4-HIL in promoting hair follicle health, inhibiting androgenetic alopecia and dandruff generation and its applications

Abstract

The application discloses an effect of 4-HIL in promoting hair follicle health, inhibiting androgenetic alopecia and dandruff generation and application thereof, and belongs to the technical field of application of non-protein amino acids. It is found for the first time that 4-HIL has the effects of promoting hair follicle proliferation, reducing hair follicle apoptosis, increasing the number of hair follicles in a growth period and the total number of hair follicles; promoting the growth speed of androgenetic alopecia scalp hair, increasing hair length and hair weight; and inhibiting the effect of keratinocyte apoptosis caused by Malassezia. 4-HIL can be used for preparing a medicament for inhibiting androgenetic alopecia, inhibiting dandruff generation and maintaining the protection function of the stratum corneum and / or a hair washing and caring product. The 4-HIL has the advantages of good effect, high safety, good biological activity, wide application range and low price, and has a great application prospect in the preparation of products for promoting hair follicle health, inhibiting androgenetic alopecia and dandruff generation.

Description

Technical Field

[0001] This invention relates to the field of non-protein amino acid application technology, and in particular to the role and application of 4-HIL in promoting hair follicle health, inhibiting androgenetic alopecia and dandruff production. Background Technology

[0002] In today's increasingly competitive society, public health is plagued by numerous factors, with hair loss being one of the most prominent daily concerns for many Chinese people. Nearly 90% of hair loss cases in my country are androgenetic alopecia (male pattern baldness), with a prevalence of approximately 21.3% in men, increasing with age. The prevalence in women is about 6.0%. It is a progressive hair loss condition characterized by the miniaturization of hair follicles, beginning in puberty or late puberty. The main symptoms of androgenetic alopecia include an oily discharge covering the bald areas of the scalp, redness, and in severe cases, dermatitis. White dandruff is often present at the hair roots, and hair follicles are miniaturized. Hair loss begins at the crown or forehead and gradually spreads outwards until all hair on the head is lost.

[0003] Healthy hair growth is closely related to a healthy hair follicle environment. The human hair follicle is a tiny and complex organ, consisting of the hair shaft, inner root sheath, outer root sheath, and stalk tissue from the inside out. Located in the epidermis and dermis of human skin, the hair follicle is divided into an upper part (sebaceous gland, follicular protuberance, and follicular opening) and a lower part (follicular stalk and hair bulb) by the arrector pili muscle. The hair bulb further comprises hair matrix cells and dermal papilla cells. The sebaceous gland cells and dermal papilla cells are rich in androgen receptors on their surface.

[0004] The human hair cycle is generally divided into three phases: the anagen (growth) phase, the catagen (transitional) phase, and the telogen (resting) phase. The anagen phase typically lasts 2-6 years, during which the hair matrix cells at the base of the hair follicle continuously divide to form new hair. The catagen phase usually lasts for a few weeks, during which the hair follicle begins to degenerate, hair growth stops, the proliferation of hair matrix cells decreases, and the hair follicle shrinks. The telogen phase lasts for several months, during which the hair is in a dormant state. Old hair will fall out during this period, while new hair will enter the anagen phase after the telogen phase ends.

[0005] The causes of androgenetic alopecia are complex and the mechanisms are not fully understood. Modern medical research also refers to it as seborrheic alopecia, believing that a Western diet high in sugar and cholesterol, as well as a diet low in minerals, genetic factors, stress and anxiety can cause abnormal androgen secretion. Excessive sebum secretion leading to increased fungal infections is also a possible cause of androgenetic alopecia.

[0006] Testosterone acting on the skin originates from the sebaceous gland cells themselves, androgen precursors or free androgens secreted by the gonads and adrenaline, as well as exogenous androgens. When there is an excess of testosterone in the skin, under the catalysis of 5α-reductase, testosterone can be converted into dihydrotestosterone (DHT). DHT competes with testosterone for androgen receptors in hair follicle target cells. Because DHT has significantly higher activity than testosterone, its ability to bind to androgen receptors is stronger than that of testosterone. Once DHT enters the cell nucleus, on the one hand, it can promote the transcription of paracrine factors that are detrimental to hair growth, such as TGF-β and IL-6, inhibiting the growth of hair follicle cells and causing the hair follicles to enter the resting phase prematurely, leading to hair loss. On the other hand, androgens can also act on sebaceous glands, activating the SREBP pathway in sebaceous gland cells, promoting the development and differentiation of immature cells in the outer layer of sebaceous gland cells into mature secretory cells, causing sebaceous gland hypertrophy, enhanced secretory function, and excessive sebum production. Tests on the secreted oils revealed increased secretion of triglycerides, squalene, and cholesterol, with corresponding increases in the expression of enzymes that synthesize these fatty acids, such as FASN and SCD.

[0007] When sebaceous glands secrete excessive sebum, the excess sebum can clog or compress pores, hindering normal hair growth. Excessive sebum secretion can also lead to the proliferation of bacteria, fungi, or yeast on the scalp, causing an imbalance in some normal skin flora. In particular, Malassezia can induce an allergic reaction in the sebaceous glands of the scalp, breaking down triglycerides in sebum into free fatty acids, such as palmitic acid and oleic acid, which irritate hair follicles and cause inflammation. A study on androgenetic alopecia showed inflammatory infiltration of mononuclear cells and lymphocytes in 50% of scalp samples. Another recent study confirmed inflammatory infiltration of activated T cells and macrophages in the upper third of hair follicles in the transitional baldness area.

