Application of dendritic cells in prevention and / or treatment of demyelination diseases

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of a dendritic cell in prevention and / or treatment of demyelination diseases, the Talin1 protein expression level in the dendritic cell is reduced or no Talin1 protein is expressed, the dendritic cell is loaded with myelin peptide, immune inflammation and nerve injury can be safely and effectively relieved, and the application of the dendritic cell in prevention and / or treatment of the demyelination diseases is promoted. Therefore, the compound is expected to be developed into a novel therapy for preventing and / or treating demyelination diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an application of dendritic cells in preventing and / or treating demyelinating diseases. Background Art

[0002] Demyelinating diseases are a group of diseases characterized by the loss of myelin sheaths in nerve fibers, with relatively mild involvement of neuronal cell bodies and axons. They include two major categories: hereditary and acquired. Acquired demyelinating diseases are further divided into central and peripheral categories. The most representative peripheral demyelinating diseases are acute and chronic inflammatory demyelinating polyneuropathies, while demyelinating diseases of the central nervous system include multiple sclerosis (MS), acute disseminated encephalomyelitis (ADEM), and neuromyelitis optica spectrum disorder (NMOSD). Among them, MS is the most common demyelinating disease of the central nervous system, which can cause visual impairment and movement disorders, seriously affecting the quality of life. Clinically, drugs such as teriflunomide, dimethyl fumarate, beta interferon and hormones are often used to alleviate the progression and recurrence of the disease. However, they have disadvantages such as drug tolerance, toxicity and large side effects. In particular, the risk of malignant tumors and opportunistic infections is significantly increased due to extensive immunosuppression.

[0003] Dendritic cells (DC) are the most powerful antigen-presenting cells in the body and the only antigen-presenting cells that can activate naive T cells. They participate in antigen recognition, processing and presentation, are the initiators of the body's immune response, and play a key role in the induction of immune responses. According to their maturity, they can be divided into immature DCs and mature DCs. Under normal circumstances, the vast majority of DCs in the body are in an immature state, with strong antigen capture and processing capabilities, but lack the ability to activate T cells. After receiving antigen stimulation, DCs gradually mature and migrate to secondary lymphoid organs. Mature DCs in secondary lymphoid organs lose the ability to process antigens, but gain the ability to activate naive T cells, which can activate T cells and induce immune responses. Therefore, immature DCs can induce immune tolerance, while mature DCs can induce immune activation (see non-patent literature: The role of dendritic cells in immune response and its clinical significance, Chinese Journal of Obstetrics and Gynecology (Electronic Edition) April 2009, Vol. 5, No. 2). Summary of the invention

[0004] To make up for the gaps in the prior art, the present invention can be used to prevent and / or treat demyelinating diseases, especially central demyelinating diseases, by downregulating Talin 1 in dendritic cells. The specific scheme is as follows: The first aspect of the present invention provides a use of dendritic cells in the preparation of a drug for preventing and / or treating demyelinating diseases, wherein the expression level of Talin1 protein in the dendritic cells is reduced or not expressed.

[0005] The dendritic cells include dendritic cells in the skin, airway, spleen, blood, lymph or bone marrow, preferably dendritic cells in lymph or bone marrow.

[0006] In a specific embodiment of the present invention, the dendritic cells are dendritic cells in the bone marrow.

[0007] The Talin1 gene is knocked out or knocked down in the dendritic cells.

[0008] Preferably, the knockout method includes CRISPR / Cas9, Cre / LoxP system, Gin / Gix system, FLP / FRT system or R / RS system.

[0009] Preferably, the knockdown method comprises RNA interference.

[0010] The shRNA sequence targeting the Talin1 gene in the RNA interference includes CCAAATGGCCCAGTACTTTTT (SEQID NO: 2).

[0011] The vector used in the RNA interference includes a viral vector or a non-viral vector. Preferably, it is a viral vector. Further preferably, the viral vector includes a lentiviral vector, an adenoviral vector, an AAV viral vector or a piggyBac vector.

[0012] In a specific embodiment of the present invention, the vector is a lentiviral vector.

[0013] The dendritic cells are loaded with myelin peptides.

[0014] The myelin peptides include myelin basic protein peptide (MBP), myelin oligodendrocyte glycoprotein peptide (MOG), proteolipid protein peptide (PLP) or myelin associated glycoprotein peptide (MAG).

