Dihydro-beta-agilawood furan type sesquiterpenoids as well as preparation method and application thereof

Abstract

The invention discloses a dihydro-beta-agilawood furan type sesquiterpenoids compound as shown in a formula (I) as well as a preparation method and application thereof. The compound provided by the invention can promote cartilage cell proliferation and reverse mRNA expression of symbolic genes Col2A1 and SOX-9 in cartilage cells under inflammation induction; meanwhile, the expression of inflammation-induced cartilage cell matrix metalloproteinase-13mRNA can be down-regulated, the degradation of cartilage cell extracellular matrix can be inhibited, and the cartilage cell metalloproteinase-13mRNA can be used for preparing products for preventing and / or treating diseases or symptoms caused by abnormal cartilage cell activity and / or improving bone and joint movement functions. # imgabs0 #

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically, the present invention relates to a dihydro-β-agarwood furan-type sesquiterpenoid compound and a preparation method thereof, as well as a use thereof in preparing a product for preventing and / or treating diseases or symptoms caused by abnormal chondrocyte activity and / or improving bone and joint movement function. Background Art

[0002] Cartilage is a smooth tissue covering the ends of joint bones. It conducts, absorbs, and relieves stress during joint movement, and lubricates the joints by secreting related proteins. Chondrocytes and cartilage matrix constitute this tissue. Chondrocytes are the only cell type in articular cartilage. They are derived from mesenchymal stem cells in the embryonic period and have undergone the differentiation process of mesenchymal stem cells-osteoprogenitor cells-chondrocytes. Due to the lack of vascular tissue inside, chondrocyte regeneration is limited. The cartilage matrix is ​​synthesized and secreted by chondrocytes to maintain the structure, function and integrity of articular cartilage. The dynamic balance between anabolism and catabolism of chondrocytes is crucial to the internal environment of the cartilage matrix. Abnormal chondrocytes will accelerate catabolism, which is much higher than the synthesis rate of the matrix, which is a major feature of osteoarthritis (OA) cartilage. In addition, under abnormal circumstances, chondrocyte hypertrophy will also cause matrix calcification. The abnormal state of chondrocytes and matrix will cause imbalance in joint homeostasis, leading to the occurrence and development of a variety of bone diseases, such as osteoarthritis and rheumatoid arthritis.

[0003] OA is a common chronic disease with degenerative lesions of articular cartilage as its core, and has become one of the most important causes of human limb pain and dysfunction. According to statistics, more than 500 million people are currently affected by OA worldwide. It is characterized by joint destruction and cartilage loss. The surface layer of the patient's cartilage breaks and wears away, causing the bones under the cartilage to rub against each other, causing pain, swelling, and loss of joint mobility. The main phenotypes are: articular cartilage erosion, synovial hyperplasia, abnormal angiogenesis, synovial inflammation, subchondral bone disorder, ligament and tendon instability, and joint stiffness. The only endpoint treatment for OA is joint replacement surgery. However, the service life of artificial joints is limited and has certain risks. There is currently no way to completely cure OA. Existing drugs include nonsteroidal anti-inflammatory drugs (NSAIDs), glucocorticoids, opioids, symptomatic, chondroprotective agents, and anti-cytokines. These clinical treatments have long focused on improving joint pain symptoms rather than slowing down disease progression. Therefore, there is an urgent need to explore improved treatments for OA.

[0004] The pathogenesis of OA has not been fully elucidated. Abnormally induced hypertrophic differentiation of articular chondrocytes, abnormal chondrocyte metabolism, and subchondral bone sclerosis are the main factors that promote the onset and progression of OA. In addition, cellular hypoxia stress, oxidative stress, and autophagy can lead to the degradation and destruction of type II collagen and enhance chondrocyte apoptosis. Therefore, regulating chondrocyte metabolism and promoting cartilage self-repair are important goals in the development of new OA therapeutic drugs. Summary of the invention

[0005] In view of the problems existing in the above-mentioned prior art, the inventors obtained a class of dihydro-β-agarwood furan-type sesquiterpenoid compounds from Celastrus orbiculatus through extensive and in-depth research. Through biological activity experiments, it was first found that such compounds can significantly promote chondrocyte proliferation and reverse the mRNA expression of the iconic genes Col2A1 and SOX-9 in chondrocytes induced by inflammation; at the same time, they can also downregulate the mRNA expression of matrix metalloproteinase-13 (MMP-13) in chondrocytes induced by inflammation, inhibit the degradation of the extracellular matrix of chondrocytes, thereby alleviating chondrocyte damage and preventing and / or treating diseases caused by abnormal chondrocyte activity.

[0006] Based on this, one of the objects of the present invention is to provide a class of dihydro-β-agarwood furan-type sesquiterpenoid compounds or plant extracts containing the same.

[0007] The second object of the present invention is to provide a method for preparing a class of dihydro-β-agarwood furan-type sesquiterpenoid compounds.

[0008] The third object of the present invention is to provide the use of dihydro-β-agarwood furan-type sesquiterpenoid compounds or compositions or plant extracts containing the same, that is, the use of the compounds as abnormal chondrocyte regulators for preparing products for preventing and / or treating diseases or symptoms caused by abnormal chondrocyte activity, and / or improving bone and joint movement function.

[0009] In order to achieve the above object, the present invention adopts the following technical solution:

[0010] In a first aspect of the present invention, there is provided a dihydro-β-agarwood furan-type sesquiterpenoid compound represented by formula (I) or a pharmaceutically acceptable salt thereof:

[0011]

[0012] In formula (I),

[0013] R1, R2, R3, R5, R6, R7 and R8 are independently selected from: -H, -OH, oxo (=O), carboxyl (-COOH), C1-C10 alkyl, C2-C8 alkenyl, C2-C8 alkynyl and -OCOR a; In particular, R1, R2, R3, R5, R6, R7 and R8 are independently selected from: -H, -OH, oxo (=O), C1-C5 alkyl (preferably C1-C3 alkyl, especially methyl, ethyl), C2-C4 alkenyl, C2-C4 alkynyl and -OCOR a ; More particularly, R1, R2, R3, R5, R6, R7 and R8 are independently selected from: -H, -OH, oxo (=O), -OAc, -OBz, -OCin, -ONic and -OFu;

[0014] R4 is selected from: -H, -OH;

[0015] Among them, R a is selected from: C1-C5 alkyl, C6-C12 aryl, 5-12 membered heteroaryl, C2-C6 alkenyl, C6-C12 aryl C2-C6 alkenyl, 5-12 membered heteroaryl C2-C6 alkenyl; preferably, R a Selected from: C1-C3 alkyl (especially methyl, ethyl), C6-C10 aryl (e.g. phenyl), 5-10 membered heteroaryl (e.g. furyl), C2-C4 alkenyl, C6-C10 aryl C2-C4 alkenyl (e.g. styryl), 5-10 membered heteroaryl C2-C4 alkenyl;

[0016] One or more (eg 1-4, preferably 1-3, especially 1) ring atoms in the heteroaryl group are heteroatoms selected from N, O or S, and the remaining ring atoms are carbon.

[0017] In one embodiment, in formula (I),

[0018] R1, R2, R3, R5, R6, R7 and R8 are independently selected from: -H, -OH, oxo (=O), C1-C5 alkyl (preferably C1-C3 alkyl, especially methyl, ethyl), C2-C4 alkenyl, C2-C4 alkynyl and -OCOR a ; In particular, R1, R2, R3, R5, R6, R7 and R8 are independently selected from: -H, -OH, oxo (=O), -OAc, -OBz, -OCin, -ONic and -OFu;

[0019] R4 is selected from: -H, -OH;

[0020] Among them, R a Selected from: C1-C5 alkyl (preferably C1-C3 alkyl, especially methyl, ethyl), C6-C10 aryl (e.g. phenyl), 5-10 membered heteroaryl (e.g. furyl), C2-C4 alkenyl, C6-C10 aryl C2-C4 alkenyl (e.g. styryl), 5-10 membered heteroaryl C2-C4 alkenyl.

[0021] In one embodiment, in formula (I), R1 and R5 are independently selected from: -H, -OH, -OAc, -OBz, -OCin, -ONic and -OFu; preferably selected from: H, -OH, -OAc, -OBz, -ONic and -OFu.

[0022] In one embodiment, in formula (I), R2, R3, R6, R7 and R8 are independently selected from: -H, -OH, -OAc, -OBz, -OCin, -ONic, -OFu, =O; preferably selected from: -H, -OH, -OAc, -OBz, -OCin, -ONic, -OFu.

[0023] In a preferred embodiment, in formula (I),

[0024] R1 and R5 are independently selected from: OH, OBz, ONic and OAc;

[0025] R2, R3, R6, R7 and R8 are independently selected from: OBz, OAc and ONic;

[0026] R4 is selected from the group consisting of: H and OH.

[0027] In a preferred embodiment, in formula (I),

[0028] R1 and R5 are independently selected from: -H, -OH, -OAc, -OBz ​​and -ONic;

[0029] R2 and R3 are independently -H or -OAc; preferably, R2 and R3 are both -H;

[0030] R4 is selected from: -H, -OH;

[0031] R6 is selected from: -H, -OAc, -OFu;

[0032] R7 is selected from: -OFu, OBz, -OCin;

[0033] R8 is selected from: -H, -OH, -OAc.

[0034] In a preferred embodiment, the compound of formula (I) is selected from the structure shown in the following formula (I-1):

[0035]

[0036] Wherein, R1, R2, R3, R4, R5, R6, R7 and R8 are defined as described above.

[0037] In a further preferred embodiment, the compound of formula (I) is selected from the following group:

[0038]

[0039]

[0040] In a further preferred embodiment, the compound is selected from compounds DY-12, DY-15, DY-28, DY-37, and DY-39.