[0008] Current Western medicine treatments involve long treatment cycles and individual variations, often resulting in side effects such as decreased libido, allergic dermatitis, and anorexia. Plant and herbal extracts, rich in active ingredients and pharmacological effects, can exert anti-androgen effects through multiple pathways and targets, promoting hair growth. They hold promising potential as a drug replacement therapy. Summary of the Invention

[0009] The purpose of this invention is to provide the role and application of 4-HIL in promoting hair follicle health, inhibiting androgenetic alopecia and dandruff production, in order to provide a bioactive ingredient to solve the problems of unsatisfactory treatment effects, large individual differences and significant side effects of current androgenetic alopecia treatments.

[0010] To achieve the above objectives, this invention provides the effect of 4-HIL in inhibiting androgenetic alopecia. Applying 4-HIL promotes hair growth on the scalp after androgenetic alopecia, increases hair growth rate, hair length, hair weight, number of hair follicles in the growth phase, and total number of hair follicles, promotes hair follicle proliferation in skin tissue, and reduces hair follicle apoptosis.

[0011] Preferably, the application of 4-HIL reduces the expression of androgen receptors in the scalp, reduces the expression of fatty acid synthase genes in the scalp, and reduces lipid secretion.

[0012] Preferably, 4-HIL is applied to the scalp surface, with a concentration of 20-40 mg / mL, once daily.

[0013] The role of 4-HIL in inhibiting the growth of Malassezia; the effective concentration of 4-HIL is greater than 5 mg / mL.

[0014] The role of 4-HIL in inhibiting Malassezia-induced keratinocyte apoptosis, which includes early and late apoptosis, with a minimum effective concentration of 50 μM.

[0015] The role of 4-HIL in inhibiting sebaceous gland cell proliferation; the effective concentration of 4-HIL is 2-4 mM.

[0016] The use of 4-HIL in the preparation of dandruff-inhibiting agents and / or shampoos and / or hair care products containing 4-HIL.

[0017] The use of 4-HIL in the preparation of anti-androgenic alopecia agents and / or shampoos and / or hair care products containing 4-HIL.

[0018] The use of 4-HIL in the preparation of agents that promote hair follicle health and / or shampoos and / or hair care products containing 4-HIL.

[0019] Preferably, promoting hair follicle health includes promoting hair follicle proliferation, reducing hair follicle apoptosis, increasing the number of hair follicles in the growth phase, and increasing the total number of hair follicles.

[0020] Therefore, the specific technical effects of 4-HIL provided by this invention in promoting hair follicle health, inhibiting androgenetic alopecia and dandruff production are as follows:

[0021] (1) This invention first discovered that 4-HIL can promote hair follicle proliferation, reduce hair follicle apoptosis, and increase the number of hair follicles in the growth phase and the total number of hair follicles; by reducing the expression of androgen receptors and fatty acid synthase genes in the scalp, it can promote the growth rate of hair in androgenetic alopecia scalp and increase hair length and weight; 4-HIL can be used to prepare drugs and / or hair care products that inhibit androgenetic alopecia.

[0022] (2) This invention first discovered that 4-HIL has the effect of inhibiting keratinocyte apoptosis caused by Malassezia. Keratinocyte apoptosis is the main cause of dandruff. 4-HIL can be used to prepare agents and / or hair care products that inhibit dandruff production and maintain the protective function of the stratum corneum.

[0023] (3) 4-HIL is a non-protein amino acid isolated from fenugreek seeds. It has good effects, high safety, good biological activity, wide applicability and low price. It has great application prospects for the preparation of products that promote hair follicle health, inhibit androgenic alopecia and dandruff production. Attached Figure Description

[0024] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 This is the result of the effect of 4-HIL on the growth of Malassezia in Example 1; Part A is the result of the effect on the growth of Malassezia; Part B is the statistical result of the inhibition rate of Malassezia growth.

[0026] Figure 2 This is the statistical result of the effect of 4-HIL on pro-inflammatory factors (A) and apoptosis factors (B) in HACAT cells induced by Malassezia in Example 2;

[0027] Figure 3 The results are the flow cytometry results (A) and apoptosis rate statistics (B) from Example 2;

[0028] Figure 4 The OD values ​​at different times in each group in Example 3 490nm Statistical results; Part A presents the effects of LA (10 μM), DHT (100 nM), and different concentrations (2 mM, 4 mM) of 4-HIL alone on the proliferation of sebaceous gland cells at 24 h, 48 h, and 72 h; Part B presents the effects of different concentrations (2 mM, 4 mM) of 4-HIL on androgen-induced proliferation of sebaceous gland cells at 24 h, 48 h, and 72 h.

[0029] Figure 5The results are the quantitative fluorescence detection results of fatty acid synthase and androgen receptor in Example 3; Part A is the expression result of FASN fatty acid synthase; Part B is the expression result of SREBP-1C steroid regulatory element binding protein 1C; Part C is the expression result of SCD fatty acid desaturase; and Part D is the expression result of AR androgen receptor.

