Use of endophytic fungus HKL06 in increasing paclitaxel content

Abstract

The application discloses application of endophytic fungus HKL06 in increasing paclitaxel content, and the endophytic fungus HKL06 is classified as Diaporthe celeris HKL06, and has been preserved in the China Center for Type Culture Collection (CCTCC) on January 26, 2024, with a preservation number of CCTCC NO: M2024234. The application can significantly promote the biosynthesis process of paclitaxel in a plant body, and enhance gene expression related to paclitaxel synthesis. The application not only increases the yield of paclitaxel, but also helps to optimize the production process of paclitaxel, so that the application has significant practical value and broad market prospect in the medical field.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial and plant secondary metabolism regulation, and particularly relates to the application of endophytic fungus HKL06 in improving paclitaxel content. BACKGROUND

[0002] Paclitaxel is a natural compound with significant anticancer activity, which was first discovered by researchers at the National Cancer Institute (NCI) in the 1960s when screening potential anticancer substances. It can be used to treat various types of cancer, including breast cancer, ovarian cancer, lung cancer, pancreatic cancer, head and neck cancer, and some types of leukemia. It prevents the proliferation of cancer cells by interfering with the microtubular structure during cell division.

[0003] Paclitaxel mainly exists in the bark of Taxus plants, so the initial method of obtaining paclitaxel was by directly extracting it from the bark of Taxus trees. However, this method caused significant damage to the trees and had low extraction efficiency. With the development of biotechnology, scientists have developed various methods to produce paclitaxel, including:

[0004] ① Semi-synthetic method: extracting precursor compounds from other Taxus plants and then chemically converting them into paclitaxel;

[0005] ② Plant tissue culture: cultivating cells of Taxus plants under laboratory conditions and increasing the production of paclitaxel through biotechnological means;

[0006] ③ Genetic engineering: introducing genes of paclitaxel synthesis pathway into microorganisms or plants to enable them to produce paclitaxel.

[0007] Currently, paclitaxel and its derivatives (such as docetaxel) have become indispensable drugs in many cancer treatment regimens. With the advancement of biotechnology, the production method of paclitaxel is continuously optimized to reduce environmental impact and improve production efficiency.

[0008] Plant endophytic fungi are symbiotic fungi that exist in healthy tissues. Since they coexist with host plants throughout their life cycle, they can often produce a variety of secondary metabolites with novel structures and significant activities. Endophytic fungi isolated from the bark of Taxus chinensis var. mairei can produce paclitaxel analogues, which has attracted great attention. Taxomyces andreana Active ingredients produced by plant endophytic fungi are precursors of drugs and important partners for plant growth and development. Some endophytic fungi can promote the growth of host plants, enhance the stress resistance of host plants, promote the synthesis and accumulation of active ingredients in host plants, and play a positive role in improving plant yield and quality. SUMMARY

[0009] The first object of the present application is to provide the application of endophytic fungus HKL06 in increasing the content of paclitaxel, which is isolated and purified from Taxus chinensis var. mairei and classified as Talaromyces sp. Diaporthe sp. HKL06, the strain preservation number of which is CCTCC NO: M2024234, the preservation date of which is January 26, 2024, and the preservation unit of which is China Center for Type Culture Collection (CCTCC), the preservation address of which is No. 299, Bajiyilu, Wuchang District, Wuhan City, Hubei Province.

[0010] As preferred, the ITS base sequence of the endophytic fungus HKL06 is shown in SEQ ID NO. 1.

[0011] As preferred, the endophytic fungus HKL06 increases the expression amount of key genes in the paclitaxel synthesis pathway and promotes the synthesis of paclitaxel.

[0012] The second object of the present application is to provide a method for increasing the content of paclitaxel in the needle leaves of Taxus chinensis var. mairei, which comprises the following steps:

[0013] Spraying spore liquid of the endophytic fungus HKL06 on the seedlings of Taxus chinensis var. mairei;

[0014] The preparation process of the spore liquid is as follows: inoculating the endophytic fungus strain HKL06 in the needle leaves of Taxus chinensis var. mairei into a culture medium for culture, obtaining the spore liquid by filtration under reduced pressure after spores are generated.

[0015] As preferred, the culture medium is PDA solid culture medium (potato dextrose broth medium).

[0016] As preferred, the culture conditions are constant temperature incubation at 25-30℃ for 5-7 days in the dark.

[0017] The third object of the present application is to provide a composition for increasing the content of paclitaxel in the needle leaves of Taxus chinensis var. mairei, which comprises: the endophytic fungus HKL06, or cell culture, cell metabolites, cell culture supernatant or cell lysate thereof.