[0041] In a further preferred embodiment, the compound is selected from DY-1, DY-2, DY-3, DY-4, DY-5, DY-6, DY-7, DY-8, DY-9, DY-10, DY-11, DY-12, DY-13, DY-14, DY-15, DY-16, DY-17, DY-18, DY-19, DY-20, DY-21, DY-22.

[0042] In this article,

[0043] "C1-C10 alkyl" refers to a linear or branched alkyl group containing 1 to 10 carbon atoms, including, but not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, isopentyl, hexyl, and the like.

[0044] "C2-C8 alkenyl" means a straight or branched alkenyl group containing 2 to 8 carbon atoms, including, but not limited to, ethenyl, propenyl, allyl, 1-butenyl, 2-butenyl, 3-butenyl, 1-pentenyl, 2-pentenyl, 1-hexenyl, etc.

[0045] "C2-C8 alkynyl" means a straight or branched alkynyl group containing 2 to 8 carbon atoms, including, but not limited to, ethynyl, propynyl, propargyl, 1-butynyl, 2-butynyl, 3-butynyl, 1-pentynyl, 2-pentynyl, 1-hexynyl, etc.

[0046] "C6-C10 aryl" refers to an aromatic carbocyclic ring system containing 6 to 10 carbon atoms, which may be monocyclic or bicyclic, including but not limited to phenyl, tolyl, xylyl and naphthyl.

[0047] "5-12 membered heteroaryl" is a cyclic aromatic group containing 5-12 ring atoms, such as a 5-10 membered heteroaryl group, wherein one or more (e.g. 1-4, preferably 1-3, and especially 1) ring atoms are heteroatoms selected from N, O or S, and the remaining ring atoms are carbon. Examples include, but are not limited to, furanyl, thienyl, benzothienyl, indolyl, isoindolyl, pyrrolyl, thiazolyl, benzothiazolyl, oxazolyl, pyrazolyl, imidazolyl, pyranyl, pyridazinyl, pyrazinyl, pyrimidinyl, pyridyl, quinolyl, isoquinolyl, and the like.

[0048] In this paper, Bz is Cin Nic Fu Ac is

[0049] The second aspect of the present invention provides a method for preparing the compound represented by formula (I) according to the first aspect of the present invention.

[0050] In the case where the specific structure of the compound is disclosed in the present invention, those skilled in the art can extract it from plants of the Celastraceae family, especially plants of the genus Celastrus, or obtain it by chemical synthesis, for example, by synthesizing it from a small molecule compound through structural design using a known chemical synthesis method, or by structural modification of a known compound.

[0051] In some embodiments, the method comprises the steps of:

[0052] (1) extracting dried Celastrus orbiculatus seeds with an ethanol solution, concentrating the extract to obtain extract A; preferably, the ethanol solution is 80-99%, v / v ethanol aqueous solution, preferably 95%, v / v ethanol aqueous solution; preferably, the mass volume ratio of Celastrus orbiculatus seeds to the ethanol solution is 10kg:3-8L, preferably 10kg:5L; preferably, the extraction can be repeated, for example, 3-8 times, preferably 5 times, each time for 3-10 days, preferably 7 days;

[0053] (2) Extract A is separated by eluting with a C18 reverse phase silica gel column with 48-52% (e.g., 50%, v / v), 68-72% (e.g., 70%, v / v), 78-82% (e.g., 80%, v / v), and 88-92% (e.g., 90%, v / v) methanol / water to obtain four fractions Fr.1 to Fr.4 respectively;

[0054] (3) Fraction Fr.2 was subjected to gradient elution using a Diol column with petroleum ether / acetone in a volume ratio of 10:1 to 5:1 as the eluent, and the eluent was collected in equal volumes. The ultraviolet absorption peak of the eluent at 200 nm was monitored, and the eluents with the same or similar absorption peaks were combined to obtain seven subfractions Fr.2-1 to Fr.2-7;

[0055] (4) Fraction Fr.2-3 was separated by gradient elution with 30%-85%, v / v methanol / water on a C18 reverse phase silica gel column, and then separated and purified by a semi-preparative ODS column with 75%, v / v acetonitrile / water as the mobile phase to obtain compounds DY-8, DY-11, DY-12, DY-13, DY-14, DY-15, DY-16, DY-19, DY-20, DY-21, DY-22, DY-38, DY-39, DY-40, DY-41, DY-42, DY-43 and DY-44;

[0056] (5) Fraction Fr.2-1 was separated by elution with 38-42% (e.g., 40%, v / v), 58-62% (e.g., 60%, v / v), 68-72% (e.g., 70%, v / v), and 78-82% (e.g., 80%, v / v) of methanol / water on a C18 reverse phase silica gel column to obtain four fractions Fr.21-1 to Fr.21-4, respectively;

[0057] (6) Fraction Fr.21-3 was separated by gradient elution on a Diol column using petroleum ether / acetone in a volume ratio of 12:1 to 6:1 as the eluent, and then separated and purified by a semi-preparative ODS column using 70%, v / v acetonitrile / water as the mobile phase to obtain compounds DY-1, DY-2, DY-3, DY-4, DY-5, DY-6, DY-7, DY-9, DY-10, DY-17, DY-18, DY-29, DY-30, DY-31, DY-32, DY-33, DY-34, DY-35, DY-36 and DY-37;

[0058] (7) Fraction Fr.21-2 was separated by gradient elution on a Diol column using petroleum ether / acetone in a volume ratio of 10:1 to 5:1 as the eluent, and then separated and purified on a semi-preparative ODS column using 65%, v / v acetonitrile / water as the mobile phase to obtain compounds DY-23, DY-24, DY-25, DY-26, DY-27 and DY-28.

[0059] The third aspect of the present invention provides a composition comprising one or more of the compounds represented by formula (I) or pharmaceutically acceptable salts thereof according to the first aspect of the present invention, and optionally an acceptable carrier or excipient.

[0060] According to the present invention, the composition can be a pharmaceutical composition, a dietary supplement, a nutritional supplement, a reagent, etc.

[0061] In a fourth aspect of the present invention, a plant extract of the genus Celastrus is provided. The plant extract of the genus Celastrus is not particularly limited as long as it contains dihydro-β-agarwood furan-type sesquiterpenoid compounds. For example, the plant extract of the genus Celastrus can be in the form of an extract, an extract or a dry powder extracted from a plant of the genus Celastrus, but is not limited thereto. The extract is obtained by the following method: extracting the powder of the genus Celastrus with 95% ethanol, filtering to obtain a filtrate, which is an extract; concentrating the extract to obtain an extract; and further drying the extract to obtain a powder.

[0062] In a preferred embodiment, the extract contains at least one compound of formula (I) in the first aspect of the present invention.

[0063] In another preferred embodiment, the extract is a water or organic solvent extract.

[0064] In another preferred embodiment, the extract is a seed extract.

[0065] In another preferred embodiment, the plant of the genus Celastrus is selected from: Celastrus gemmatus Loes.

[0066] In another preferred embodiment, the extract is an extract of Celastrus gemmatus Loes., and the extract contains one or more compounds selected from the following group:

[0067] DY-1, DY-2, DY-3, DY-4, DY-5, DY-6, DY-7, DY-8, DY-9, DY-10, DY-11, DY-12, DY-13, DY-14, DY-15, DY-16, DY-17, DY-18, DY-19, DY-20, DY-21, DY-22.

[0068] The structures of the compounds are shown above.

[0069] The fifth aspect of the present invention provides the use of the compound of formula (I) or a pharmaceutically acceptable salt thereof described in the first aspect of the present invention, the compound of formula (I) obtained by the preparation method described in the second aspect, the composition described in the third aspect and / or the Celastrus plant extract described in the fourth aspect in the preparation of products for preventing and / or treating diseases or symptoms caused by abnormal chondrocyte activity, and / or improving bone and joint movement function.

[0070] According to the present invention, specifically, provided is the use of the compound of formula (I) or a pharmaceutically acceptable salt thereof described in the first aspect of the present invention, the compound of formula (I) obtained by the preparation method described in the second aspect, the composition described in the third aspect and / or the Celastrus plant extract described in the fourth aspect in the preparation of a product for promoting chondrocyte proliferation and / or inhibiting chondrocyte extracellular matrix degradation.

[0071] Preferably, the compounds of the present invention can promote chondrocyte proliferation by reversing the down-regulation of COL2A1 and / or SOX-9 mRNA expression in chondrocytes, or can inhibit the degradation of cartilage extracellular matrix by reversing the up-regulation of MMP-13 mRNA expression in chondrocytes.

[0072] Therefore, the present invention also provides the use of the compound of formula (I) or a pharmaceutically acceptable salt thereof described in the first aspect of the present invention, the compound of formula (I) obtained by the preparation method described in the second aspect, the composition described in the third aspect and / or the Celastrus plant extract described in the fourth aspect in the preparation of a product for reversing the down-regulation of mRNA expression of COL2A1 and / or SOX-9 in chondrocytes and reversing the up-regulation of mRNA expression of MMP-13 in chondrocytes; preferably, the down-regulation of mRNA expression of COL2A1 and SOX-9 or the up-regulation of mRNA expression of MMP-13 is induced by inflammation.

[0073] The products include pharmaceuticals, reagents, dietary or nutritional supplements.

[0074] The reagents are products used in life science research, clinical diagnosis and medical research.

[0075] The sixth aspect of the present invention provides a method for treating or preventing diseases caused by abnormal chondrocyte activity or improving bone and joint movement function, comprising administering to a subject in need thereof a therapeutically effective amount of a compound as shown in formula (I) of the first aspect of the present invention or a pharmaceutically acceptable salt thereof, the composition described in the third aspect, and / or the Celastrus plant extract described in the fourth aspect.

[0076] In a preferred embodiment, the subject is a human.

[0077] In the present invention, the abnormal chondrocyte activity includes but is not limited to: chondrocyte apoptosis, down-regulation of COL2A1 and / or SOX-9 mRNA expression in chondrocytes, up-regulation of MMP-13 mRNA expression in chondrocytes, and degradation of chondrocyte extracellular matrix.