[0030] Figure 6 These are the results of Oil Red O staining in different groups in Example 3;

[0031] Figure 7 These are the Western Blot experimental results (A) and quantitative results (B) of different groups in Example 3;

[0032] Figure 8 These are photos of mice taken during the construction of the androgenic alopecia model in Example 4; Part A is a full-body photo, and Part B is a magnified photo of a randomly selected mouse.

[0033] Figure 9 These are the statistical results of hair weight (A), hair length (B), number of hair follicles (C), and number of hair follicles in the anagen and telogen phases (D) of different groups in Example 4.

[0034] Figure 10 These are HE pathological sections from different groups during the construction of the androgenic alopecia model in Example 4;

[0035] Figure 11 The images show the mice in each group during the study of the effects of 4-HIL on androgenetic alopecia mice in Example 4, including (A), total number of hair follicles (B), hair length (C), number of hair follicles in the anagen and telogen phases (D), and hair weight (E).

[0036] Figure 12 These are HE pathological sections of skin from different groups during the investigation of the effects of 4-HIL on androgenetic alopecia mice in Example 4;

[0037] Figure 13 This refers to the immunohistochemical results of skin androgen receptors in Example 4 when examining the effects of 4-HIL on androgen-induced alopecia mice;

[0038] Figure 14 The results of Oil Red O staining of skin in Example 4 to investigate the effect of 4-HIL on androgenetic alopecia mice are as follows: (A), triglyceride expression level (B), SCD mRNA expression level (C), FASN mRNA expression level (D), and SRBP-1C mRNA expression level (E).

[0039] Figure 15 This is the statistical result of skin inflammatory factor gene expression when examining the effect of 4-HIL on androgenetic alopecia mice in Example 4;

[0040] Figure 16 This is the result of examining the expression level of key enzyme protein in skin fatty acid synthesis in Example 4 when investigating the effect of 4-HIL on androgenetic alopecia mice;

[0041] Figure 17 This refers to the immunohistochemical detection results of skin inflammatory factors when examining the effects of 4-HIL on androgenetic alopecia mice in Example 4;

[0042] Figure 18 The results of Example 4 are: (A) the expression of pro-apoptotic factor mRNA in mouse skin during the investigation of the effect of 4-HIL on androgenetic alopecia mice; (B) the TUNEL staining results; and (C) the results of Ki67 proliferation marker expression detection. Detailed Implementation

[0043] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0044] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all illustrations of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0045] All instruments, equipment, and reagents used in the examples were obtained commercially. 4-HIL (4-hydroxyisoleucine) was purchased from Henan Julong Biotechnology Co., Ltd., with a purity >98%. Malassezia furfur was purchased from Shanghai Preservation Biotechnology Center, strain number SMHCC(SHBCC)D10558. HACAT (human immortalized keratinocytes) was purchased from Wuhan Sewell Biotechnology Co., Ltd. SZ95 cells were purchased from Beijing Yunclone Biotechnology Co., Ltd. SPF-grade C57BL / 6 mice were purchased from Henan Skebest Biotechnology Co., Ltd., and were housed at the SPF-grade Animal Experiment Center of Zhengzhou University, strictly adhering to SPF-grade standards.

[0046] Example 1

[0047] The effect of 4-HIL on the growth of Malassezia was investigated using Malassezia furfur (a type of Malassezia) as the test strain. The specific steps are as follows:

[0048] After activating and expanding the culture of the purchased Malassezia furfur, Malassezia in the logarithmic growth phase was collected to prepare a bacterial concentration of 1×10⁻⁶. 7 CFUs / mL, 4-HIL solution was added to final concentrations of 0, 5, 10, 20, and 40 mg / mL, respectively. After mixing, the OD of the bacterial culture was measured at different time points. 600The absorbance was measured to investigate the inhibitory effect of 4-HIL on the growth of Malassezia. The inhibition rate of 4-HIL on Malassezia was calculated using the following formula:

[0049]

[0050] Blank A represents the OD of Malassezia bacterial suspension without any added drugs. 600 Absorbance represents the maximum growth of the bacterial culture; Sample A is the OD of bacterial cultures after adding different concentrations of 4-HIL. 600 Absorbance reflects the inhibitory effect of 4-HIL on the growth of Malassezia.

[0051] The results are as follows Figure 1 As shown in the figure, Part A represents the effect of 0-40 mg / mL 4-HIL on the growth of Malassezia; Part B represents the inhibition rate of 4-HIL on the growth of Malassezia. The figure shows that 5 mg / mL 4-HIL inhibited the growth of Malassezia by 13%, 10 mg / mL 4-HIL by 22%, 20 mg / mL 4-HIL by 36%, and 40 mg / mL 4-HIL by 56%.

[0052] Example 2

[0053] The effects of 4-HIL on HACAT cells were investigated using Malassezia furfur as the test bacterium. The specific steps are as follows:

[0054] (1) Investigate the effects of 4-HIL on inflammatory factors and apoptosis factors in Malassezia-induced HACAT cells.

[0055] S21. Adjust the amount of Malassezia furfur in the logarithmic growth phase to 1×10⁻⁶. 7 CFUs / mL, after incubation at 30℃ for 16h, the bacterial cells were disrupted by ultrasonic disruption in a low-temperature ice-water bath (3s on, 5s off, 15min total), centrifuged at 12000r / min for 10min at 4℃ (repeated 3 times), the supernatant was collected, and the Malassezia bacterial suspension was obtained by filtration through a 0.22μM filter and stored at -80℃ for later use.

