacterium nucleatum polymorphic subspecies, Fusobacterium nucleatum subspecies nucleatum, Fusobacterium nucleatum subspecies wenkelii, Fusobacterium nucleatum subspecies fusiformis, Fusobacterium nucleatum subspecies animalis and combinations thereof.

[0086] 9. The Fusobacterium nucleatum for use according to clause 8, or a lysate thereof, or a culture supernatant thereof, wherein the Fusobacterium nucleatum is Fusobacterium nucleatum subspecies polymorphum.

[0087] 10. The Fusobacterium nucleatum for use according to clause 9, or a lysate thereof, or a culture supernatant thereof, wherein the Fusobacterium nucleatum subsp. polymorpha is strain ATCC10953 or a mutant thereof that retains or enhances the ability of the parent strain to inhibit the growth of Propionibacterium acnes.

[0088] 11. A pharmaceutical composition comprising a therapeutically effective amount of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof, and at least one pharmaceutically acceptable excipient and / or carrier.

[0089] 12. The pharmaceutical composition according to clause 11, for use in the prevention and / or treatment of bacterial infections, in particular bacterial infections caused by or associated with Propionibacterium acnes.

[0090] 13. A cosmetic composition comprising a cosmetically effective amount of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof, and at least one cosmetically acceptable excipient and / or carrier.

[0091] 14. A non-therapeutic use of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof as an antibacterial agent, in particular for inhibiting the growth of Propionibacterium acnes.

[0092] 15. The pharmaceutical composition according to clause 11, the pharmaceutical composition for use according to clause 12, the cosmetic composition according to clause 13 or the non-therapeutic use according to clause 14, wherein the Fusobacterium nucleatum is Fusobacterium nucleatum subsp. polymorphum.

[0093] Example

[0094] Materials and methods

[0095] Acne patient sampling

[0096] Forty individuals aged 14-15 years from the same school in the El Vallès region near Barcelona (Spain) were informed about the study. Informed consent was obtained from their parents or legal guardians. Exclusion criteria were applied (smokers, antibiotic treatment during the past 6 months, benzoyl peroxide treatment during the past 6 months, skin diseases affecting the sampling area). Dermatologists assessed the severity of acne and only grade 1 and 2 individuals were included. Acne was assessed by using sterile swabs (Catch-All from Epicentre). TM ref.QEC091H), swabs were collected 4 times on fixed areas of the chin, cheeks and forehead, and the swabs were previously soaked in a 0.15M NaOH solution containing 0.01% Tween 20 as described in Fierer et al., 2010. Briefly, the swabs were placed in an Eppendorf tube containing 0.5 ml PBS and stirred vigorously. The samples were stored on ice and immediately frozen at -20°C upon arrival at the laboratory. DNA extraction was performed using the Norgen Saliva DNA Isolation Kit (ref: RU454000) according to the manufacturer's instructions.

[0097] Culture medium

[0098] BHI (Brain Heart Infusion Broth) was from Conda (ref 1048). R-2A (Reasoner's 2A) was from Condalab (ref: 1071.00). Nissui is a common nickname for the modified GAM broth (ref 05433) produced by Nissui. BM (Bob's Medium): yeast extract 2.5 g / l (Condalab ref: 1702.00), meat peptone 2.5 g / l (Condalab ref: 1616.05), casein hydrolysate 2.5 g / l (Merck ref: 22090), glucose 2.5 g / l, potassium dihydrogen phosphate 1.5 g / l (Panreac ref 121512.1211) and sodium pyruvate 1.5 g / l (Gibco ref: 11840-048). HEPES (VWR ref: 0511) was added to a final concentration of 75 mM. The pH was adjusted to 7 by addition of NaOH (Panreac ref: 141687.1211). MRS medium was from Scharlau (ref: 01-135-500).

[0099] BMSA is BM containing 0.7% agar (BM soft agar). BMSA was autoclaved and stored at 45°C to contain a final concentration of 0.0025 OD 600 / ml (1OD is the number of bacteria that produce 1 unit of absorbance in 1ml). The culture medium is placed in a petri dish to solidify and used for later use.

[0100] Inhibition zone assay

[0101] All different bacterial strains were thawed from glycerol stocks stored at -80°C. Specifically, Fusobacterium nucleatum was streaked on agar-Nissui plates and P. acnes was streaked on agar-BHI plates. The bacteria were grown in anaerobic jars (AnaeroGen, OXOID 2004AN0025A) at 37°C for 2 to 3 days. P. acnes cells were scraped and placed in 1 ml BM medium. The optical density was measured using a spectrophotometer at a wavelength of λ = 600 nm. In order to embed P. acnes in BMSA plates, a final concentration of 0.0025 OD λ600 acnes were added to the culture medium maintained in a 45°C water bath and placed in empty 10 cm Petri dishes and allowed to solidify for 15 min in a fume hood. The Petri dish lid was partially opened to avoid excess water condensation.

[0102] Meanwhile, scrape the Fusobacterium nucleatum plate and resuspend the cells in BM medium. Harvest the cells by centrifugation (14,100 rcf, 1 min) and resuspend them in BM medium to a final concentration of 50 OD λ600 / ml.