[0078] In the present invention, the disease caused by abnormal chondrocyte activity refers to a disease caused by abnormal chondrocyte metabolism or induced by various types of inflammation, including, for example, cartilage damage caused by metabolic diseases (such as rheumatoid arthritis, osteoarthritis); bone and joint damage, etc.

[0079] In the present invention, improving the movement function of bones and joints refers to repairing the damaged functions of bones and joints.

[0080] Beneficial effects:

[0081] (1) It was first discovered that the compounds of the present invention can promote chondrocyte proliferation and reverse the mRNA expression of the marker genes Co12A1 and SOX-9 in chondrocytes induced by inflammation; at the same time, they can also downregulate the mRNA expression of matrix metalloproteinase-13 (MMP-13) induced by inflammation in chondrocytes and inhibit the degradation of the extracellular matrix of chondrocytes.

[0082] (2) For the first time, the function of the extract of Celastrus orbiculatus in treating bone / arthritis and bone / joint injury diseases was discovered.

[0083] (3) For the first time, 22 monomeric compounds (DY-1, DY-2, DY-3, DY-4, DY-5, DY-6, DY-7, DY-8, DY-9, DY- 10. DY-11, DY-12, DY-13, DY-14, DY-15, DY-16, DY-17, DY-18, DY-19, DY-20, DY-21, DY-22).

[0084] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here.

[0085] The present invention has been described in detail above, but the above embodiments are only illustrative in nature and are not intended to limit the present invention. In addition, this article is not limited by any theory described in the above prior art or invention content or the following examples.

[0086] Unless otherwise expressly stated, the numerical ranges throughout the application documents include any subranges therein and any numerical values ​​incremented by the smallest subunit of a given value therein. Unless otherwise expressly stated, the numerical values ​​throughout the application documents represent approximate measurements or limitations of the range of embodiments including slight deviations from the given values ​​and having approximately the values ​​mentioned and having the exact values ​​mentioned. Except for the working examples provided at the end of the detailed description, all numerical values ​​of parameters (e.g., quantities or conditions) in this application document (including the appended claims) should be understood in all cases as modified by the term "approximately", regardless of whether "approximately" actually appears before the numerical value. "Approximately" means that the numerical value described allows for slight imprecision (some close to precision in the value; approximately or reasonably close to the value; approximately). If the imprecision provided by "approximately" is not understood in this ordinary sense in the art, the "approximately" used herein at least represents the variation that can be produced by ordinary methods of measuring and using these parameters. For example, "approximately" can include a variation of less than or equal to 10%, less than or equal to 5%, less than or equal to 4%, less than or equal to 3%, less than or equal to 2%, less than or equal to 1% or less than or equal to 0.5%. BRIEF DESCRIPTION OF THE DRAWINGS

[0087] Figure 1 A schematic diagram of the process for extracting and isolating compounds from Celastrus orbiculatus seeds is shown.

[0088] Figure 2 The figure shows the change of mRNA expression level of the marker gene Col2A1 after chondrocytes were treated with the compound of the present invention in the test example.

[0089] Figure 3 The effect of compound DY-12 on the mRNA expression levels of key genes in chondrocytes is shown.

[0090] *p<0.05, **p<0.01 indicate that there is a significant difference between the two groups. DETAILED DESCRIPTION

[0091] Preparation method

[0092] The compound of the present invention can be prepared by chemical synthesis, or extracted from a plant of the genus Celastrus, preferably extracted from Celastrus macrophylla.

[0093] In a preferred embodiment of the present invention, the process of extracting the compound of the present invention from Celastrus orbiculatus of the genus Celastrus comprises: crushing the dried seeds and then extracting them with ethanol, then concentrating them under reduced pressure, and then purifying them using a chromatographic method (such as silica gel column chromatography, macroporous adsorption resin, high performance liquid chromatography), and finally obtaining a monomer compound or a composition containing multiple compounds.

[0094] Pharmaceutical compositions and methods of administration

[0095] The compound of the present invention can be used as an inhibitor of bone / joint damage, a drug or a dietary supplement for preventing or treating cartilage damage caused by metabolic diseases.

[0096] In one aspect, the present invention provides a pharmaceutical composition comprising (a) a safe and effective amount of a compound of the present invention or a pharmaceutically acceptable salt thereof; and (b) a pharmaceutically acceptable carrier or excipient. The content of the compound of the present invention is generally 0.01-1000 mg / dose, preferably 100-1000 μg / dose.

[0097] For purposes of the present invention, effective dosage is to give individual about 0.01 mg / kg to 1000 mg / kg, preferably 0.1 mg / kg to 500 mg / kg body weight of the compounds of the present invention. In addition, the compounds of the present invention can be used alone or together with other therapeutic agents (such as formulated in the same pharmaceutical composition).

[0098] The pharmaceutical composition may also contain a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" refers to a carrier used for the administration of a therapeutic agent. The term refers to such pharmaceutical carriers that do not themselves induce the production of antibodies that are harmful to the individual receiving the composition and that are not excessively toxic after administration. These carriers are well known to those of ordinary skill in the art. A full discussion of pharmaceutically acceptable excipients can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., NJ 1991). Such carriers include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, adjuvants, and combinations thereof.

[0099] The pharmaceutically acceptable carrier in the pharmaceutical composition may contain a liquid such as water, saline, glycerol and ethanol. In addition, auxiliary substances such as wetting agents or emulsifiers, pH buffer substances, etc. may also be present in these carriers.

[0100] Typically, pharmaceutical compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution or suspension in liquid vehicles prior to injection can also be prepared.

[0101] Once formulated, the composition of the present invention can be administered by conventional routes, including (but not limited to): intramuscular, intravenous, subcutaneous, intradermal or topical administration. The subject to be prevented or treated can be an animal; especially a human.

[0102] When the pharmaceutical composition of the present invention is used for actual treatment, various dosage forms of the pharmaceutical composition can be used according to the usage, preferably an injection.

[0103] These pharmaceutical compositions can be prepared by mixing, diluting or dissolving according to conventional methods, and occasionally add suitable pharmaceutical additives, such as excipients, disintegrants, binders, lubricants, diluents, buffers, isotonicities, preservatives, wetting agents, emulsifiers, dispersants, stabilizers and cosolvents, and the preparation process can be carried out in a conventional manner according to the dosage form. Pharmaceutical compositions of the present invention can also be administered in a sustained release form.

[0104] When the pharmaceutical composition of the present invention is used for prevention or treatment, the dosage of the compound of the present invention or its pharmaceutically acceptable salt as the active ingredient can be reasonably determined according to the weight, age, sex, and symptom severity of each subject (patient) to be prevented or treated.

[0105] The compounds and pharmaceutical compositions according to the present invention can be used to treat diseases caused by abnormal chondrocyte activity, including but not limited to: cartilage damage caused by metabolic diseases (preferably rheumatoid arthritis, osteoarthritis); bone and joint damage, and the like.

[0106] Example

[0107] The present invention will be further described in detail below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. Unless otherwise stated, percentages and parts are calculated by weight.

[0108] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0109] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0110] Materials used for compound extraction, separation and identification

[0111] Semi-preparative HPLC: Unimicro EasySep-1010 binary pump, Unimicro EasySep-1010 detector (Unimicro, Shanghai, China); YMC-Pack ODS-A (250 × 20 mm, 5 μm) and YMC-Pack ODS-A (250 × 10 mm, 5 μm) chromatographic columns (YMC Co., Ltd., Kyoto, Japan); column chromatographic packing: normal phase silica gel (300–400 mesh) (Qingdao Ocean Chemical Co., Ltd., Qingdao, China), C-18 reverse phase silica gel (150–200 mesh) (Merck, Whitehouse Station, NJ, USA); semi-preparative HPLC: Unimicro Technologies EasySep TM-1020 dual pump system and UV detector; semi-preparative columns: YMC-Pack ODS-A (250×20 mm, 5 μm); eluent: acetonitrile / water or methanol / water; column chromatography filler: silica gel H60 (300-400 mesh), reversed-phase silica gel LiChroprep RP-18 (40-63 μm), Diol (SMB100-20 / 45); color developer: 10% by volume sulfuric acid ethanol solution; specific rotation: PerkinElmer 341 polarimeter; infrared spectrum: PerkinElmer 577 spectrometer (PerkinElmer, Waltham, MA, USA); melting point test: Büchi 510 melting point apparatus (Büchi, Flawil, Switzerland); UV spectrum: Varian Cary 50-visspectrophotometer (Varian, Melbourne, Australia); ECD experiment: JASCO J-810 spectrometer (JASCO Corporation, Tokyo, Japan); NMR spectrum test: Bruker AM-400, Bruker Advance III500, Bruker Advance III 600 (Bruker, Ettlingen, Germany) and Varian-MERCURY Plus-400 (Varian, Palo Alto, CA, USA); internal standards were the undeuterated proton signals of the solvent in the deuterated reagents: C5H5N (7.20 / 123.5), CHCl3 (7.26 / 77.0), MeOH (3.30 / 49.5); Mass spectrometry: low-resolution mass spectrometry was performed by Shimadzu LCMS-2020 spectrometer (Shimadzu, Kyoto, Japan); high-resolution mass spectrometry was performed by Waters-Micromass QTOFUltima Global mass spectrometer (Waters, Milford, MA, USA);.

[0112] The seeds of C. gemmatus were collected from Baoshan City, Yunnan Province, China in November 2018 and were collected and identified by Kunming Caizhi Biotechnology Co., Ltd.

[0113] Example 1 Preparation and structural identification of the compound

[0114] Extraction and separation of compounds from Celastrus orbiculatus seeds

[0115] (1) 10 kg of dried seeds of Celastrus gemmatus were crushed and soaked in 95% v / v ethanol for 5 times (5×5 L), each time for 7 days. The extracts were combined and concentrated under reduced pressure to obtain 308 g of total extract.