[0056] S22. Take HACAT cells in the logarithmic growth phase at a concentration of 1.5 × 10⁻⁶. 52 mL of the culture medium was seeded per well into 6-well plates at a concentration of 1 / mL and cultured in DMEM medium supplemented with penicillin (100 U / mL), streptomycin (100 μg / mL), and 10% fetal bovine serum (FBS). The cells were cultured overnight at 37°C with 5% CO2 until adherence. The original culture medium was then discarded. The control group received 2 mL of the aforementioned DMEM medium, the Stimuate group received 2 mL of the Malassezia suspension prepared in step S21 (final concentration 1%), the Stimuate+50 μM 4-HIL group received 2 mL of both the 1% suspension and 50 μM 4-HIL, and the Stimuate+100 μM 4-HIL group received 2 mL of both the 1% suspension and 100 μM 4-HIL. The cells were divided into three groups: a 4-HIL group, a 1% Malassezia bacterial suspension prepared in step S21, and a 200μM 4-HIL group (Stimuate + 200μM 4-HIL). Each group had three replicates. After incubation in a cell culture incubator at 37℃ with 5% CO2 for 24 hours, RNA was extracted from cells in different treatment groups using a kit. The RNA quality was then assessed, and high-quality RNA was selected for reverse transcription into cDNA using a reverse transcription kit.

[0057] S23. Using the primers for inflammatory and apoptotic factors shown in Table 1, and the obtained cDNA as a template, qRT-PCR was performed using the LightCycler 480 SYBR Green I Master kit prepared according to the accompanying instructions. The qRT-PCR program was: 95℃ for 10 min; 95℃ for 10 s, 60℃ for 20 s, 45 cycles; 95℃ for 5 s, 65℃ for 1 min; 40℃ for 30 s. Quantitative detection and melting curve analysis were then performed. Each sample was tested in triplicate.

[0058] Table 1

[0059] Primer name Primer sequences (5′-3′) β-actin-F GGCTCTTTTCCAGCCTTCCT(SEQ ID NO.1) β-actin-R AATGCCAGGGTACATGGTGG(SEQ ID NO.2) IL6-F TAGTGAGGAACAAGCCAGAGC(SEQ ID NO.3) IL6-R GTTGGGTCAGGGGTGGTTATT(SEQ ID NO.4) TNFα-F GCTGCACTTTGGAGTGATCG(SEQ ID NO.5) TNFα-R CTTGTCACTCGGGGTTCGAG(SEQ ID NO.6) IL1α-F CTGGGAAACTCACGGCACTA(SEQ ID NO.7) IL1α-R CCAAGCACACCCAGTAGTCT(SEQ ID NO.8) Bax-F TCATGGGCTGGACATTGGAC(SEQ ID NO.9) Bax-R GCGTCCCAAAGTAGGAGAGG(SEQ ID NO.10) Bcl2-F GAACTGGGGGAGGATTGTGG(SEQ ID NO.11) Bcl2-R GCCGGTTCAGGTACTCAGTC(SEQ ID NO.12) Caspase 8-F CTCGGACTCTCCAAGAGAACAG(SEQ ID NO.13) Caspase 8-R GTCATCGTGGGGCTTGATCT(SEQ ID NO.14)

[0060] The results are as follows Figure 2As shown, 1% Malassezia bacterial suspension significantly increased the secretion of pro-inflammatory factors (IL6, IL-1α, TNFα) and apoptosis factors (Bax, Capase 8) in HACAT cells. 4-HIL inhibited the increase in inflammatory factors (IL6, IL-1α, TNFα) and the significant increase in apoptosis factors (Bax, Capase 8) induced by 1% Malassezia bacterial solution. *** indicates P < 0.001 compared to the Control group; ## indicates P < 0.01 compared to Stimulate; ### indicates P < 0.001 compared to Stimulate.

[0061] (2) Effect of 4-HIL on Malassezia-induced apoptosis in HACAT cells

[0062] S24. Following the procedures in steps S21 and S22, gently pipette the cells from each treatment (incubated for 24 hours in step S22) into PBS (pH 7.2), transfer them to EP tubes, centrifuge, discard the supernatant, add pre-chilled PBS (pH 7.2) at 4°C, and gently vortex to mix. Then add 5 μL Annexin V and 10 μL LPI respectively, and incubate at 4°C in the dark for 10 min. After incubation, the apoptosis rate was detected by flow cytometry. Results are as follows. Figure 3 As shown, 1% Malassezia solution induced early and late apoptosis in HACAT cells. 4-HIL significantly slowed down both early and late apoptosis induced by 1% Malassezia, with the best effect observed at the lowest dose. *** indicates P < 0.001 compared to the Control group; ## indicates P < 0.01 compared to the Stimulate group; ### indicates P < 0.001 compared to the Stimulate group.

[0063] Example 3

[0064] The effects of 4-HIL on SZ95 cells (human sebaceous gland cells) were investigated using the following steps:

[0065] (1) Effect of 4-HIL on androgen-induced growth of SZ95 cells.

[0066] S31. Collect and count SZ95 cells in the logarithmic growth phase, then count them under a microscope using a cell counting chamber, adjusting the cell count to 2.5 × 10⁻⁶. 4 Single cells / mL were evenly seeded into 96-well plates using a pipette, 100 μL per well, and incubated overnight in a 5% CO2, 37°C incubator.