[0103] To examine the inhibitory capacity of Fusobacterium nucleatum cells by the formation of inhibition zones, 10 μl of Fusobacterium nucleatum under the above conditions was pipetted onto the above embedded P. acnes plates. The plates were allowed to stand in a hood for 15-30 min to allow the liquid to be absorbed. The plates were stored at 37° C. under anaerobic conditions for 2 to 3 days.

[0104] To examine the inhibition zone produced by the culture medium (i.e., culture supernatant) in which Fusobacterium nucleatum was grown, 0.06 OD λ600Fusobacterium nucleatum was inoculated in 150 ml of liquid BM medium in a 250 ml flask. The flask was stored at 37°C in anaerobic conditions and without stirring for 2 to 3 days. The culture was divided into 50 ml tubes and centrifuged at 15,500 rcf for 10 min. The supernatant was filtered using a 0.22 μm filter to eliminate cells. The filtered supernatant was frozen at -80°C and freeze-dried in a Lyomicon from Coolvacum Technologies at -55°C in a 150 mm petri dish for 2 days. The freeze-dried material was dissolved in 1 ml of water. To check for inhibition, 10 μl of the dissolved freeze-dried material was placed on a P. acnes embedding plate and incubated at 37°C in anaerobic conditions for 2 to 3 days.

[0105] result

[0106] Microbiome analysis

[0107] Microbial facial skin samples from 40 individuals were collected and processed as described above. The presence and severity of acne were assessed on-site by a dermatologist, and only patients with grade 1 and 2 (Plewig G. and Kligman A., 1975) acne were included. DNA was extracted and sequenced using the Illumina MISeq 2x300 next-generation sequencing system using oligonucleotides designed in the V1-V3 region of the RNA16S gene as described in Meisel et al. 2016. The oligonucleotide sequences were: 27F (forward) AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 1) and 534R (reverse) ATTACCGCGGCTGCTGG (SEQ ID NO: 2).

[0108] Sequence data obtained from the Illumina platform were analyzed using informatics to compare the relative presence of species in acne individuals relative to healthy individuals. Spearman's nonparametric correlation was used to find species that were more abundant in healthy individuals than in acne individuals, representing putative balancers or protectors of acne. A list of the most differential species was generated. The top 10 candidates (including Fusobacterium nucleatum) that showed large differences between healthy individuals and acne patients were tested for in vitro inhibition of Propionibacterium acnes.

[0109] Fusobacterium nucleatum inhibits Propionibacterium acnes in vitro

[0110] The commercially available Fusobacterium nucleatum strain ATCC 10953 was grown in agar Nissui medium at 37°C in anaerobic conditions for 48h. The cells were harvested by scraping with 1 ml BM and concentrated to a density of 50 optical density (OD) units (measured as absorbance at λ=600nm in a 1 cm cuvette) by centrifugation (14,100rcf, 1 min). 10μl of the concentrated Fusobacterium nucleatum as described above was spotted on BMSA plates, in which P. acnes had just been embedded during the solidification of the plates, as explained above. The plates were incubated in anaerobic conditions at 37°C for 48h by placing them in an anaerobic jar. A zone of inhibition of P. acnes growth was found where Fusobacterium nucleatum was spotted (see Figure 1 ). Finally, to exclude artifacts arising from bacterial growth, no inhibition of P. acnes growth was observed when different bacterial species were used ( Figure 2 acnes on a P. acnes culture). In summary, the results indicate that F. nucleatum is able to inhibit the growth of P. acnes and that this inhibition by F. nucleatum is specific.

[0111] Fusobacterium nucleatum specifically inhibits the growth of Propionibacterium acnes but not other bacterial species

[0112] The ability of Fusobacterium nucleatum to inhibit the growth of bacterial species other than P. acnes was tested using the same method as described above. Figure 2 In , it was shown that Fusobacterium nucleatum did not inhibit the growth of Gram-negative bacteria (such as Escherichia coli) or Gram-positive bacteria (such as Enterococcus faecalis or Staphylococcus epidermidis).

[0113] Thus, these results indicate that F. nucleatum provides very specific inhibition of P. acnes, which makes it suitable for the treatment of acne without producing undesirable side effects caused by alterations in the skin microbiota.

[0114] The inhibition produced by Fusobacterium nucleatum was more significant than that produced by probiotics used to treat acne

[0115] Several well-known probiotic species were included in this assay, such as Bifidobacterium longum, Lactobacillus plantarum, Streptococcus salivarius, Lactobacillus rhamnosus, and Lactobacillus reuteri. Figure 3 It can be seen that none of them can inhibit the growth of Propionibacterium acnes.

[0116] The ability of commensal bacteria, such as Prevotella intermedia, to inhibit P. acnes in vitro has been reported previously. However, the results presented herein indicate a toxic effect of the hemin group, a component of the growth medium of P. intermedia, on P. acnes.