[0116] (2) The total extract was separated by C18 reverse phase silica gel column chromatography using 50% (v / v, 3 L), 70% (v / v, 3 L), 80% (v / v, 3 L), and 90% (v / v, 3 L) of methanol / water as gradient elution to obtain four fractions (Fr.1 to Fr.4).

[0117] (3) Fr.2 (120 g) was separated by Diol column chromatography using petroleum ether / acetone as the eluent (volume ratio of 10:1 to 5:1) and gradient elution at a flow rate of 40 ml / min for a total time of 90 min. An equal volume of the mobile phase was collected in a 50 ml test tube. Based on the absorption peaks obtained by ultraviolet monitoring at 200 nm, the collected liquids with similar absorption peaks were combined to obtain 7 subfractions (Fr.2-1 to Fr.2-7).

[0118] (4) Fraction Fr.2-3 (12 g) was separated and purified by C18 reverse phase silica gel column chromatography (methanol / water elution 30%-85%, v / v) and semi-preparative HPLC (75%, v / v acetonitrile / water, 30 min, 8.0 mL / min) to obtain compounds DY-8 (6 mg), DY-11 (6 mg), DY-12 (7 mg), DY-13 (5 mg), DY-14 ( 8mg), DY-15 (5mg), DY-16 (4mg), DY-19 (9mg), DY-20 (7mg), DY-21 (4mg), DY-22 (2mg), DY-3 8 (9mg), DY-39 (128mg), DY-40 (5mg), DY-41 (8mg), DY-42 (6mg), DY-43 (7mg) and DY-44 (5mg).

[0119] (5) Fraction Fr.2-1 (40 g) was separated by C18 reverse phase silica gel column chromatography with 40% (2 L), 60% (2 L), 70% (2 L), and 80% (2 L) methanol / water, respectively, to obtain four fractions (Fr.21-1 to Fr.21-4).

[0120] (6) Fraction Fr.21-3 (18 g) was first subjected to Diol column chromatography with petroleum ether / acetone as the eluent in a gradient elution from a volume ratio of 12:1 to 6:1, and then separated and purified by semi-preparative HPLC (70%, v / v acetonitrile / water, 28 min, 10.0 mL / min) to obtain compounds DY-1 (108 mg), DY-2 (3 mg), DY-3 (5 mg), DY-4 (33 mg), DY-5 (7 mg), DY-6 (10 mg), DY-7 (20 mg), DY-8 (30 mg), DY-9 (40 mg), DY-10 (10 mg), DY-11 (10 mg), DY-12 (10 mg), DY-13 (10 mg), DY-14 (10 mg), DY-15 (10 mg), DY-16 (10 mg), DY-17 (10 mg), DY-18 (10 mg), DY-19 (10 mg), DY-20 (10 mg), DY-21 (10 mg), DY-22 (10 mg), DY-23 (10 mg), DY-24 (10 mg), DY-25 (10 mg), DY-26 (10 mg), DY-27 (10 mg), DY-28 (10 mg), DY-29 (10 mg), DY-30 (10 mg), DY-31 (10 mg), DY-32 (10 mg), DY-33 (10 mg), DY-34 (10 mg), DY-35 (10 mg), DY-36 (10 mg), DY-37 (10 mg), DY-38 (10 mg), DY-39 (10 mg), DY-31 (10 mg), DY-3 6(11mg), DY-7(7mg), DY-9(7mg), DY-10(4mg), DY-17(2mg), DY-18(3mg), DY-29(12mg), DY-30(90mg ), DY-31 (16mg), DY-32 (21mg), DY-33 (15mg), DY-34 (26mg), DY-35 (9mg), DY-36 (4mg) and DY-37 (3mg).

[0121] (7) Fr.21-2 (5 g) was separated by Diol column chromatography using petroleum ether / acetone as the eluent for gradient elution from a volume ratio of 10:1 to 5:1. Semi-preparative HPLC (65%, v / v acetonitrile / water, 35 min, 10.0 mL / min) was used to separate and purify compounds DY-23 (412 mg), DY-24 (206 mg), DY-25 (129 mg), DY-26 (57 mg), DY-27 (107 mg) and DY-28 (13 mg).

[0122] For the specific separation process, see Figure 1 .

[0123] Physical and chemical properties and spectral data of compounds:

[0124] DY-1: (c 0.01, MeOH); UV(MeOH)λ max (kogε)201(3.74), 237(3.28)nm; IR(KBr)v max 3648, 3566, 2921, 2851, 1748, 1717, 1685, 1507, 1362, 1305, 1227, 1160, 1136, 1088, 1032, 763, 750, 605cm -1 ; 1 H NMR data (500 MHz, CDCl3) δ H AcO-1 [1.66 (3H, s)], AcO-6 [2.10 (3H, s)], AcO-8 [1.90 (3H, s)], FuO-9 [7.95 (1H, dd, J = 1.5, 0.8Hz), 7.40 (1H, br s), 6.65 (1H, dd, J = 1.6, 0.8Hz)], AcO-15 [2.33 (3H, s)], H-1 [5.32 (1H, dd, J = 11, 8, 4.5Hz)], H-2α [1.43 (1H, overlap)], H-2β[1.78(1H, m)], H-3α[1.43(1H, overlap)], H-3β[2.16(1H, m)], H-4[2.23(1H, m)] , H-6 [6.30 (1H, s)], H-7 [2.47 (1H, d, J = 3.2Hz)], H-8 [5.50 (1H, dd, J = 9.8, 3.2Hz)], H-9 [5.88 (1H, d, J = 9.8Hz)],H-12[1.58(3H,s)],H-13[1.39(3H,s)],H-14[0.99(3H,d,J=7.5Hz)],H-15[4.93,4.33(each 1H,d,J=12.5Hz)]; 13 C NMR data (125MHz, CDCl3)δ CAcO-1 [170.0 (s), 21.1 (q)], AcO-6 [169.7 (s), 21.3 (q)], AcO-8 [170.1 (s), 21.0 (q)], FuO-9 [162.1 (s), 148.3 (d), 144.2 (d), 118.9 (s), 109.7 (d)], AcO-15 [170.1 (s), 21.4 (q)], C-1 (78.2, d), C-2 (23.0, t), C-3 (26.3, t), C-4 (33.4, d), C-5 (91.0, s), C-6 (75.5, d), C-7 (52.2, d), C-8 (74.0, d), C-9 (75.1, d), C-10 (49.8, s), C-11 (82.5, s), C-12 (26.1, q), C-13 (30.8, q), C-14 (16.2, q), C-15 (60.8, t); (+)-HRESIMS m / z 587.2097 [M+Na] + (calcd for C 28 H 36 NaO 12 , 587.2099).

[0125] DY-2: -42 (c 0.01, MeOH); ECD (MeOH) λ max (Δε) 221 (-0.40), 253 (1.69) nm; UV (MeOH) λ max (logε) 202 (3.47) nm; IR (KBr) ν max 3648, 3566, 2923, 2852, 1737, 1716, 1680, 1507, 1362, 1307, 1260, 1233, 1160, 1080, 1028, 764, 750, 604 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ HAcO-1 [1.73 (3H, s)], AcO-8 [2.13 (3H, s)], FuO-9 [8.03 (1H, br s), 7.40 (1H, t, J = 1.7 Hz), 6.74 (1H, d, J = 1.8 Hz)], H-1 [5.28 (1H, dd, J = 11.9, 4.2 Hz)], H-2α [1.59 (1H, overlap)], H-2β [1.81 (1H, m)], H-3α [1.41 (1H, m)], H-3β [2.18 (1H, overlap)], H-4 [1.85 (1H, m)], H-6α [2.34 (1H, d, J = 12.8 Hz)], H-6β [1.91 (1H, dd, J = 12.8, 4.4 Hz)], H-7 [2.19 (1H, m)], H-8 [5.17 (1H, br s)], H-9 [4.85 (1H, s)], H-12 [1.43 (3H, s)], H-13 [1.21 (3H, s)], H-14 [1.08 (3H, d, J = 7.8 Hz)], H-15 [1.32 (3H, s)]; 13 13C NMR data (125 MHz, CDCl3) δ C AcO-1 [170.4 (s), 21.1 (q)], AcO-8 [169.4 (s), 21.5 (q)], FuO-9 [161.7 (s), 148.7 (d), 143.9 (d), 118.9 (s), 110.0 (d)], C-1 (73.7, d), C-2 (21.7, t), C-3 (26.9, t), C-4 (39.9, d), C-5 (87.9, s), C-6 (31.4, d), C-7 (48.2, d), C-8 (74.8, d), C-9 (76.9, d), C-10 (47.1, s), C-11 (81.1, s), C-12 (24.2, q), C-13 (30.4, q), C-14 (17.8, q), C-15 (18.0, q); (+)-HRESIMSm / z 471.1990 [M+Na] + (calcd for C 24 H 32 NaO8, 471.1989).