[0067] S32, starvation treatment: After observing cell adhesion under a microscope, discard the old culture medium and add 200 μL of serum-free DMEM medium to continue culturing for 8 h.

[0068] S33. Discard the culture medium. Add 200 μL of DMEM medium containing only DMEM and designate it as the normal control group (Control). Add 200 μL of DMEM medium containing only 10 μM linoleic acid and designate it as the LA group. Add 200 μL of DMEM medium containing only 100 nmM DHT and designate it as the DHT group. Add 200 μL of DMEM medium containing only 2 mM 4-HILDMEM and designate it as the 2 mM 4-HIL group. Add 200 μL of DMEM medium containing only 4 mM 4-HILDMEM and designate it as the 4 mM 4-HIL group. Add 200 μL of DMEM medium containing a final concentration of 10 μM linoleic acid and 100 nmM DHT and designate it as the LA+DHT group. Add 200 μL of DMEM medium containing a final concentration of 10 μM linoleic acid + 100 nM DHT + 2 mM 4-HIL and designate it as the LA+DHT+2 mM 4-HIL group. Add 200 μL of DMEM medium containing a final concentration of 10 μM linoleic acid + 100 nM DHT + 2 mM 4-HIL and designate it as the LA+DHT+2 mM 4-HIL group. The DMEM medium containing DHT + 4mM 4-HIL was designated as the LA + DHT + 4mM 4-HIL group. 200 μL of PBS (pH 7.2) was added to the blank wells surrounding the cell wells. Cells were cultured in a 5% CO2, 37°C incubator for 24 h, 48 h, and 72 h, respectively. Then, at 20 h, 44 h, and 68 h, 20 μL of LTT was added to each well in the dark, and the cells were cultured for another 4 h. The supernatant was discarded, and 150 μL of DMSO was added to each well, followed by vortexing to mix. The absorbance was read at 490 nm using a microplate reader. Results are as follows: Figure 4 As shown, there was no difference in cell proliferation among the groups within 24 hours. Within 48 hours, LA and DHT significantly promoted the proliferation of SZ95 cells, with LA+DHT being more significant. 4-HIL alone inhibited SZ95 cell proliferation, and the inhibitory effect increased with increasing dose. The 4-HIL treatment group significantly inhibited LA+DHT-induced SZ95 cell proliferation. The change in cell number within 72 hours was the same as within 48 hours. * indicates P<0.05 compared to the Control group; ** indicates P<0.01 compared to the Control group; # indicates P<0.05 compared to LA+DHT; ## indicates P<0.01 compared to LA+DHT; ### indicates P<0.001 compared to LA+DH.

[0069] (2) Effects of 4-HIL on androgen-induced fatty acid synthase and androgen receptor in SZ95 cells.

[0070] S34. Take SZ95 cells in the logarithmic growth phase at a dose of 1×10⁻⁶. 52 mL of DMEM medium containing penicillin (100 U / mL), streptomycin (100 μg / mL), and 10% fetal bovine serum (FBS) was seeded into 6-well plates and cultured overnight at 37°C with 5% CO2. After cell attachment, the original medium was discarded. Two groups were added: a control group (LA) containing 2 mL of DMEM medium containing only 10 μM linoleic acid; a control group (LA) containing 2 mL of DMEM medium containing 10 nM DHT; a control group (LA+DHT) containing 2 mL of DMEM medium containing 10 μM linoleic acid and 100 nM DHT; and a control group (LA+DHT+2 mM 4-HIL) containing 2 mL of DMEM medium containing 10 μM linoleic acid, 100 nM DHT, and 2 mM 4-HIL. The 4-HIL group was designated as LA+DHT+4mM 4-HIL group, containing 2 mL of DMEM medium with a final concentration of 10 μM linoleic acid, 100 nM DHT, and 4 mM 4-HIL. Each group had three replicates. After incubation at 37°C and 5% CO2 for 24 h, RNA was extracted from cells in different treatment groups using a kit. RNA quality was then assessed, and high-quality RNA was selected for reverse transcription into cDNA using a reverse transcription kit. Using the primers shown in Table 2 and the obtained cDNA as a template, quantitative real-time PCR was performed according to the kit instructions, following the same procedure as in S23.

[0071] Table 2

[0072] Primer name Primer sequences (5′-3′) SREBP-1C-F TGTGACCTCGCAGATCCAG(SEQ ID NO.15) SREBP-1C-R CAGAGACCAGGGGACTGAGA(SEQ ID NO.16) FASN-F CAGGCACACACGATGGAC(SEQ ID NO.17) FASN-R CGGAGTGAATCTGGGTTGAT(SEQ ID NO.18) SCD-F CTGGCTTGCTGATGATGTGC(SEQ ID NO.19) SCD-R CGCAAGAAAGTGGCAACGAA(SEQ ID NO.20) AR-F GGTGAGCAGAGTGCCCTATC(SEQ ID NO.21) AR-R GCAGTTCCCAAACGCATGTC(SEQ ID NO.22)

[0073] The results are as follows Figure 5 As shown, LA and DHT alone did not significantly induce the expression of FASN, SCD, SREBP-1c, and AR in SZ95 cells compared to the control group. However, the LA+DHT group significantly induced the expression of FASN, SCD, SREBP-1c, and AR compared to the control group. 4-HIL treatment significantly inhibited the expression of FASN, SCD, SREBP-1c, and AR induced by LA+DHT. The effect was more pronounced with increasing dosage. * indicates P<0.05 compared to the control group; ** indicates P<0.01 compared to the control group; *** indicates P<0.001 compared to the control group; # indicates P<0.05 compared to LA+DHT; ## indicates P<0.01 compared to LA+DHT; ### indicates P<0.001 compared to LA+DH.