[0015] Preferably, the myelin peptide is MOG peptide. Further preferably, the MOG peptide is MOG35-55 peptide segment (as shown in SEQ ID NO: 5).

[0016] The demyelinating disease includes hereditary demyelinating disease or acquired demyelinating disease.

[0017] Preferably, the acquired demyelinating disease includes central demyelinating disease.

[0018] Further preferably, the acquired demyelinating disease is a central demyelinating disease.

[0019] Further preferably, the central demyelinating disease is multiple sclerosis (MS), acute disseminated encephalomyelitis or neuromyelitis optica spectrum disorder.

[0020] The prevention and / or treatment comprises administering the drug to a subject.

[0021] The administration method includes, but is not limited to, intradermal injection, subcutaneous injection, intramuscular injection or intravenous injection.

[0022] In a specific embodiment of the present invention, the administration method is intravenous injection.

[0023] The second aspect of the present invention provides a dendritic cell, wherein the expression level of Talin1 protein in the dendritic cell is reduced or not expressed, and the dendritic cell is loaded with myelin peptide.

[0024] Preferably, the myelin peptide comprises myelin basic protein peptide (MBP), myelin oligodendrocyte glycoprotein peptide (MOG), proteolipid protein peptide (PLP) or myelin associated glycoprotein peptide (MAG).

[0025] Further preferably, the myelin peptide is MOG.

[0026] Further preferably, the myelin peptide is the MOG35-55 peptide segment (as shown in SEQ ID NO: 5).

[0027] The dendritic cells include dendritic cells in the skin, airways, spleen, blood, lymph or bone marrow.

[0028] Knocking out or knocking down the Talin1 gene in the dendritic cells; Preferably, the knockout method includes CRISPR / Cas9, Cre / LoxP system, Gin / Gix system, FLP / FRT system or R / RS system; Preferably, the knockdown method comprises RNA interference.

[0029] The third aspect of the present invention provides a method for preparing dendritic cells as described in the second aspect, the preparation method comprising: knocking out or knocking down Talin1 gene in dendritic cells loaded with myelin peptide.

[0030] Preferably, the knockout method includes CRISPR / Cas9, Cre / LoxP system, Gin / Gix system, FLP / FRT system or R / RS system.

[0031] Preferably, the knockdown method comprises RNA interference.

[0032] The shRNA sequence targeting the Talin1 gene in the RNA interference includes CCAAATGGCCCAGTACTTTTT (SEQID NO: 2).

[0033] Preferably, the preparation method comprises: adding MOG35-55 peptide to dendritic cells with Talin1 gene knocked out or knocked down and treating with LPS for 12-48 hours (preferably 24 hours) to obtain the peptide.

[0034] The fourth aspect of the present invention provides a drug for preventing and / or treating demyelinating diseases, wherein the drug comprises the dendritic cells described in the second aspect or the dendritic cells obtained by the preparation method described in the third aspect.

[0035] The fifth aspect of the present invention provides a method for preventing and / or treating demyelinating diseases, which comprises administering to a subject an effective amount of the dendritic cells described in the second aspect, or the dendritic cells obtained by the preparation method described in the third aspect, or the drug described in the fourth aspect.

[0036] In a specific embodiment of the present invention, the subject is a human. Preferably, the drug is administered once every 2 weeks, for a total of 3 times. Preferably, the administration method may be intravenous injection. Preferably, the total administration dose is 1×10 6 ~5×10 9 The number of dendritic cells is preferably 5×10 6 ~3×10 9 of dendritic cells.

[0037] As used herein, "treating" means slowing, interrupting, preventing, controlling, stopping, alleviating, or reversing the progression or severity of a sign, symptom, disorder, condition, or disease after the disease has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders.

[0038] The "effective amount" of the present invention refers to the amount or dosage of the drug of the present invention that provides the desired treatment or prevention after being administered to an individual or an organ in a single or multiple doses.

[0039] The term "prevention" as used herein refers to a method implemented to prevent or delay the occurrence of a disease, disorder or symptom in an organism.

[0040] The "subject" described in the present invention may be a human or a non-human mammal, or a cell, tissue or organ of a human or a non-human mammal, and the non-human mammal may be a wild animal, a zoo animal, an economic animal, a pet, an experimental animal, etc. Preferably, the non-human mammal includes but is not limited to pigs, cattle, sheep, horses, donkeys, foxes, raccoon dogs, minks, camels, dogs, cats, rabbits, mice (e.g., rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels) or monkeys, etc.