[0018] The present application has the following beneficial effects:

[0019] The present application provides the application of the endophytic fungus strain HKL06 of Taxus chinensis var. mairei in increasing the content of paclitaxel, which specifically relates to directly spraying the filtered spore suspension on the young branches of the seedlings of Taxus chinensis var. mairei. This method can significantly promote the biosynthesis process of paclitaxel, an important medicinal ingredient, in the plant body and enhance the expression of genes related to the synthesis of paclitaxel. The present application not only increases the yield of paclitaxel, but also helps to optimize the production process, thereby having significant practical value and broad market prospect in the medical field. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 Diaporthe phaseolorum Diaporthe Colony morphology of D. phaseolorum sp. HKL06 on solid medium.

[0021] Figure 2 Diaporthe phaseolorum Diaporthe Hyphal and spore morphology of D. phaseolorum sp. HKL06 under light microscope.

[0022] Figure 3 Diaporthe phaseolorum Diaporthe sp. ITS sequence agarose gel electrophoresis map of D. phaseolorum sp. HKL06.

[0023] Figure 4 Diaporthe phaseolorum Diaporthe Phylogenetic tree of D. phaseolorum sp. HKL06.

[0024] Figure 5 Diaporthe phaseolorum Diaporthe Bar chart of D. phaseolorum sp. HKL06 infection increasing paclitaxel content in Taxus wallichiana leaves.

[0025] Figure 6 Diaporthe phaseolorum Diaporthe Graph of D. phaseolorum sp. HKL06 infection increasing expression of key genes in paclitaxel pathway in Taxus wallichiana leaves. DETAILED DESCRIPTION

[0026] The specific embodiments of the present application will be described in detail below with reference to the accompanying drawings.

[0027] Example 1 Diaporthe Isolation, identification and preservation of D. phaseolorum sp. HKL06:

[0028] The endophytic fungus was obtained according to the following steps:

[0029] (1) Freshly picked healthy two-year-old stem segments of Taxus wallichiana were washed under tap water for 30 minutes to remove visible surface dirt, and the surface water was absorbed with filter paper and placed on a clean workbench. The stem segments were soaked in 75% alcohol for 1 min, and the beaker was shaken constantly to ensure that the Taxus wallichiana tissue was in full contact with the alcohol. Then the tissue was washed with sterile water three times to remove the residual alcohol on the surface of the tissue. Next, the stem segments were treated with 0.1% HgCl2 for 5 min, and the plant material was washed in a clean beaker for 4 to 5 times to remove the residual HgCl2 on the surface of the tissue. To verify whether the disinfection was complete, 100 μL of the last washing sterile water was taken as a control and cultured at 26°C for 3 to 5 days. No bacterial growth was observed, indicating that the disinfection was effective.

[0030] (2) The sterilized stem nodes are peeled with a scalpel, and the bark is cut into small pieces of 5 mm; the treated plant material is laid flat on PDA medium, and three to four pieces of material are placed in each culture dish, and cultured at 26°C in constant temperature and dark. The mycelium will grow out of the tissue blocks after three to seven days of culture. After inoculation, the inoculation needle is transferred to a new PDA plate every 12 hours from the edge of the stem bark wound. The phenotype characteristics of the fungal colonies transferred are observed, and the single colony edge mycelium is selected and cultured on a new PDA plate. After three times of continuous purification, a small amount of mycelium is selected and observed under a microscope. If there is no mixed fungus, it is considered to be a single strain. After obtaining a single strain, it is inoculated on a PDA slant and stored at 4°C. As shown in Figure 1 , the HKL06 solid culture characteristics are white colonies. Under a microscope, the morphological characteristics are transparent mycelium with bifurcation, as shown in Figure 2 .

[0031] The PDA medium formula described in the present application is: potato 200.0 g / L, glucose 50.0 g / L, NH4NO3 6.0 g / L, anhydrous MgSO4 0.3 g / L, KH2PO4 0.5 g / L, vitamin B1 0.05 g / L.