[0074] S35 and Oil Red O assays were performed using SZ95 cells at a concentration of 1×10⁻⁶. 5The cells were seeded at the density specified in the S34 wells and cultured overnight in a cell culture incubator at 37°C and 5% CO2 until adherence. Afterward, the cells were grouped and treated as in S34, and cultured for another 48 hours in a cell culture incubator at 37°C and 5% CO2. The cells were centrifuged, the supernatant was discarded, and the cells were washed once with PBS (pH 7.2). The cells were then fixed with 4% paraformaldehyde for half an hour, the supernatant was discarded, and the cells were washed once with PBS (pH 7.2). Preparative Oil Red O staining solution was added to the wells and stained at room temperature in the dark for 10 minutes. Excess staining solution was discarded, and the cells were differentiated with 60% isopropanol for a few seconds, then discarded. PBS (pH 7.2) was added, and the cells were observed and photographed under an inverted microscope.

[0075] The results are as follows Figure 6 As shown, the LA and DHT groups induced lipid content in SZ95 cells compared to the Control group, and the LA+DH group showed a more significant induction effect than LA or DHT alone. The 4-HIL administration group inhibited lipid production induced by the LA+DH group, with the high-dose group showing a more pronounced effect.

[0076] S36. Western Blot Experiment: Following the method in step S35, cells were obtained into the Control group, LA group, DHT group, DHT+LA group, DHT+LA+2mM 4-HIL group, and DHT+LA+4mM 4-HIL group for Western Blot experiments. The results are as follows: Figure 7 As shown, the LA+DHT group significantly induced the expression of FASN, SCD, and SREBP-1c proteins compared to the control group. The 4-HIL treatment group significantly inhibited the expression of FASN, SCD, and SREBP-1c proteins induced by the LA+DHT group. * indicates P<0.05 compared to the control group; ** indicates P<0.01 compared to the control group; *** indicates P<0.001 compared to the control group; # indicates P<0.05 compared to LA+DHT; ## indicates P<0.01 compared to LA+DHT; ### indicates P<0.001 compared to LA+DH.

[0077] Example 4

[0078] The effects of 4-HIL on androgenetic alopecia mice were investigated using the following steps:

[0079] S41. Construct a mouse model of androgenetic alopecia. Healthy, clean-grade male C57BL / 6 mice (SPF grade) weighing approximately 18-20g and aged 4-5 weeks were used. They were fed with sterile drinking water and sterile feed for one week under conditions of approximately 60% humidity, 25℃, and 12h light-dark alternation. After no abnormalities were observed, the experiment began.

[0080] In a clean bench, testosterone propionate solution was diluted to 1 mg / mL with injectable soybean oil, sonicated for 10 min, and then thoroughly mixed using a vortex mixer. The solution was then injected into the back of mice via multiple skin injections, with a total dose of 0.1 mL per mouse. Injections were administered once daily for 28 consecutive days; this group was designated as the model group. Mice injected with an equal volume of injectable soybean oil under the same conditions were designated as the model control group. Mice injected with an equal volume of physiological saline under the same conditions were designated as the blank control group. Each group was replicated with 5 mice.

[0081] Mice in each group were observed and photographed every 7 days, such as Figure 8 As shown in Parts A and B, compared with the blank control group, the model solvent group had shiny fur and no hair loss. Compared with the blank control group, all mice in the model group experienced hair loss, accompanied by fighting and biting. Compared with the model control group, the model group mice had oily fur. After 3 weeks, the fur on the backs of the model group mice was oily, and hair loss gradually occurred after 3 weeks, resulting in sparse fur.

[0082] After the last administration, three model group mice were randomly selected and fasted for 12 hours. Blood was collected from the eyeballs, and the mice were euthanized by cervical dislocation. The blood was allowed to stand at room temperature for 30 minutes to coagulate naturally, then centrifuged at 3500 rpm for 10 minutes. The supernatant was then sent to the hospital to detect the hormone content in the blood. The same method was used to detect the hormone content in the blood of mice in the blank control group and the model control group. The results are shown in Table 3.

[0083] Table 3

[0084] Group T content (ng / mL) E2 content (ng / mL) T / E2 Blank control group 0.74±0.79 32.42±1.60 0.02±0.02 Model control group 0.90±1.17 38.51±5.00 0.03±0.04 Model group 10.36±1.14*** 40.24±1.37 0.26±0.02***

[0085] Compared with the blank control group and the model control group, the serum androgen levels and the estradiol / androgen ratio of the model group mice were significantly increased. ***P<0.001 compared with the model control group.

[0086] Simultaneously, using ophthalmic scissors, 15 hairs were randomly plucked from the backs of mice euthanized after blood collection, and their length and weight were recorded. After hair removal from the mice's backs, a skin tissue sample of approximately 1.5cm × 1.5cm was taken and placed in a 15mL centrifuge tube for fixation in a 10% formaldehyde solution. The collected tissue underwent routine dehydration, paraffin embedding, sectioning, and hematoxylin-eosin (HE) staining. The total number of hair follicles and their stage of development were counted under a standard optical microscope, and the morphology of the hair follicles was observed.