[0041] The present invention has the following beneficial effects: by down-regulating Talin1 in dendritic cells, the number and length of dendritic cell surface processes are reduced, the number of intracytoplasmic phagocytic vacuoles and organelles is significantly reduced, the secretion of pro-inflammatory cytokines is reduced, the secretion of anti-inflammatory cytokines is increased, and the Th1 / Th17 / Treg balance is reshaped. Dendritic cells with down-regulated Talin1 loaded with MOG can treat MS, especially from the perspective of immune homeostasis and protection of nerve damage. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, wherein: Figure 1 The figure shows the validation results of knocking down the Talin1 gene by lentiviral vector. Figure A: Lentivirus knockdown sequence, specifically the control sequence (shN) and shTalin1 sequence (shT1-shT3); Figure B: Western Blot detection of the expression level of Talin1 in BMDCs after knocking down Talin1 using different shRNA sequences (among which, shT2 significantly knocked down the expression level of Talin1 protein in BMDCs, for subsequent research); GADPH is glyceraldehyde-3-phosphate dehydrogenase, used as an internal reference; Figure 2 Shown are scanning electron microscopic analysis images of dendritic cells in different groups, Figure A represents scanning electron microscopic analysis images of dendritic cells in shN group, Figure B represents scanning electron microscopic analysis images of dendritic cells in shN+L group, Figure C represents scanning electron microscopic analysis images of dendritic cells in shT group, and Figure D represents scanning electron microscopic analysis images of dendritic cells in shT+L group, wherein shN represents bone marrow-derived dendritic cells (BMDCs) treated with control medium for 12 h and transfected with control lentiviral vector for 48 h, shN+L represents BMDCs treated with lipopolysaccharide (LPS, 1 μg / ml) for 12 h and transfected with control lentiviral vector for 48 h, shT represents BMDCs treated with control medium for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h, and shT+L represents BMDCs treated with LPS (1 μg / ml) for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h; Figure 3Shown are transmission electron microscopy images of dendritic cells treated in different ways, Figure A represents the transmission electron microscopy image of dendritic cells in the shN group, Figure B represents the transmission electron microscopy image of dendritic cells in the shN+L group, Figure C represents the transmission electron microscopy image of dendritic cells in the shT group, and Figure D represents the transmission electron microscopy image of dendritic cells in the shT+L group, wherein the thin red arrow indicates the phagocytic vacuoles, the thick red arrow indicates the Golgi apparatus, the thin blue arrow indicates the mitochondria, and the thick blue arrow indicates the endoplasmic reticulum. shN represents BMDCs treated with control medium for 12 h and transfected with control lentiviral vector for 48 h, shN+L represents BMDCs treated with LPS (1 μg / ml) for 12 h and transfected with control lentiviral vector for 48 h, shT represents BMDCs treated with control medium for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h, and shT+L represents BMDCs treated with LPS (1 μg / ml) for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h; Figure 4 The figure shows the results of flow cytometry analysis of the expression of dendritic cell surface molecules CD80, CD86 and MHCII after Talin1 knockdown. Isotype represents the isotype control group, shN represents BMDCs treated with control medium for 12 h and transfected with control lentiviral vector for 48 h, shN+L represents BMDCs treated with LPS (1 μg / ml) for 12 h and transfected with control lentiviral vector for 48 h, shT represents BMDCs treated with control medium for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h, shT+L represents BMDCs treated with LPS (1 μg / ml) for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h, data are expressed as mean ± standard deviation, ns represents no significant difference, * represents p < 0.05, ** represents p < 0.01, **** represents p < 0.0001; Figure 5Shown are the bar graphs of IL-1β, IL-6, TNF-α, and IL-10 levels in the supernatants of BMDCs of Talin1 knockdown, Figure A represents the bar graph of IL-1β in the supernatants of BMDCs of the shN group, shN+L group, shT, and shT+L group, Figure B represents the bar graph of IL-6 in the supernatants of BMDCs of the shN group, shN+L group, shT, and shT+L group, Figure C represents the bar graph of TNF-α in the supernatants of BMDCs of the shN group, shN+L group, shT, and shT+L group, Figure D represents the bar graph of IL-10 levels in the supernatants of BMDCs of the shN group, shN+L group, shT, and shT+L group, and Figure B represents the bar graph of IL-6 in the supernatants of BMDCs of the shN group, shN+L group, shT, and shT+L group. MDCs were treated with control medium for 12 h and transfected with control lentiviral vector for 48 h, shN+L represents BMDCs treated with LPS (1 μg / ml) for 12 h and transfected with control lentiviral vector for 48 h, shT represents BMDCs treated with control medium for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h, shT+L represents BMDCs treated with LPS (1 μg / ml) for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h, data are expressed as mean ± SD, ns represents no significant difference, * represents p < 0.05, ** represents p < 0.01, *** represents p < 0.001, **** represents p < 0.0001; Figure 6 Shown is the effect of Talin1 knockdown on BMDCs stimulating CD4 + The proliferation capacity of T cells was affected by different groups of intervention BMDCs (3-6 times / group) and further compared with CD4 + T cells were co-cultured at a ratio of 1:5 for 72 h, and CD4 + Proliferation of T cells, where NC represents negative control group, shN represents BMDCs treated with control medium for 12 h and transfected with control lentiviral vector for 48 h, shN+L represents BMDCs treated with LPS (1 μg / ml) for 12 h and transfected with control lentiviral vector for 48 h, shT represents BMDCs treated with control medium for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h, shT+L represents BMDCs treated with LPS (1 μg / ml) for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h, data are expressed as mean ± SD, ns represents no significant difference, **** represents p < 0.0001; Figure 7A-7F Shown is the effect of Talin1 knockdown on BMDCs stimulating CD4 +The BMDCs from different groups (3-6 times / group) were further compared with CD4 + T cells were co-cultured at a ratio of 1:5 for 72 h. AF shows flow cytometry analysis of CD4 + T cells differentiate into Th1 (CD4 + IFN-γ + )、Th2(CD4 + IL-4 + )、Th17(CD4 + IL-17 + ) capabilities, among which, Figure 7A-7B : Flow cytometric analysis of CD4 + T cells differentiate into Th1 (CD4 + IFN-γ + ) Cell status, Figure 7C-D : Flow cytometric analysis of CD4 + T cells differentiate