[0032] (3) The DNA of the endophytic fungal strain of Taxus chinensis is extracted by using a TIANGEN plant genome DNA extraction kit, and the ITS sequence is amplified by using the extracted DNA as a template. The primers are ITS4 (SEQ ID NO. 2: 5'-TCCTCCGCTTTATTGATATGC-3') and ITS5 (SEQ ID NO. 3: 5'-GGAAGTAAAGTCGTAACAAGG-3'). The PCR reaction system is 2x Taq MasterMix (Dye), 25 μL; ITS5 (10 μM), 2 μL; ITS4 (10 μM), 2 μL; Template DNA, 3 μL; ddH2O, 18 μL. The PCR reaction program is 94°C pre-denaturation for 2 min, 94°C denaturation for 30 s, 57°C annealing for 30 s, 72°C extension for 30 s, denaturation-annealing-extension cycle for 30 times, and 72°C final extension for 2 min. Whether the amplification is successful is detected by 1% agarose gel electrophoresis, as shown in Figure 3 . The successful PCR product is sent to Zhejiang Shangya Biotechnology Co., Ltd. for sequencing. The ITS sequence of the endophytic fungus HKL06 described in the present application is amplified by PCR, and the product gel electrophoresis map is as shown in Figure 3 . The sequence obtained by sequencing is as shown in SEQ ID NO. 1. The sequencing results are compared with known Diaporthe celeris NR_158433 by using the NCBI website, and the similarity is 99.28%.

[0033] SEQ ID NO 1: HKL06

[0034] gtcctacctgatccgaggtcaattttcagaagttgggggtttaacggcagggcaccgccagggccttccagagcgagggtttaactactgcgctcggggtcctggcgagctcgccactgaatttcagggcctgcttcttgggtaagaagcagtgccccatcaccaagccaggcttgagggttgaaatgacgctcgaacaggcatgccctccggaataccagagggcgcaatgtgcgttcaaagattcgatgattcactgaattctgcaattcacattacttatcgcatttcgctgcgttcttcatcgatgccagaaccaagagatccgttgttgaaagttttgattcatttatgttttgtgctcagagtttcagtgtaaaaacaagagttgggttggccgccggcgggccgtctcaacacccgggggtgaggggccccggaggaccagctagcgccgaggcaacagtaaggtataagttcacaaagggtttctgggtgcgcctggggcgcgttccagcaatgatccctccgctggttcaccaacggagaccttgttacgatct

[0035] Example 2: Construction and analysis of homologous phylogenetic tree of endophytic fungus HKL06

[0036] The ITS sequence of endophytic fungus HKL06 was used as a target sequence to search for homologous sequences in the GenBank database in NCBI. The most similar sequence to the ITS sequence of endophytic fungus HKL06 was downloaded as a reference sequence, and a phylogenetic tree was constructed using MEGA 11 software. It was highly homologous to known Entophthora fungi. The phylogenetic tree is as follows Figure 4 .

[0037] Example 3: Preparation and application of spore liquid of Taxus chinensis var. mairei endophytic fungus HKL06

[0038] (1) Inoculation needle picks the shoe surface preserved about 5 mm x 5 mm size of Taxus chinensis var. mairei endophytic fungal blocks, and inverts on V8 medium, 26℃ constant temperature and dark culture for 5-7 days, until the fungus produces spores. Add 2 mL sterile water to the solid plate, scrape the mycelium and spores with a coating rod to obtain a mixture, fold three layers of gauze into a funnel shape, and filter the spore solution at nine layers (all the above steps are completed in a clean bench). Spore counting is performed under an optical microscope, and the obtained fungal spore solution concentration is adjusted to 1 x 10 6

[0039] (2) Wet sterile filter paper is laid in a tray, and about 20 cm long, age similar Taxus chinensis var. mairei stems and leaves are cut and washed with sterile water for 2-3 times, and the lower epidermis of the leaves is placed on the filter paper. Spray 20 mL of fungal spore solution evenly on the surface of the leaves, and spray the same amount of sterile water on the control group. Wrap the tray with plastic wrap and stand for 48 h, then cut the leaves and wash them with sterile water, and freeze them in liquid nitrogen and store them in a-80℃ refrigerator.

[0040] Example 4: Effect of endophytic fungus HKL06 on the content of paclitaxel in Taxus chinensis var. mairei leaves

[0041] (1) All extraction reagents are pre-cooled at-20℃ before use. Weigh 60 mg of leaves into a 1.5 mL centrifuge tube, add appropriate amount of steel beads and 600 μL of methanol-water (V:V=7:3, containing mixed internal standard, 4 μg / mL); after pre-cooling in-40℃ refrigerator for 2 min, put it into the grinder, 60 Hz grinding for 2 min; ice water bath ultrasonic extraction for 30 min, -40℃ standing overnight; 12000 rpm low temperature centrifugation for 10 min, using a syringe to suck 150 μL of supernatant, using a 0.22 μm organic phase needle filter to filter, then transfer to LC injection vial, -80℃ storage for standby; mix equal volume of all sample extracts to prepare quality control sample (QC).