[0087] The results are as follows Figure 9 and Figure 10As shown, the hair length, hair weight, total number of hair follicles, and number of anagen / telogen phases in the model group were significantly lower than those in the blank control group. HE pathological section observation revealed that hair follicles in the blank and model control groups were in the anagen phase, while in the model group, the hair matrix was atrophied, the dermal papilla was shrunken, and the hair bulb showed signs of regression or telogen.

[0088] The above results prove that the androgen-induced alopecia mouse model has been successfully established.

[0089] S42. Investigate the effects of 4-HIL on androgen-induced alopecia mice.

[0090] Mice that successfully developed the model in step S41 were selected. The central area of ​​the mice's backs was shaved with a shaver, and then the shaved area was thoroughly dehaired using a depilatory cream according to the accompanying instructions to remove any remaining hair. Mice with 20 mg / mL 4-HIL aqueous solution were applied to the backs of the thoroughly hairless mice, 0.2 mL each time, once daily, and were designated as the 20 mg / mL 4-HIL group. Mice with the same treatment and an equal volume of 40 mg / mL 4-HIL aqueous solution were designated as the 40 mg / mL 4-HIL group. Mice with the same treatment and an equal volume of physiological saline were designated as the control group. Mice with the same treatment and an equal volume of 1% azone aqueous solution were designated as the model group. During the experiment, all groups of mice were fed according to standard feeding practices.

[0091] 1) Observe and photograph the backs of mice in each group every 7 days, and pay attention to monitoring any abnormalities in the skin at the drug administration site, such as redness, swelling, blisters, ulceration, erosion and other contact dermatitis-like symptoms. At the same time, observe any changes in the mice's living habits, eating habits and other aspects, and make corresponding records.

[0092] Photos Figure 11 As shown in Part A, the hair growth of mice in the model group was slow, and after 28 days, the hair was sparse, fragile, and dull in color; the hair growth of mice in the 20mg / mL 4-HIL group and the 40mg / mL 4-HIL group was faster, and after 28 days, the hair was thick, strong, and shiny.

[0093] 2) On the second day after the last application of medication (i.e., the 30th day after hair removal), the mice were euthanized by removing white hair from their cervical spine. Fifteen hairs were randomly plucked from each mouse in the hair removal area, and photographs were taken to compare the length of the newly grown hair. A 2cm × 2cm skin flap was cut from the same area within the hair removal region of each mouse using a blade and scissors. All hair on the skin flap was then scraped off with a scalpel, weighed, and the mean hair weight of each group was calculated. One-way ANOVA was used to analyze the hair weight of each group using Prism8 software.

[0094] The results are as follows Figure 11As shown in Part B, the 4-HIL treatment group had significantly higher hair length, hair weight, total number of hair follicles, and number of hair follicles in the growth phase than the model group. * indicates P < 0.05 compared to the Control group; ** indicates P < 0.01 compared to the Control group; *** indicates P < 0.001 compared to the Control group; # indicates P < 0.05 compared to the Model group; ## indicates P < 0.01 compared to the Model group; ### indicates P < 0.001 compared to the Model group.

[0095] 3) After the last administration, three model group mice were randomly selected and fasted for 12 hours. After anesthesia and cervical dislocation, several pieces of skin tissue, approximately 1.5cm × 1.5cm in area, were harvested from the bald area on the back of the mice using ophthalmic scissors. Some of the tissue was treated with liquid nitrogen and frozen at -80℃, while the rest was placed in centrifuge tubes and fixed in 10% formaldehyde solution. The harvested tissues underwent routine dehydration, paraffin embedding, sectioning, and HE staining. The total number of hair follicles and their stage of development were counted under a regular optical microscope, and the morphology of the hair follicles was observed.

[0096] The results are as follows Figure 12 As shown, compared with the control group, the model group had fewer hair follicles, vacuolized hair follicles, shrunken hair papillae, and hair follicles that lost their normal morphology, with most of them in the resting or regression phase. In the drug-treated group, the hair follicles were tightly arranged, structurally intact, and mostly in the growth phase.

[0097] 4) Skin tissue from each group of mice was collected and sent to the company for androgen receptor immunohistochemical analysis. Results are as follows: Figure 13 As shown, androgen receptor expression was increased in the androgen sebaceous glands and dermal papillae of the model group compared to the control group, while androgen receptor expression in the hair follicles of the 4-HIL treatment group was significantly reduced, indicating that 4-HIL can reduce androgen receptor expression.

[0098] 5) Skin tissue samples from each group of mice were collected and sent to the company for Oil Red O assay. Results are as follows: Figure 14 As shown in Part A, the expression of lipids in the back skin of the model group mice was significantly increased compared with that of the control group, while the lipid secretion in the skin of the 4-HIL treatment group was significantly reduced compared with that of the model group, indicating that 4-HIL can reduce the secretion of lipids in the skin. The effect is more obvious with increasing dose, indicating that 4-HIL can reduce the lipid content in the skin.