into Th2 (CD4 + IL-4 + ) Cell status, Figure 7E-7F : Flow cytometric analysis of CD4 + T cells differentiate into Th17 (CD4 + IL-17 + ) Cell conditions, shN represents BMDCs treated with control medium for 12 h and transfected with control lentiviral vector for 48 h, shN+L represents BMDCs treated with LPS (1 μg / ml) for 12 h and transfected with control lentiviral vector for 48 h, shT represents BMDCs treated with control medium for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h, shT+L represents BMDCs treated with LPS (1 μg / ml) for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h, data are expressed as mean ± SD, ns represents no significant difference, * represents p < 0.05, ** represents p < 0.01; Figure 8The figure shows the flow cytometry combined with microsphere immunoassay (Cytometric Bead Array (CBA) was used to detect the levels of IFN-γ, IL-4 and IL-17 in the co-culture supernatant, where Figure A: IFN-γ, Figure B: IL-4, Figure C: IL-17, shN represents BMDCs treated with control medium for 12 h and transfected with control lentiviral vector for 48 h, shN+L represents BMDCs treated with LPS (1 μg / ml) for 12 h and transfected with control lentiviral vector for 48 h, shT represents BMDCs treated with control medium for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h, shT+L represents BMDCs treated with LPS (1 μg / ml) for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h, data are expressed as mean ± SD, ns represents no significant difference, * represents p < 0.05, ** represents p < 0.01, *** represents p < 0.001, **** represents p < 0.0001; Fig. 9 The results show that Talin1 knockdown dendritic cells slowed down the progression of EAE model mice and neurological deficits. C57BL / 6 mice were induced into EAE model mice, and the EAE model mice were randomly divided into two groups: EAE represents EAE model mice injected with saline via tail vein (n=10), EAE+shN represents EAE model mice injected with control lentiviral vector-transfected dendritic cells via tail vein (n=10), and EAE+shT represents EAE model mice injected with Talin1 knockdown dendritic cells via tail vein (n=10). BMDCs loaded with MOG for intervention in EAE mouse model 35-55 Peptide (20 μg / ml) and treated with LPS (1 μg / ml) for 24 h, where A: Flow chart of BMDCs intervention in EAE model mice, B: Curve of weight change of mice in each group over time, C: Curve of neurological deficit score change over time, D: Kaplan-Meier survival curve comparing the onset time of each group, data are expressed as mean ± standard deviation, ※ represents P < 0.05 compared with EAE group, # represents P < 0.05 compared with EAE+shN group; Fig.10 The results show that Talin1 slows down the progression of EAE model mice and neurological deficits. C57BL / 6 mice were induced into EAE model mice, and the EAE model mice were randomly divided into two groups: EAE represents EAE model mice injected with saline via tail vein (n=10), EAE+shN represents EAE model mice injected with dendritic cells transfected with control lentiviral vector via tail vein (n=10), and EAE+shT represents EAE model mice injected with dendritic cells with Talin1 knockdown via tail vein (n=10). BMDCs loaded with MOG for intervention in EAE mouse model35-55 Peptide (20 μg / ml) and treated with LPS (1 μg / ml) for 24 h, where Figure A: Comparison of onset time of EAE model mice in different groups, Figure B: Comparison of maximum neurological deficit scores in different groups, Figure C: Comparison of cumulative neurological deficit scores in different groups, data are expressed as mean ± standard deviation, ns represents no significant difference, * represents p < 0.05, **** represents p < 0.0001; Fig.11 The figure shows the effect of Talin1 knockdown BMDCs on the pathological severity of EAE mice. After 20 days of immunization, the mice were killed and their spinal cord lumbar enlargement tissues were collected for pathological analysis. Figures A-C: HE staining analysis of white matter inflammatory infiltration scores of spinal cord tissue (n=6, scale bar in Figure A=500μm, scale bar in Figure B=50μm), Figures D-F: LFB staining analysis of demyelination scores of spinal cord tissue (n=5-6, scale bar in Figure D=500μm, scale bar in Figure E=50μm), EAE represents EAE model mice injected with normal saline via tail vein, EAE+shN represents EAE model mice injected with dendritic cells transfected with control lentiviral vector via tail vein, and EAE+shT represents EAE model mice injected with Talin1 knockdown dendritic cells via tail vein. Data are expressed as mean ± SD, ns represents no significant difference, **** represents p<0.0001; Figures 12A-12H The figure shows that Talin1 knockdown dendritic cells regulate the Th1\Th17\Treg response in the spleen of EAE model mice. Specifically, flow cytometry was used to analyze the Th1 (CD4 + IFN-γ + )、Th2(CD4 + IL-4 + ) and Th17 (CD4 + IL-17 + ) cells, each group of mice (5 mice / group) were killed 20 days after immunization, and their spleen cells were collected and incubated in MOG 35-55 Analysis of CD4 in splenocytes of EAE model mice under peptide restimulation conditions + T cell reactivity, among which Figure 12A-12B : CD4 + T cells differentiate into Th1 (CD4 + IFN-γ + ) cell ratio, Figure 12C-Figure 12D : CD4 + T cells differentiate into Th2 (CD4 + IL-4 + ) cell ratio, Figure 12E-12F : CD4 + T cells differentiate into Th17 (CD4+ IL-17 + ) cell ratio, Figure 12G-12H : CD4 + T cells differentiate into Treg (CD4 + CD25 + FoxP3 + ) cell ratio, EAE represents EAE model mice injected with normal saline via tail vein, EAE+shN represents EAE model mice injected with control lentiviral vector-transfected dendritic cells via tail vein, and EAE+shT represents EAE model mice injected with Talin1 knockdown dendritic cells via tail vein, data are expressed as mean ± SD, ns represents no significant difference, * represents p < 0.05, ** represents p < 0.01, **** represents p < 0.0001; Fig.13 The results show that Talin1 knockdown dendritic cells regulate the infiltration of inflammatory cells Th1\Th17\Treg in the spinal cord tissue of EAE model mice. Each group of EAE model mice was killed 20 days after immunization (5 mice / group), and their spinal cord lumbar enlargement tissues were collected for further analysis. Figure A-Figure C: Immunohistochemical staining analysis of Th1 (IFN-γ + ), Th17 (IL-17 + ) and Treg (IL-10+) cells, among which, Figure A: Th1 (IFN-γ + ) Cell infiltration diagram, Figure B: Th17 (IL-17 + ) Cell infiltration diagram, Figure C: Treg (IL-10 + ) Cell infiltration diagram, EAE represents EAE model mice injected with normal saline via tail vein, EAE+shN represents EAE model mice injected with control lentiviral vector-transfected dendritic cells via tail vein, EAE+shT represents EAE model mice injected with Talin1 knockdown dendritic cells via tail vein, data are expressed as mean ± SD, ns represents no significant difference, * represents p < 0.05, ** represents p < 0.01, *** represents p < 0.001, **** represents p < 0.0001. DETAILED DESCRIPTION