[0042] ​(2) The sample was detected using a Waters ACQUITY UPLC I-Class plus ultra-high performance liquid chromatograph coupled with high-resolution mass spectrometer. The chromatographic conditions were as follows: chromatographic column: ACQUITY UPLC HSS T3 (100 mm x 2.1 mm, 1.8 μm); column temperature: 45°C; mobile phase: water (containing 0.1% formic acid) and acetonitrile; flow rate: 0.35 mL / min; injection volume: 3 μL; elution gradient: 0 min water:acetonitrile (volume ratio) 95:5, 4 min water:acetonitrile (volume ratio) 70:30, 8 min water:acetonitrile (volume ratio) 50:50, 10 min water:acetonitrile (volume ratio) 20:80, 14 min water:acetonitrile (volume ratio) 0:100, 15.1 min water:acetonitrile (volume ratio) 95:5. The separated sample was introduced into the mass spectrometer for analysis. The mass spectrometry conditions were as follows: the sample mass spectrum signal was collected by separate scanning of positive and negative ions, and the specific collection mode was DDA (data dependent acquisition) data-dependent scanning mode.

[0043] (3) The transition of mass-to-charge ratio (m / z) between 876.4→308.1 was used for paclitaxel quantitative analysis, and the transition of mass-to-charge ratio (m / z) between 876.4→531.2 and 876.4→591.4 was used for paclitaxel verification analysis. The paclitaxel (≥99%; CAS: 33069-62-4) standard was purchased from Aladdin Biochem Technology (Shanghai) Co., Ltd. The difference in paclitaxel content in Taxus chinensis treated with endophytic fungus HKL06 is shown in Figure 5 , wherein CK is the control group and HKL06 is the experimental group.

[0044] Example 5: Effect of endophytic fungus HKL06 on the expression content of paclitaxel synthesis related genes in Taxus chinensis leaves

[0045] (1) The total RNA of the HKL06 experimental group and the control group was extracted using TIANGEN RNAprep Pure Plant Kit, and after quality inspection, the transcriptome library was constructed and sequenced. The total RNA integrity of the sample was detected using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), and the VAHTS Universal V5 RNA-seq Library Prep kit was used to construct the transcriptome library. The library was sequenced using the Illumina Novaseq 6000 sequencing platform to generate 150 bp double-end reads; fastp software was used for processing to obtain clean reads for subsequent data analysis.

[0046] (2) HISAT2 software was used for alignment of the Taxus wallichiana genome, and gene expression (FPKM) was calculated, and HTSeq-count was used to obtain read counts of each gene; R (v 3.2.0) was used for PCA analysis and plotting of samples to assess sample biological repeats. DESeq2 software was used for differential expression gene analysis, and the differential expression genes (DEGs) were defined as genes meeting the threshold of P value < 0.05 and fold change > 2 or fold change < 0.5.

[0047] (3) The Taxus wallichiana paclitaxel synthesis related genes and their IDs required to be detected are: TS (ctg5306_gene.4), TS (ctg7747_gene.1), T13OH (ctg593_gene.12), TBT (ctg4165_gene.7), T5OH (ctg11276_gene.1), DBTNBT (ctg195_gene.25) and T7OH (ctg12564_gene.1). The expression level difference of the Taxus wallichiana paclitaxel synthesis related genes under the treatment of the endophytic fungus HKL06 is shown in Table 2. Figure 6 ​

Claims

1. Application of endophytic fungus HKL06 in increasing the content of paclitaxel in needles of Taxus chinensis var. mairei, characterized in that, The taxonomic name of the endophytic fungus HKL06 is Diaporthe phaseolorum Diaporthe sp. HKL06, and the deposit number is CCTCC NO: M2024234, and the deposit date is January 26, 2024.

2. A method for increasing the content of paclitaxel in the needles of Taxus chinensis, characterized in that, The method comprises the following steps: Spraying spore solution of endophytic fungus HKL06 on Taxus chinensis var. mairei seedlings; the taxonomic name of the endophytic fungus HKL06 is Diaporthe phaseolorum Diaporthe sp. HKL06, the accession number is CCTCC NO: M2024234, and the preservation date is January 26, 2024; The preparation process of the spore solution is as follows: the strain HKL06 of Taxus chinensis var. mairei needle endophytic fungus is inoculated into a culture medium for culture, and after spores are generated, the spore solution is obtained through reduced pressure filtration.

3. The method of claim 2, wherein, The culture medium is PDB solid culture medium.

4. The method of claim 2, wherein, The culture condition is constant temperature and light-proof culture at 26-28 DEG C for 5-7 days.

5. A composition for increasing the paclitaxel content of Taxus floridiana needles, comprising, Comprising: an endophytic fungus HKL06 or a cell culture thereof; the taxonomic name of the endophytic fungus HKL06 is Diaporthe sp. Diaporthe HKL06, the deposit number is CCTCC NO: M2024234, and the deposit date is January 26, 2024.

Images