[0099] 6) Accurately weigh 20g of skin tissue, add 180mL of homogenizing medium, mechanically homogenize under ice-water bath conditions, centrifuge at 2500r / min for 10min, and add 2.5μL of supernatant + 250μL of working solution to a 96-well plate as sample wells. Wells containing 2.5μL of calibrator + 250μL of working solution are used as standard wells, and wells containing 2.5μL of distilled water + 250μL of working solution are used as blank wells. Shake the plate to mix, then incubate at 37℃ for 10min. OD 500nm The absorbance values ​​of each well were measured, and the concentration of triglycerides in the skin was calculated using the following formula:

[0100]

[0101] Where W is the tissue weight (g), V 提取液 This represents the total volume of the homogenate added.

[0102] Statistical analysis was performed using one-way ANOVA with Prism8 software.

[0103] like Figure 14 As shown in Part B, the expression of triglycerides in the back skin of mice in the model group was significantly higher than that in the control group, while the secretion of triglycerides in the skin of the 4-HIL treatment group was significantly lower than that in the model group, indicating that 4-HIL can reduce the secretion of triglycerides in the skin, and the effect is more obvious with increasing dose.

[0104] 7) Take 100g of back skin from each group of mice, extract total RNA using a kit, reverse transcribe it into cDNA, and use the primers shown in Table 4 for quantitative real-time PCR to investigate the expression of fatty acid synthase, inflammatory factors and apoptosis factors in mouse skin tissue.

[0105] Table 4

[0106]

[0107]

[0108] The results are as follows Figure 14As shown in Part C, the expression of key enzymes FASN, SCD, and SREBP-1c in the dorsal skin of the model group mice was significantly increased compared with the control group, while the expression of key enzymes FASN, SCD, and SREBP-1c in the skin of the 4-HIL treatment group was significantly decreased compared with the model group, indicating that 4-HIL can reduce the expression level of fatty acid synthase genes in the skin. * indicates P<0.05 compared with the control group; ** indicates P<0.01 compared with the control group; *** indicates P<0.001 compared with the control group; # indicates P<0.05 compared with the model group; ## indicates P<0.01 compared with the model group; ### indicates P<0.001 compared with the model group.

[0109] like Figure 15 As shown, the expression of IL6, IL-1β, TNFα, and TLR2 in the dorsal skin of mice in the model group was significantly increased compared with that in the control group, while the expression levels of IL6, IL-1β, TNFα, and TLR2 in the skin of the 4-HIL treatment group were significantly decreased compared with those in the model group, indicating that 4-HIL can reduce the expression levels of inflammatory cytokine genes in the skin. * indicates P < 0.05 compared with the control group; ** indicates P < 0.01 compared with the control group; *** indicates P < 0.001 compared with the control group; # indicates P < 0.05 compared with the model group; ## indicates P < 0.01 compared with the model group; ### indicates P < 0.001 compared with the model group.

[0110] 8) The expression level of fatty acid synthase protein in mouse dorsal skin was detected by Western blot. Results are as follows: Figure 16 As shown, the expression of key enzymes FASN, SCD, and SREBP-1c in the dorsal skin of mice in the model group was significantly increased compared with the control group, while the expression of key enzymes FASN, SCD, and SREBP-1c in the skin of the 4-HIL treatment group was significantly decreased compared with the model group, indicating that 4-HIL can reduce the expression level of fatty acid synthase proteins in the skin. * indicates P<0.05 compared with the control group; ** indicates P<0.01 compared with the control group; *** indicates P<0.001 compared with the control group; # indicates P<0.05 compared with the model group; ## indicates P<0.01 compared with the model group; ### indicates P<0.001 compared with the model group.

[0111] 9) The TUNEL staining method was used to detect hair follicle apoptosis in the skin.

[0112] like Figure 17The apoptotic cells in the back skin of the model group mice were mostly concentrated in the epidermis, and their expression was significantly increased compared with the control group. The expression of apoptotic cells in the skin of the 4-HIL treatment group was significantly reduced compared with the model group, indicating that 4-HIL can reduce the apoptosis of hair follicles in skin tissue.

[0113] 10) Immunofluorescence detection of Ki67 proliferation marker expression in mouse skin

[0114] like Figure 18 The results showed that Ki67 expression was concentrated in the hair bulb of the hair follicle. Compared with the control group, Ki67 expression in the model group was significantly reduced, while Ki67 expression in the hair bulb of the hair follicle in the 4-HIL treatment group was significantly increased compared with the model group, indicating that 4-HIL can promote the expression of the proliferative marker Ki67 in the hair follicle.

[0115] Therefore, this invention is the first to discover that 4-HIL promotes hair follicle proliferation, reduces hair follicle apoptosis, increases the number and total number of hair follicles in the growth phase; promotes the growth rate of hair on the scalp in androgenetic alopecia, and increases hair length and weight; and inhibits keratinocyte apoptosis induced by Malassezia. 4-HIL can be used to prepare agents and / or hair care products that inhibit androgenetic alopecia, inhibit dandruff production, and maintain the protective function of the stratum corneum. It has good efficacy, high safety, good bioactivity, wide applicability, and low price, and has great application prospects in the preparation of products that promote hair follicle health and inhibit androgenetic alopecia and dandruff production.

[0116] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

The application of 1,4-HIL in the preparation of products that inhibit the growth of Malassezia, characterized by: The effective concentration of 4-HIL in the product is greater than 5 mg / mL.

Images