[0043] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0044] It should be noted that the methods used in the present invention are all conventional methods unless otherwise specified, and the reagents used in the present invention are all commercially available products unless otherwise specified. Example 1 Preparation of Tolerogenic Dendritic Cells 1. Differentiation, culture and activation of bone marrow-derived dendritic cells (BMDCs)

[0045] First, bone marrow mononuclear cells (BMMCs) were prepared by lysing and removing red blood cells from cell suspensions of tibia and femur of donor C57BL / 6 mice. 6 BMMCs were cultured at a density of 10 cells / ml in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS, Gibco, Invitrogen, Carlsbad, CA, USA), 2 mM glutamine (Sigma, St. Louis, MO, USA), 100 IU / mL penicillin-streptomycin (Sigma), 10 ng / mL recombinant mouse granulocyte macrophage colony-stimulating factor (rmGM-CSF; PeproTech, Rocky Hill, NJ, USA), and 10 ng / mL rmIL-4 (PeproTech) at 37°C and 5% CO2 for 7 days. On days 2, 4, and 6 of culture, half the volume of fresh medium containing GM-CSF and IL-4 was added. On day 8, negative selection was performed using a CD11c cell isolation kit to obtain BMDCs. When necessary, 1 μg / mL lipopolysaccharide (LPS, Sigma) was added to the culture medium to activate or mature BMDCs. Talin1 knockdown (shTalin1) lentiviral transfection of BMDCs and verification of transfection effect