[0117] Inhibitory compounds produced by Fusobacterium nucleatum are secreted into the culture medium

[0118] Fusobacterium nucleatum was grown overnight in Nissui plates, harvested and grown in liquid BM for 48 h at 37°C, cells were removed by centrifugation (15,500 rcf, 10 min). The supernatant was freeze dried and a 50 ml portion of the supernatant was resuspended in 1 ml of water. 10 μl of the solution was spotted on a plate that had just been embedded with P. acnes, as described above. Figure 4 As can be seen, inhibitory activity was still retained in the reconstituted freeze-dried supernatant, indicating that the inhibitory compounds produced by F. nucleatum were secreted into the growth medium.

[0119] The results presented here clearly show that Fusobacterium nucleatum or its culture supernatant (ie, conditioned medium) is able to inhibit the growth of P. acnes and is therefore suitable for treating acne without any undesired effects caused by the inhibition of other bacteria in the skin microbiota.

[0120] Citation List

[0121] Fierer, N., Lauber, CL, Zhou, N., McDonald, D., Costello, EK, and Knight, R. "Forensic identification using skin bacterial communities", 2010, Proc NatlAcad Sci USA, vol.107, pp.6477-6481.

[0122] Meisel JS, Hannigan GD, Tyldsley AS, SanMiguel AJ, Hodkinson BP, Zheng Qand Grice EA. "Skin microbiome surveys are strongly influenced by experimental design", 2016, J Invest Dermatol., vol.136(5), pp.947–956.

[0123] Plewig G, Kligman A., "Acne: morphogenesis and treatment", 1975, New York: Springer-Verlag; pp.162-3.

Claims

1. Fusobacterium nucleatum, or a lysate thereof, or a culture supernatant thereof, for use in preventing and / or treating bacterial infections caused by or associated with Propionibacterium acnes.

2. The Fusobacterium nucleatum for use according to claim 1, or a lysate thereof, or a culture supernatant thereof, wherein the bacterial infection caused by or associated with Propionibacterium acnes is selected from the group consisting of: acne vulgaris, eye infection, dental infection, skin infection, endocarditis, bone infection, joint infection, central nervous system infection, sepsis, postoperative infection, device-related infection, and combinations thereof.

3. The Fusobacterium nucleatum for use according to any one of claims 1 to 2, or a lysate thereof, or a culture supernatant thereof, for preventing and / or treating acne vulgaris.

4. The Fusobacterium nucleatum for use, or a lysate thereof, or a culture supernatant thereof according to any one of claims 1 to 3, wherein the Fusobacterium nucleatum culture supernatant is a cell-free supernatant, and / or the Fusobacterium nucleatum lysate is a cell-free lysate.

5. The Fusobacterium nucleatum for use according to any one of claims 1 to 4, or a lysate thereof, or a culture supernatant thereof, wherein the lysate can be obtained by a method comprising the following steps: a) cultivating the Fusobacterium nucleatum under suitable growth conditions, in particular anaerobic conditions, thereby producing a cell culture; and b) lysing the cell culture, thereby obtaining the lysate.

6. The Fusobacterium nucleatum for use according to any one of claims 1 to 5, or a lysate thereof, or a culture supernatant thereof, wherein the culture supernatant can be obtained by a method comprising the following steps: a) cultivating the Fusobacterium nucleatum in a culture medium under suitable growth conditions, in particular anaerobic conditions; and b) separating the culture medium from the Fusobacterium nucleatum to obtain the culture supernatant.

7. The Fusobacterium nucleatum for use according to any one of claims 1-6, or a lysate thereof, or a culture supernatant thereof, wherein the Fusobacterium nucleatum is selected from the subspecies group consisting of: Fusobacterium nucleatum polymorphic, Fusobacterium nucleatum nucleatum, Fusobacterium nucleatum wenkelii, Fusobacterium nucleatum fusiformis, Fusobacterium nucleatum animalis, and combinations thereof.

8. The Fusobacterium nucleatum for use according to claim 7, or a lysate thereof, or a culture supernatant thereof, wherein the Fusobacterium nucleatum is Fusobacterium nucleatum subspecies polymorphum.

9. The Fusobacterium nucleatum for use according to claim 8, or a lysate thereof, or a culture supernatant thereof, wherein the Fusobacterium nucleatum subsp. polymorpha is strain ATCC10953 or a mutant thereof that retains or enhances the ability of the parent strain to inhibit the growth of Propionibacterium acnes.

10. A pharmaceutical composition comprising a therapeutically effective amount of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof, and at least one pharmaceutically acceptable excipient and / or carrier.

11. The pharmaceutical composition according to claim 10, for use in preventing and / or treating bacterial infections caused by or associated with Propionibacterium acnes.

12. A cosmetic composition comprising a cosmetically effective amount of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof, and at least one cosmetically acceptable excipient and / or carrier.

13. A non-therapeutic in vitro use of Fusobacterium nucleatum, or a lysate thereof, or a supernatant thereof as an antibacterial agent, in particular for inhibiting the growth of Propionibacterium acnes.

14. The pharmaceutical composition according to claim 10, the pharmaceutical composition for use according to claim 11, the cosmetic composition according to claim 12 or the non-therapeutic use according to claim 13, wherein the Fusobacterium nucleatum is Fusobacterium nucleatum subsp. polymorphum.

Images