[0126] DY-3: +21 (c 0.01, MeOH); UV (MeOH) λ max (logε) 204 (3.53) nm; IR (KBr) ν max3648,3566,2924,2853,1745,1716,1680,1507,1363,1310,1237,1227,1161,1139,1078,1020,874,764,750,605 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ H AcO-1 [1.71 (3H, s)], FuO-9 [8.02 (1H, brs), 7.40 (1H, t, J = 1.8 Hz), 6.75 (1H, d, J = 1.9 Hz)], AcO-15 [2.16 (3H, s)], H-1 [5.43 (1H, dd, J = 12.3, 4.2 Hz)], H-2α [1.52 (1H, m)], H-2β [1.86 (1H, m)], H-3α [1.43 (1H, dt, J = 13.5, 3.2 Hz)], H-3β [2.24 (1H, m)], H-4 [1.85 (1H, m)], H-6α [2.00 (1H, m)], H-6β [2.23 (1H, m)], H-7 [2.04 (1H, m)], H-8α [2.20 (1H, m)], H-8β [2.09 (1H, m)], H-9 [5.30 (1H, d, J = 6.9 Hz)], H-12 [1.38 (3H, s)], H-13 [1.19 (3H, s)], H-14 [1.08 (3H, d, J = 7.8 Hz)], H-15 [4.53, 4.47 (each 1H, d, J = 12.1 Hz)]; 13 13C NMR data (125 MHz, CDCl3) δ C AcO-1 [170.2 (s), 21.1 (q)], FuO-9 [162.4 (s), 148.7 (d), 143.8 (d), 119.2 (s), 110.0 (d)], AcO-15 [170.8 (s), 21.5 (q)], C-1 (73.6, d), C-2 (22.6, t), C-3 (26.8, t), C-4 (40.1, d), C-5 (87.0, s), C-6 (36.7, t), C-7 (43.7, d), C-8 (34.0, t), C-9 (69.7, d), C-10 (50.5, s), C-11 (82.1, s), C-12 (24.3, q), C-13 (30.3, q), C-14 (17.4, q), C-15 (64.9, t); (+)-HRESIMS m / z 471.1990 [M + Na] + (calcd for C 24 H32 NaO8,471.1989).

[0127] DY-4: -227 (c 0.01, MeOH); ECD (MeOH) λ max (Δε) 220 (2.83), 242 (-2.46) nm; UV (MeOH) λ max (logε) 202 (4.05), 230 (4.13) nm; IR (KBr) ν max 3648, 3566, 2926, 2853, 1738, 1680, 1454, 1364, 1277, 1234, 1111, 1025, 764, 750, 712 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ H AcO-1 [1.41 (3H, s)], AcO-8 [2.03 (3H, s)], BzO-9 [8.01 (2H, d, J = 7.6 Hz), 7.54 (1H, t, J = 7.4 Hz), 7.42 (2H, t, J = 7.7 Hz)], H-1 [5.18 (1H, dd, J = 11.5, 5.6 Hz)], H-2α [1.60 (1H, m)], H-2β [1.63 (1H, m)], H-3α [1.38 (1H, overlap)], H-3β [2.14 (1H, ddt, J = 18.8, 10.2, 4.9 Hz)], H-4 [1.80 (1H, m)], H-6α [2.57 (1H, d, J = 12.8 Hz)], H-6β [1.86 (1H, dd, J = 12.8, 3.4 Hz)], H-7 [2.23 (1H, t, J = 4.0 Hz)], H-8 [5.51 (1H, t, J = 4.4 Hz)], H-9 [5.53 (1H, d, J = 5.0 Hz)], H-12 [1.52 (3H, s)], H-13 [1.21 (3H, s)], H-14 [1.13 (3H, d, J = 7.8 Hz)], H-15 [1.41 (3H, s)]; 13 13C NMR data (125 MHz, CDCl3) δ CAcO-1 [170.4 (s), 21.0 (q)], AcO-8 [169.9 (s), 21.2 (q)], BzO-9 [165.1 (s), 133.1 (d), 130.1 (s), 129.6×2 (d), 128.6×2 (d)], C-1 (79.2, d), C-2 (22.4, t), C-3 (26.9, t), C-4 (40.1, d), C-5 (89.2, s), C-6 (31.7, t), C-7 (48.0, d), C-8 (70.9, d), C-9 (75.3, d), C-10 (47.6, s), C-11 (80.9, s), C-12 (22.9, q), C-13 (30.1, q), C-14 (17.4, q), C-15 (12.0, q); (+)-HRESIMS m / z 481.2201 [M+Na] + (calcd for C 26 H 34 NaO7, 481.2197).

[0128] DY-5: -62 (c 0.01, MeOH); ECD (MeOH) λ max (Δε) 225 (0.22), 246 (-0.12) nm; UV (MeOH) λ max (logε) 202 (3.63), 235 (3.21) nm; IR (KBr) ν max 3648, 3566, 2925, 2853, 1748, 1729, 1680, 1507, 1367, 1306, 1231, 1162, 1138, 1083, 1034, 758, 751, 605 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ HAcO-1 [1.65 (3H, s)], AcO-6 [2.11 (3H, s)], AcO-8 [1.90 (3H, s)], FuO-9 [7.98 (1H, br s), 7.42 (1H, t, J = 1.8 Hz), 6.71 (1H, d, J = 1.6 Hz)], H-1 [5.17 (1H, dd, J = 11.9, 4.2 Hz)], H-2α [1.50 (1H, m)], H-2β [1.78 (1H, m)], H-3α [1.39 (1H, m)], H-3β [2.11 (1H, overlap)], H-4 [2.17 (1H, m)], H-6 [5.42 (1H, s)], H-7 [2.48 (1H, d, J = 3.0 Hz)], H-8 [5.23 (1H, dd, J = 9.9, 3.0 Hz)], H-9 [5.81 (1H, d, J = 9.9 Hz)], H-12 [1.56 (3H, s)], H-13 [1.37 (3H, s)], H-14 [0.98 (3H, d, J = 7.4 Hz)], H-15 [1.29 (3H, s)]; 13 13C NMR data (125 MHz, CDCl3) δ C AcO-1 [170.4 (s), 21.2 (q)], AcO-6 [169.8 (s), 21.3 (q)], AcO-8 [170.1 (s), 21.0 (q)], FuO-9 [162.0 (s), 147.9 (d), 144.1 (d), 119.4 (s), 109.8 (d)], C-1 (79.2, d), C-2 (22.1, t), C-3 (26.5, t), C-4 (34.0, d), C-5 (91.2, s), C-6 (76.4, d), C-7 (52.1, d), C-8 (73.4, d), C-9 (76.4, d), C-10 (46.9, s), C-11 (82.6, s), C-12 (25.8, q), C-13 (30.9, q), C-14 (17.1, q), C-15 (12.6, q); (+)-HRESIMS m / z 529.2052 [M+Na] + (calcd for C 26 H 34 NaO 10 , 529.2044).

[0129] DY-6: -1 (c 0.01, MeOH); UV (MeOH) λ max (logε) 201 (3.98), 231 (3.92) nm; IR (KBr) ν max3648,3566,2924,2852,1744,1723,1507,1362,1310,1276,1236,1160,1113,1051,759,750,715,603 cm -1 ; 1 H NMR data (500 MHz, CDCl3) δ H AcO-1 [1.77 (3H, s)], BzO-6 [8.20 (2H, d, J = 7.6 Hz), 7.59 (1H, t, J = 7.5 Hz), 7.47 (2H, t, J = 7.5 Hz)], AcO-8 [1.93 (3H, s)], FuO-9 [8.07 (1H, br s), 7.45 (1H, br s), 6.78 (1H, br s)], H-1 [5.27 (1H, dd, J = 11.5, 4.2 Hz)], H-2α [1.48 (1H, m)], H-2β [1.90 (1H, m)], H-3α [1.72 (1H, dt, J = 13.1, 3.2 Hz)], H-3β [1.90 (1H, m)], H-6 [5.62 (1H, s)], H-7 [2.60 (1H, d, J = 3.2 Hz)], H-8 [5.69 (1H, dd, J = 6.4, 3.3 Hz)], H-9 [5.28 (1H, d, J = 6.4 Hz)], H-12 [1.66 (3H, s)], H-13 [1.55 (3H, s)], H-14 [1.34 (3H, s)], H-15 [1.45 (3H, s)]; 13 C NMR data (125 MHz, CDCl3) δ C AcO-1 [170.2 (s), 20.8 (q)], BzO-6 [165.9 (s), 133.6 (d), 130.4×2 (d), 129.7 (s), 128.8×2 (d)], AcO-8 [169.3 (s), 21.0 (q)], FuO-9 [162.2 (s), 148.7 (d), 144.0 (d), 118.8 (s), 110.0 (d)], C-1 (72.4, d), C-2 (23.4, t), C-3 (38.9, t), C-4 (70.8, s), C-5 (91.4, s), C-6 (78.5, d), C-7 (53.9, d), C-8 (68.9, d), C-9 (71.8, d), C-10 (49.8, s), C-11 (84.7, s), C-12 (26.4, q), C-13 (30.5, q), C-14 (23.9, q), C-15 (19.7, q); (+)-HRESIMS m / z 607.2145 [M+Na]+ (calcd for C 31 H 36 NaO 11 , 607.2150).

[0130] DY - 7: - 25 (c 0.01, MeOH); UV (MeOH) λ max (log ε) 201 (3.88), 231 (3.75) nm; IR (KBr) ν max 3648, 3568, 2924, 2853, 1746, 1932, 1507, 1456, 1368, 1307, 1275, 1228, 1159, 1083, 1039, 763, 750, 711, 605 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ H AcO - 1 and AcO - 6 [1.60 (3H, s), 2.11 (3H, s)], FuO - 8 [7.61 (1H, br s), 7.28 (1H, t, J = 1.6 Hz), 6.46 (1H, d, J = 1.5 Hz)], BzO - 9 [7.99 (2H, d, J = 7.4 Hz), 7.59 (1H, t, J = 7.4 Hz), 7.44 (2H, t, J = 7.8 Hz)], AcO - 15 [2.35 (3H, s)], H - 1 [5.59 (1H, dd, J = 12.3, 4.3 Hz)], H - 2α [1.54 (1H, m)], H - 2β [1.94 (1H, m)], H - 3α [1.50 (1H, m)], H - 3β [2.27 (1H, m)], H - 4 [2.34 (1H, m)], H - 6 [5.99 (1H, s)], H - 7 [2.57 (1H, d, J = 3.4 Hz)], H - 8 [5.86 (1H, dd, J = 6.7, 3.4 Hz)], H - 9 [5.67 (1H, d, J = 6.7 Hz)], H - 12 [1.65 (3H, s)], H - 13 [1.44 (3H, s)], H - 14 [1.01 (3H, d, J = 7.5 Hz)], H - 15 [4.64, 4.50 (each 1H, d, J = 12.2 Hz)]; 13 13C NMR data (125 MHz, CDCl3) δ CAcO-1 and AcO-6 [169.8 (s), 169.8 (s), 21.3 (q) 20.8 (q)], FuO-8 [161.4 (s), 147.9 (d), 143.9 (d), 118.9 (s), 109.7 (d)], BzO-9 [165.6 (s), 133.7 (d), 130.4×2 (d), 129.2 (s), 128.5×2 (d)], AcO-15 [170.8 (s), 21.3 (q)], C-1 (73.1, d), C-2 (22.5, t), C-3 (26.5, t), C-4 (33.7, d), C-5 (89.6, s), C-6 (76.1, d), C-7 (53.6, d), C-8 (70.7, d), C-9 (69.3, d), C-10 (52.1, s), C-11 (82.9, s), C-12 (26.7, q), C-13 (31.1, q), C-14 (16.8, q), C-15 (64.5, t); (+)-HRESIMS m / z 649.2258 [M+Na] + (calcd for C 33 H 38 NaO 12 , 649.2255).