[0046] Three different sequences of shTalin1 lentivirus (shT1, shT2, and shT3) were constructed, and the shN sequence was used as a control to compare the knockdown effect and select the one with the best knockdown effect (shT2) for subsequent experiments. 4 The cells were inoculated with lentiviral vectors (multiplicity of infection: 10) in 6-well plates and incubated at 37°C for 6-8 hours. The lentivirus was removed and fresh medium was added to the cells. The transfected cells were then cultured for another 48 hours for further testing. For relevant shRNA sequence information and validation of Talin1 gene knockdown by Western blotting, see Figure 1 .

[0047] The shT1 sequence is GCTCATTGCTGGCTACATATT (SEQ ID NO: 1); The shT2 sequence is CCAAATGGCCCAGTACTTTTT (SEQ ID NO: 2); The shT3 sequence is CCGAATGACCAAGGGTATTTT (SEQ ID NO: 3); The shN sequence is TTCTCCGAACGTGTCACGTTT (SEQ ID NO: 4).

[0048] The results showed that shT2 knockdown had the best effect, so shT2 knockdown cells (referred to as shTalin1-BMDCs) were used in subsequent verification. 3. Identification of the morphological structure, phenotype and function of shTalin1-BMDCs. 1) Electron microscopic morphology and ultrastructure of shTalin1-BMDCs

[0049] After being activated by LPS, BMDCs undergo a series of changes in morphology and internal structure, including an increase in the number and length of surface protrusions, a decrease in intracytoplasmic phagocytic vacuoles, and a significant increase in organelles. The morphology and ultrastructure of shTalin1-BMDCs were examined using scanning electron microscopy and transmission electron microscopy, respectively, and it was found that Talin1 knockdown did not affect the morphology and structure of unactivated (unstimulated by LPS) BMDCs ( Figure 2 Talin1 knockdown resulted in fewer phagocytic vacuoles and organelles (rough endoplasmic reticulum, mitochondria, Golgi complex) in activated BMDCs (LPS stimulation) ( Figure 3 ), which is consistent with the morphological and structural characteristics of tolerant dendritic cells. 2) Phenotypic characterization of shTalin1-BMDCs

[0050] As the main professional antigen presenting cells in the body, high expression of surface molecules (co-stimulatory molecules and MHC molecules) and pro-inflammatory cytokines are the material basis for BMDCs activation and stimulation of T cell response. This study used flow cytometry, qRT-PCR and Cytometric Bead Array (CBA) to detect the above indicators at the transcriptional and protein levels. Figure 4-Figure 5 As shown, Talin1 had no significant effect on the levels of surface molecules and cytokines in unactivated BMDCs; Talin1 knockdown significantly downregulated the levels of co-stimulatory molecules (CD80, CD86) and MHCII molecules in activated BMDCs, reduced the secretion of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α), and increased the secretion of anti-inflammatory cytokines (IL-10), which are also consistent with the expression characteristics of surface molecules and cytokines of tolerant dendritic cells.