[0131] DY-8: -1 (c 0.01, MeOH); ECD (MeOH) λ max (Δε) 226 (-0.55), 246 (1.15) nm; UV (MeOH) λ max (logε) 201 (4.14), 231 (4.18) nm; IR (KBr) ν max 3648, 3566, 2931, 2856, 1744, 1730, 1682, 1507, 1368, 1311, 1276, 1232, 1160, 1048, 970, 874, 764, 750, 712 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ HAcO-1 [1.49 (3H, s)], FuO-6 [8.16 (1H, dd, J = 1.6, 0.8 Hz), 7.43 (1H, t, J = 1.6 Hz), 6.82 (1H, dd, J = 1.8, 0.7 Hz)], AcO-8 [1.88 (3H, s)], BzO-9 [8.02 (2H, d, J = 7.9 Hz), 7.58 (1H, tt, J = 7.4, 1.3 Hz), 7.45 (2H, t, J = 7.9 Hz)], H-1 [5.13 (1H, dd, J = 11.8, 3.9 Hz)], H-2α [1.41 (1H, m)], H-2β [1.84 (1H, m)], H-3α [1.65 (1H, m)], H-3β [1.86 (1H, m)], H-6 [5.70 (1H, s)], H-7 [2.61 (1H, d, J = 3.1 Hz)], H-8 [5.39 (1H, dd, J = 9.9, 3.2 Hz)], H-9 [5.97 (1H, d, J = 9.9 Hz)], H-12 [1.68 (3H, s)], H-13 [1.51 (3H, s)], H-14 [1.33 (3H, s)], H-15 [1.45 (1H, s)]; 13 13C NMR data (125 MHz, CDCl3) δ C AcO-1 [170.3 (s), 21.1 (q)], FuO-6 [162.1 (s), 149.3 (d), 144.2 (d), 119.2 (s), 110.0 (d)], AcO-8 [170.0 (s), 20.9 (q)], BzO-9 [165.5 (s), 133.4 (d), 129.9 (s), 129.8×2 (d), 128.8×2 (d)], C-1 (78.2, d), C-2 (24.2, t), C-3 (38.7, t), C-4 (70.7, s), C-5 (92.6, s), C-6 (76.8, d), C-7 (52.1, d), C-8 (73.4, d), C-9 (76.6, d), C-10 (48.0, s), C-11 (84.3, s), C-12 (25.6, q), C-13 (29.8, q), C-14 (23.7, q), C-15 (13.6, q); (+)-HRESIMS m / z 607.2152 [M+Na] + (calcd for C 31 H 36 NaO 11 , 607.2150).

[0132] DY-9: -48 (c 0.01, MeOH); UV (MeOH) λ max (log ε) 201 (3.97), 231 (3.91) nm; IR (KBr) ν max 3649, 3568, 2926, 2853, 1731, 1670, 1451, 1366, 1307, 1274, 1230, 1160, 1093, 1037, 966, 874, 758, 713 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ H AcO-1 [1.65 (3H, s)], AcO-6 [2.12 (3H, s)], FuO-8 [7.62 (1H, br s), 7.28 (1H, t, J = 1.8 Hz), 6.47 (1H, d, J = 1.8 Hz)], BzO-9 [8.00 (2H, d, J = 8.0 Hz), 7.57 (1H, t, J = 7.4 Hz), 7.44 (2H, t, J = 7.8 Hz)], H-1 [5.49 (1H, dd, J = 12.0, 4.3 Hz)], H-2α [1.65 (1H, overlap)], H-2β [1.88 (1H, m)], H-3α [1.46 (1H, m)], H-3β [2.22 (1H, m)], H-4 [2.28 (1H, m)], H-6 [5.40 (1H, s)], H-7 [2.60 (1H, d, J = 3.2 Hz)], H-8 [5.72 (1H, dd, J = 6.4, 3.2 Hz)], H-9 [5.39 (1H, d, J = 6.4 Hz)], H-12 [1.60 (3H, s)], H-13 [1.42 (3H, s)], H-14 [1.01 (3H, d, J = 7.4)], H-15 [1.41 (1H, s)]; 13 13C NMR data (125 MHz, CDCl3) δ CAcO-1 [170.1 (s), 20.9 (q)], AcO-6 [169.8 (s), 21.4 (q)], FuO-8 [161.3 (s), 148.0 (d), 143.8 (d), 118.9 (s), 109.8 (d)], BzO-9 [165.8 (s), 133.5 (d), 130.3×2 (d), 129.5 (s), 128.5×2 (d)], C-1 (73.4, d), C-2 (21.7, t), C-3 (26.9, t), C-4 (34.1, d), C-5 (89.9, s), C-6 (77.4, d), C-7 (53.9, d), C-8 (69.5, d), C-9 (72.8, d), C-10 (49.1, s), C-11 (83.0, s), C-12 (26.8, q), C-13 (31.4, q), C-14 (17.4, q), C-15 (18.9, q); (+)-HRESIMS m / z 591.2205 [M+Na] + (calcd for C 31 H 36 NaO 10 , 591.2201).

[0133] DY-10: -136 (c 0.01, MeOH); ECD (MeOH) λ max (Δε) 220 (2.39), 275 (-4.52) nm; UV (MeOH) λ max (logε) 204 (3.83), 217 (3.75), 280 (3.88) nm; IR (KBr) ν max 3647, 3567, 2926, 2854, 1732, 1680, 1363, 1308, 1259, 1230, 1166, 1094, 1025, 964, 873, 764, 750, 604 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ HAcO-1 [1.62 (3H, s)], AcO-6 [2.12 (3H, s)], CinO-8 [7.76 (1H, d, J = 16.0 Hz), 7.58 (2H, m), 7.40 (3H, m), 6.48 (1H, d, J = 16.0 Hz)], FuO-9 [7.94 (1H, br s), 7.37 (1H, t, J = 1.7 Hz), 6.68 (1H, d, J = 1.7 Hz)], H-1 [5.21 (1H, dd, J = 11.7, 4.4 Hz)], H-2α [1.63 (1H, overlap)], H-2β [1.71 (1H, m)], H-3α [1.42 (1H, overlap)], H-3β [2.13 (1H, m)], H-4 [2.22 (1H, m)], H-6 [6.09 (1H, s)], H-7 [2.49 (1H, d, J = 4.4 Hz)], H-8 [5.65 (1H, t, J = 4.8 Hz)], H-9 [5.55 (1H, d, J = 5.2 Hz)], H-12 [1.56 (3H, s)], H-13 [1.43 (3H, s)], H-14 [1.05 (3H, d, J = 7.5)], H-15 [1.44 (1H, s); 13 13C NMR data (125 MHz, CDCl3) δ C AcO-1 [170.3 (s), 21.1 (q)], AcO-6 [170.1 (s), 21.5 (q)], CinO-8 [165.7 (s), 145.9 (d), 134.5 (s), 130.6 (d), 129.0×2 (d), 128.5×2 (d), 117.7 (d)], FuO-9 [161.7 (s), 147.8 (d), 144.0 (d), 119.4 (s), 109.8 (d)], C-1 (79.1, d), C-2 (22.2, t), C-3 (26.7, t), C-4 (34.0, d), C-5 (91.2, s), C-6 (75.1, d), C-7 (53.0, d), C-8 (71.4, d), C-9 (74.0, d), C-10 (48.8, s), C-11 (81.8, s), C-12 (24.3, q), C-13 (30.8, q), C-14 (16.9, q), C-15 (12.2, q); (+)-HRESIMS m / z 617.2356 [M+Na] + (calcd for C 33 H 38 NaO 10 , 617.2357).

[0134] DY-11: -3 (c 0.01, MeOH); ECD (MeOH) λ max (Δε) 215 (-0.75), 242 (3.26) nm; UV (MeOH) λ max (logε) 201 (3.99), 231 (3.99) nm; IR (KBr) ν max 3648, 3566, 2929, 2857, 1743, 1719, 1680, 1509, 1362, 1311, 1276, 1231, 1159, 1119, 1076, 1028, 764, 750, 715, 602 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ H AcO-1 [1.68 (3H, s)], BzO-6 [8.16 (2H, d, J = 7.8 Hz), 7.57 (1H, t, J = 7.4 Hz), 7.45 (2H, t, J = 7.8 Hz)], AcO-8 [2.26 (3H, s)], FuO-9 [8.03 (1H, br s), 7.44 (1H, t, J = 1.7 Hz), 6.74 (1H, d, J = 1.7 Hz)], AcO-15 [2.30 (3H, s)], H-1 [5.43 (1H, dd, J = 12.1, 4.2 Hz)], H-2α [1.57 (1H, overlap)], H-2β [1.99 (1H, m)], H-3α [1.78 (1H, m)], H-3β [1.99 (1H, m)], H-6 [6.59 (1H, s)], H-7 [2.50 (1H, d, J = 3.0 Hz)], H-8 [5.30 (1H, d, J = 3.0 Hz)], H-9 [5.52 (1H, s)], H-12 [1.62 (3H, s)], H-13 [1.57 (3H, s)], H-14 [1.34 (3H, s)], H-15 [4.74, 4.59 (each 1H, d, J = 12.7 Hz)]; 13 13C NMR data (125 MHz, CDCl3) δ CAcO-1 [169.9 (s), 21.0 (q)], BzO-6 [165.9 (s), 133.5 (d), 130.2×2 (d), 129.9 (s), 128.7×2 (d)], AcO-8 [169.8 (s), 21.5 (q)], FuO-9 [161.1 (s), 149.0 (d), 144.2 (d), 118.2 (s), 109.9 (d)], AcO-15 [170.7 (s), 21.4 (q)], C-1 (72.6, d), C-2 (23.9, t), C-3 (38.6, t), C-4 (70.7, s), C-5 (91.8, s), C-6 (76.0, d), C-7 (53.3, d), C-8 (76.6, d), C-9 (73.1, d), C-10 (53.7, s), C-11 (83.2, s), C-12 (25.5, q), C-13 (29.8, q), C-14 (23.0, q), C-15 (65.1, t); (+)-HRESIMS m / z 665.2203 [M+Na] + (calcd for C 33 H 38 NaO 13 , 665.2205).

[0135] DY-12: -41 (c 0.01, MeOH); ECD (MeOH) λ max (Δε) 245 (1.09) nm; UV (MeOH) λ max (logε) 202 (3.77), 235 (3.35) nm; IR (KBr) ν max 3647, 3565, 3133, 2929, 2856, 1731, 1682, 1507, 1362, 1309, 1276, 1259, 1237, 1160, 1077, 968, 874, 766, 750, 605 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ HAcO-1 [1.76 (3H, s)], FuO-6, FuO-8 and FuO-9 [8.17 (1H, br s), 8.03 (1H, br s), 7.74 (1H, br s), 7.44 (1H, t, J = 1.7 Hz), 7.44 (1H, t, J = 1.7 Hz), 7.34 (1H, t, J = 1.7 Hz), 6.83 (1H, d, J = 1.7 Hz), 6.72 (1H, d, J = 1.7 Hz), 6.54 (1H, d, J = 1.7 Hz)], H-1 [5.29 (1H, dd, J = 12.0, 4.0 Hz)], H-2α [1.49 (1H, m)], H-2β [1.89 (1H, m)], H-3α [1.71 (1H, m)], H-3β [1.89 (1H, m)], H-6 [5.60 (1H, s)], H-7 [2.71 (1H, d, J = 3.3 Hz)], H-8 [5.80 (1H, dd, J = 6.4, 3.3 Hz)], H-9 [5.36 (1H, d, J = 6.4 Hz)], H-12 [1.73 (3H, s)], H-13 [1.55 (3H, s)], H-14 [1.34 (3H, s)], H-15 [1.45 (3H, s)]; 13 13C NMR data (125 MHz, CDCl3) δ C AcO-1 [170.2 (s), 20.8 (q)], FuO-6, FuO-8 and FuO-9 [162.1 (s), 162.0 (s), 161.2 (s), 149.3 (d), 148.7 (d), 148.0 (d), 144.2 (d), 144.1 (d), 144.0 (d), 119.2 (s), 118.9 (s), 118.8 (s), 110.0 (d), 109.9 (d), 109.8 (d)], C-1 (72.3, d), C-2 (23.5, t), C-3 (38.9, t), C-4 (70.8, s), C-5 (91.4, s), C-6 (77.6, d), C-7 (53.9, d), C-8 (69.1, d), C-9 (71.8, d), C-10 (49.9, s), C-11 (84.6, s), C-12 (26.5, q), C-13 (30.4, q), C-14 (24.0, q), C-15 (19.8, q); (+)-HRESIMS m / z 649.1890 [M + Na] + (calcd for C 32 H 34 NaO 13 , 649.1892).

[0136] DY-13: -30 (c 0.01, MeOH); UV (MeOH) λ max (logε) 204 (3.49), 237 (3.06) nm; IR (KBr) ν max 3648, 3566, 3135, 2932, 2861, 2836, 1747, 1681, 1507, 1362, 1309, 1228, 1159, 1077, 1048, 964, 874, 765, 750, 603 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ H AcO-1 and AcO-8 [1.93 (3H, s), 1.74 (3H, s)], FuO-9 [8.04 (1H, dd, J = 1.7, 0.8 Hz), 7.44 (1H, t, J = 1.8 Hz), 6.76 (1H, dd, J = 1.8, 0.8 Hz)], AcO-15 [2.25 (3H, s)], H-1 [5.33 (1H, dd, J = 12.5, 4.3 Hz)], H-2α [1.38 (1H, dddd, J = 13.1, 13.1, 13.0, 3.8 Hz)], H-2β [1.95 (1H, m)], H-3α [1.76 (1H, overlap)], H-3β [1.84 (1H, td, J = 13.8, 4.1 Hz)], H-6α [2.07 (1H, d, J = 12.9 Hz)], H-6β [2.53 (1H, dd, J = 12.9, 5.1 Hz)], H-7 [2.29 (1H, t, J = 4.0 Hz)], H-8 [5.56 (1H, dd, J = 6.4, 3.4 Hz)], H-9 [5.52 (1H, d, J = 6.4 Hz)], H-12 [1.62 (3H, s)], H-13 [1.32 (3H, s)], H-14 [1.28 (3H, s)], H-15 [4.58, 4.38 (each 1H, d, J = 12.3 Hz)]; 13 13C NMR data (125 MHz, CDCl3) δ CAcO-1 and AcO-8 [170.0 (s), 170.0 (s), 21.0 (q), 20.9 (q)], FuO-9 [162.2 (s), 148.7 (d), 144.0 (d), 118.7 (s), 110.0 (d)], AcO-15 [170.7 (s), 21.4 (q)], C-1 (71.9, d), C-2 (24.4, t), C-3 (36.8, t), C-4 (70.3, s), C-5 (89.5, s), C-6 (31.9, t), C-7 (48.1, d), C-8 (71.3, d), C-9 (68.2, d), C-10 (51.4, s), C-11 (83.7, s), C-12 (25.1, q), C-13 (31.0, q), C-14 (23.8, q), C-15 (64.3, t); (+)-HRESIMS m / z 545.1999 [M+Na] + (calcd for C 26 H 34 NaO 11 , 545.1993).

[0137] DY-14: -37 (c 0.01, MeOH); UV (MeOH) λ max (logε) 201 (3.77), 237 (3.37) nm; IR (KBr) ν max 3648, 3566, 3143, 2982, 2940, 2908, 2958, 1744, 1681, 1507, 1396, 1368, 1307, 1225, 1159, 1134, 1082, 1041, 973, 874, 855, 761, 741, 603 cm -1 ; 1 H NMR data (500 MHz, CDCl3) δ HAcO-1 [1.66 (3H, s)], AcO-8 and AcO-15 [2.28 (3H, s), 1.92 (3H, s)], FuO-9 [7.97 (1H, dd, J = 1.8, 0.8 Hz), 7.42 (1H, t, J = 1.7 Hz), 6.67 (1H, dd, J = 1.8, 0.8 Hz)], H-1 [5.23 (1H, dd, J = 12.3, 4.1 Hz)], H-2α [1.62 (1H, m)], H-2β [1.87 (1H, m)], H-3α [1.73 (1H, m)], H-3β [1.84 (1H, m)], H-6α [2.53 (1H, dd, J = 12.8, 1.5 Hz)], H-6β [2.50 (1H, dd, J = 12.9, 4.4 Hz)], H-7 [2.35 (1H, t, J = 3.2 Hz)], H-8 [5.44 (1H, dd, J = 9.8, 3.4 Hz)], H-9 [5.94 (1H, d, J = 9.8 Hz)], H-12 [1.61 (3H, s)], H-13 [1.30 (3H, s)], H-14 [1.33 (3H, s)], H-15 [5.09, 4.20 (each 1H, d, J = 12.7 Hz)]; 13 13C NMR data (125 MHz, CDCl3) δ C AcO-1 [170.1 (s), 21.0 (q)], AcO-8 and AcO-15 [170.7 (s), 170.6 (s), 21.6 (q), 21.1 (q)], FuO-9 [162.3 (s), 148.2 (d), 144.2 (d), 119.1 (s), 109.8 (d)], C-1 (77.2, d), C-2 (25.1, t), C-3 (36.7, t), C-4 (70.1, s), C-5 (91.2, s), C-6 (30.9, t), C-7 (47.1, d), C-8 (75.1, d), C-9 (75.4, d), C-10 (50.7, s), C-11 (83.1, s), C-12 (24.6, q), C-13 (30.4, q), C-14 (23.4, q), C-15 (61.4, t); (+)-HRESIMSm / z 545.1992 [M+Na] + (calcd for C 26 H 34 NaO 11 , 545.1993).