[0051] 3) shTalin1-BMDCs stimulate CD4 +Functional characterization of T cell responses As antigen presenting cells, dendritic cells stimulate activation, proliferation and differentiation of other immune cells and coordinate adaptive immune responses. Based on this, this example evaluates the effect of Talin1 knockdown on BMDCs stimulating CD4 + Isolation and purification of CD4 T cells from spleen mononuclear cells of BALB / c mice + T cells. Differentiation, culture and LPS stimulation of BMDCs were performed as described above, and cells were treated with mitomycin C (30 mg / L, Sangon Biotechnology, Shanghai, China) for 30 min before harvesting. + T cells were co-cultured in 96-well plates at a ratio of 1:5 for 72 h. CD4 + T cells served as positive control, and CD4 + T cells served as negative controls. CD4 + T cell proliferation (detected by CFSE staining), differentiation (differentiation into Th1, Th2, Th17, Treg cells) and production of related cytokines.

[0052] The results showed that CD4 + T cells showed lower proliferation ( Figure 6 ), differentiate into Th1 and Th17 cells ( Figure 7A-7F ), and the ability to secrete IFN-γ and IL-17 was also significantly weakened ( Figure 8 Therefore, Talin1 knockdown significantly impaired BMDCs stimulation of CD4 + In terms of the function of T cell responses, shTalin1-BMDCs fulfill the functional characteristics of tolerogenic dendritic cells. Example 2: shTalin1-BMDCs intervention in EAE model and efficacy evaluation

[0053] The EAE model is mainly composed of CD4 + The animal model of central nervous system (CNS) inflammatory demyelination mediated by abnormal T cell activation is a classic animal model of MS. Based on the phenotype and functional characteristics of shTalin1-BMDCs as described in Example 1, this example used shTalin1-BMDCs loaded with MOG35-55 peptide to intervene in mice three times (eg, 8, 12, and 16 days after EAE modeling) by tail vein injection. Fig. 9 A) (10 6cells / mouse / time) to evaluate its therapeutic effect on EAE model.

[0054] Among them, the sequence of MOG35-55 (myelin oligodendrocyte glycoprotein) peptide segment is MEVGWYRSPFSRVVHLYRNGK (SEQ ID NO: 5), which was purchased from Nanjing Peptide Industry Biotechnology Co., Ltd. 118 H 177 N 35 O 29 S, MW: 2581.95, CAS: 149635-73-4.

[0055] shTalin1-BMDCs loaded with MOG35-55 peptide were obtained by adding MOG35-55 peptide (20 μg / ml) and LPS (100 ng / ml) to shTalin1-BMDCs (16 μM) for 24 h.

[0056] The results showed that: ①shTalin1-BMDCs significantly improved the survival rate and delayed the onset of EAE mice ( Fig. 9 D and Fig.10 A);②shTalin1-BMDCs significantly reduced the mean, maximum and cumulative neurological deficit scores of EAE mice ( Fig. 9 C. Fig.10 B and Fig.10 C); ③ The body weight of mice in the EAE model treated with shTalin1-BMDCs was stable during the entire experiment ( Fig. 9 B), no unexpected events such as obvious weight loss, skin ulceration, infection, and death occurred. The above generally demonstrated the positive therapeutic effect of shTalin1-BMDCs on the EAE model from the perspective of intervention safety and effectiveness. Example 3 Neuropathology

[0057] Experimental autoimmune encephalomyelitis (EAE) is a classic animal model of multiple sclerosis, with massive inflammatory cell infiltration in the central nervous system and demyelination of white matter as typical pathological features. In this example, hematoxylin-eosin staining (HE) and Luxol Fast Blue (LFB) staining were used to further evaluate the above indicators.

[0058] The construction of EAE model and intervention with shTalin1-BMDCs loaded with MOG35-55 peptide were the same as in Example 2. The data showed that Talin1 knockdown BMDCs significantly reduced the inflammatory infiltration score of the spinal cord (lumbar enlargement) of EAE mice ( Fig.11 AC) and demyelination score ( Fig.11 DF), the above verified the neuroprotective effect of Talin1 knockdown BMDCs on EAE model from the perspective of neuropathology. Example 4 Peripheral immune homeostasis

[0059] Splenic CD4 in EAE mice + T cells have a strong response to restimulation with MOG35-55 peptide, and can rapidly proliferate and differentiate into Th1 and Th17 cells, which are also an important source of pathogenic inflammatory cells in the EAE model. Based on this, this example evaluates the reactivity of splenocytes in EAE mice intervened by shTalin1-BMDCs.

[0060] The construction of EAE model and the intervention of shTalin1-BMDCs loaded with MOG35-55 peptide were the same as in Example 2. The results showed that the spleen cells of EAE mice treated with shTalin1-BMDCs showed a lower ability to differentiate into Th1 and Th17 cells under the condition of MOG35-55 peptide restimulation ( Figures 12A-12F ), but the proportion of them differentiating into Treg cells increased significantly ( Figure 12G-12H ), reshaped the Th1 / Th17 / Treg balance. The above explains the mechanism of shTalin1-BMDCs in treating EAE from the perspective of peripheral immune homeostasis regulation. Example 5 Maintaining the balance of Th1 / Th17 / Treg in the CNS

[0061] Abnormally activated inflammatory cells in the periphery (mainly including Th1, Th17 cells, etc.) break the blood-brain barrier and enter the CNS. In the CNS, these inflammatory cells further proliferate and severely damage the differentiation and survival of oligodendrocytes or oligodendrocyte precursor cells that form myelin. This is the main pathological process of myelin loss caused by inflammation in the EAE model. This example uses immunohistochemistry (IHC) staining to detect Th1 (IFN-γ + ), Th17 (IL-17 + ), Treg (IL-10 + ) Cell infiltration.

[0062] The construction of EAE model and the intervention of shTalin1-BMDCs loaded with MOG35-55 peptide were the same as in Example 2. The results showed that the intervention of shTalin1-BMDCs significantly reduced the immunohistochemistry (IHC) scores of Th1 and Th17 cells in the lumbar enlargement tissue of the spinal cord of EAE mice ( Fig.13 A and Fig.13 B) and significantly increased the IHC score of Treg cells ( Fig.13 C) The above explains the mechanism of shTalin1-BMDCs in treating EAE from the perspective of maintaining the balance of Th1 / Th17 / Treg in the CNS.

Claims

1. A use of dendritic cells in the preparation of a drug for preventing and / or treating demyelinating diseases, characterized in that: The expression level of Talin1 protein in the dendritic cells is reduced or not expressed.

2. The use according to claim 1, characterized in that: The dendritic cells include dendritic cells in the skin, airways, spleen, blood, lymph or bone marrow.

3. The use according to claim 1, characterized in that: Knocking out or knocking down the Talin1 gene in the dendritic cells; The knockout method includes CRISPR / Cas9, Cre / LoxP system, Gin / Gix system, FLP / FRT system or R / RS system; The knockdown method includes RNA interference.

4. The use according to claim 3, characterized in that: The shRNA sequence targeting the Talin1 gene in the RNA interference includes: CCAAATGGCCCAGTACTTTTT (SEQ ID NO: 2).

5. The use according to any one of claims 1 to 4, characterized in that: The dendritic cells are loaded with myelin peptides, The myelin peptides include myelin basic protein peptide (MBP), myelin oligodendrocyte glycoprotein peptide (MOG), proteolipid protein peptide (PLP) or myelin associated glycoprotein peptide (MAG).

6. The use according to claim 5, characterized in that: The myelin peptide is a MOG35-55 peptide segment, and the amino acid sequence of the MOG35-55 peptide segment is shown in SEQ ID NO:

5.

7. The use according to claim 1, characterized in that: The demyelinating disease includes hereditary demyelinating disease or acquired demyelinating disease; The acquired demyelinating diseases include central demyelinating diseases; The central demyelinating disease is multiple sclerosis, acute disseminated encephalomyelitis or neuromyelitis optica spectrum disease.

8. A dendritic cell, characterized in that: The expression level of Talin1 protein in the dendritic cells is reduced or not expressed, and the dendritic cells are loaded with myelin peptides.

9. A method for preparing dendritic cells according to claim 8, characterized in that: The preparation method comprises: knocking out or knocking down Talin1 gene in dendritic cells loaded with myelin peptide.

10. A drug for preventing and / or treating demyelinating diseases, characterized in that: The drug comprises the dendritic cell according to claim 8.

Images