[0138] DY-15: -503 (c 0.01, MeOH); ECD (MeOH) λmax (Δε) 222 (4.98), 271 (-14.00) nm; UV (MeOH) λ max (logε) 204 (4.08), 217 (4.03), 280 (4.15) nm; IR (KBr) ν max 3648, 3566, 2984, 2933, 2867, 2833, 1744, 1732, 1716, 1681, 1507, 1362, 1307, 1279, 1260, 1165, 1077, 1002, 764, 750 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ H AcO-1 [1.61 (3H, s)], CinO-8 [7.64 (1H, d, J = 16.0 Hz), 7.55 (2H, m), 7.41 (3H, m), 6.45 (1H, d, J = 16.0 Hz)], FuO-9 [7.93 (1H, dd, J = 1.7, 0.8 Hz), 7.36 (1H, t, J = 1.8 Hz), 6.67 (1H, dd, J = 1.8, 0.8 Hz)], H-1 [5.13 (1H, dd, J = 11.8, 4.1 Hz)], H-2α [1.50 (1H, m)], H-2β [1.78 (1H, m)], H-3α [1.80 (1H, m)], H-3β [1.69 (1H, m)], H-6α [2.40 (1H, dd, J = 13.9, 2.1 Hz)], H-6β [2.33 (1H, m)], H-7 [2.32 (1H, m)], H-8 [5.57 (1H, t, J = 3.9 Hz)], H-9 [5.63 (1H, d, J = 4.9 Hz)], H-12 [1.59 (3H, s)], H-13 [1.33 (3H, s)], H-14 [1.33 (3H, s)], H-15 [1.41 (3H, s)]; 13 13C NMR data (125 MHz, CDCl3) δ CAcO-1 [170.3 (s), 21.1 (q)], CinO-8 [165.9 (s), 145.6 (d), 134.3 (s), 130.7 (d), 129.1×2 (d), 128.3×2 (d), 117.9 (d)], FuO-9 [161.7 (s), 147.7 (d), 144.0 (d), 119.5 (s), 109.8 (d)], C-1 (78.1, d), C-2 (24.7, t), C-3 (36.8, t), C-4 (70.5, s), C-5 (92.1, s), C-6 (26.3, t), C-7 (47.7, d), C-8 (70.2, d), C-9 (74.5, d), C-10 (47.6, s), C-11 (82.2, s), C-12 (22.9, q), C-13 (29.7, q), C-14 (23.5, q), C-15 (12.6, q); (+)-HRESIMS m / z 575.2254 [M+Na] + (calcd for C 31 H 36 NaO9, 575.2252).

[0139] DY-16: -76 (c 0.01, MeOH); ECD (MeOH) λ max (Δε) 210 (-6.30), 231 (2.83), 244 (2.94) nm; UV (MeOH) λ max (logε) 202 (4.24), 232 (4.21) nm; IR (KBr) ν max 3648, 3566, 3133, 2989, 2935, 2866, 2819, 1731, 1716, 1681, 1507, 1362, 1313, 1275, 1260, 1162, 874, 764, 750, 714 cm -1 ; 1 H NMR data (500 MHz, CDCl3) δ HAcO-1 [1.77 (3H, s)], BzO-6 [8.21 (2H, d, J = 8.0 Hz), 7.59 (1H, tt, J = 7.4, 1.3 Hz), 7.47 (2H, t, J = 7.8 Hz)], FuO-8 [8.04 (1H, dd, J = 1.6, 0.8 Hz), 7.34 (1H, t, J = 1.8 Hz), 6.54 (1H, dd, J = 1.9, 0.8 Hz)], FuO-9 [7.75 (1H, dd, J = 1.7, 0.8 Hz), 7.45 (1H, t, J = 1.7 Hz), 6.73 (1H, dd, J = 1.9, 0.8 Hz)], H-1 [5.32 (1H, dd, J = 12.1, 3.4 Hz)], H-2α [1.50 (1H, m)], H-2β [1.92 (1H, m)], H-3α [1.74 (1H, overlap)], H-3β [1.92 (1H, m)], H-6 [5.68 (1H, s)], H-7 [2.75 (1H, d, J = 3.3 Hz)], H-8 [5.85 (1H, dd, J = 6.3, 3.3 Hz)], H-9 [5.39 (1H, d, J = 6.3 Hz)], H-12 [1.73 (3H, s)], H-13 [1.56 (3H, s)], H-14 [1.36 (3H, s)], H-15 [1.49 (3H, s)]; 13 13C NMR data (125 MHz, CDCl3) δ C AcO-1 [170.2 (s), 21.0 (q)], BzO-6 [165.9 (s), 133.6 (d), 130.4×2 (d), 129.7 (s), 128.8×2 (d)], FuO-8 [161.2 (s), 148.7 (d), 144.0 (d), 118.9 (s), 109.8 (d)], FuO-9 [162.0 (s), 148.0 (d), 144.1 (d), 118.8 (s), 109.9 (d)], C-1 (72.3, d), C-2 (23.5, t), C-3 (38.9, t), C-4 (70.8, s), C-5 (91.4, s), C-6 (78.3, d), C-7 (53.9, d), C-8 (69.1, d), C-9 (71.8, d), C-10 (49.9, s), C-11 (84.7, s), C-12 (26.5, q), C-13 (30.5, q), C-14 (24.0, q), C-15 (19.8, q); (+)-HRESIMS m / z 659.2099 [M+Na] + (calcd for C 34 H 36NaO 12 , 659.2099).

[0140] DY-17: -16 (c 0.01, MeOH); ECD (MeOH) λ max (Δε) 215 (-0.87), 240 (1.35) nm; UV (MeOH) λ max (logε) 201 (3.93), 231 (3.86) nm; IR (KBr) ν max 3648, 3566, 2927, 2855, 1744, 1734, 1681, 1507, 1456, 1362, 1275, 1260, 1228, 1107, 1024, 802, 764, 750, 712 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ H AcO-1 [1.74 (3H, s)], BzO-6 [8.03 (2H, d, J = 7.6 Hz), 7.60 (1H, t, J = 7.6 Hz), 7.48 (2H, t, J = 7.8 Hz)], AcO-8 [2.27 (3H, s)], FuO-9 [8.04 (1H, br s), 7.42 (1H, t, J = 1.7 Hz), 6.75 (1H, dd, J = 1.8, 0.7 Hz)], H-1 [5.38 (1H, dd, J = 11.9, 4.0 Hz)], H-2α [1.61 (1H, overlap)], H-2β [1.88 (1H, m)], H-3α [1.32 (1H, overlap)], H-3β [2.24 (1H, overlap)], H-4 [2.44 (1H, m)], H-6 [5.93 (1H, s)], H-7 [2.63 (1H, d, J = 3.3 Hz)], H-8 [5.29 (1H, d, J = 3.3 Hz)], H-9 [4.97 (1H, s)], H-12 [1.49 (3H, s)], H-13 [1.45 (3H, s)], H-14 [1.04 (3H, d, J = 7.6 Hz)], H-15 [1.49 (3H, s)]; 13 13C NMR data (125 MHz, CDCl3) δ CAcO-1 [170.3 (s), 21.1 (q)], BzO-6 [169.6 (s), 133.6 (d), 130.0 (s), 129.7×2 (d), 128.8×2 (d)], AcO-8 [169.6 (s), 21.4 (q)], FuO-9 [161.5 (s), 148.9 (d), 144.0 (d), 118.6 (s), 109.9 (d)], C-1 (73.6, d), C-2 (21.5, t), C-3 (26.9, t), C-4 (34.4, d), C-5 (90.7, s), C-6 (76.5, d), C-7 (53.2, d), C-8 (76.3, d), C-9 (76.6, d), C-10 (50.0, s), C-11 (82.0, s), C-12 (25.6, q), C-13 (31.2, q), C-14 (17.6, q), C-15 (18.8, q); (+)-HRESIMS m / z 591.2206 [M+Na] + (calcd for C 31 H 36 NaO 10 , 591.2201).

[0141] DY-18: -135 (c 0.01, MeOH); ECD (MeOH) λ max (Δε) 219 (6.10), 241 (-4.92) nm; UV (MeOH) λ max (logε) 202 (3.95), 230 (3.92) nm; IR (KBr) ν max 3647, 3566, 2972, 2931, 2858, 1747, 1732, 1716, 1681, 1507, 1362, 1275, 1261, 1229, 1026, 966, 764, 750, 712 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ HAcO-1 [1.42 (3H, s)], AcO-6 [2.12 (3H, s)], FuO-8 [8.12 (1H, dd, J = 1.4, 0.6 Hz), 7.44 (1H, t, J = 1.7 Hz), 6.76 (1H, dd, J = 1.8, 0.7 Hz)], BzO-9 [7.93 (2H, d, J = 7.8 Hz), 7.51 (1H, tt, J = 7.5, 1.4 Hz), 7.36 (2H, t, J = 7.8 Hz)], H-1 [5.24 (1H, dd, J = 11.6, 4.6 Hz)], H-2α [1.61 (1H, overlap)], H-2β [1.68 (1H, overlap)], H-3α [1.45 (1H, overlap)], H-3β [1.63 (1H, overlap)], H-4 [2.23 (1H, m)], H-6 [6.14 (1H, s)], H-7 [2.50 (1H, d, J = 4.3 Hz)], H-8 [5.73 (1H, t, J = 4.8 Hz)], H-9 [5.62 (1H, d, J = 5.2 Hz)], H-12 [1.60 (3H, s)], H-13 [1.44 (3H, s)], H-14 [1.06 (3H, s)], H-15 [1.50 (1H, s)]; 13 13C NMR data (125 MHz, CDCl3) δ C AcO-1 [170.3 (s), 21.0 (q)], AcO-6 [170.2 (s), 21.4 (q)], FuO-8 [161.8 (s), 148.3 (d), 144.1 (d), 119.3 (s), 110.0 (d)], BzO-9 [165.1 (s), 133.2 (d), 130.1 (s), 129.7×2 (d), 128.5×2 (d)], C-1 (79.0, d), C-2 (22.2, t), C-3 (26.7, t), C-4 (34.0, d), C-5 (91.1, s), C-6 (75.0, d), C-7 (53.2, d), C-8 (71.3, d), C-9 (74.6, d), C-10 (48.9, s), C-11 (81.8, s), C-12 (24.3, q), C-13 (30.7, q), C-14 (16.9, q), C-15 (12.4, q); (+)-HRESIMS m / z 591.2206 [M+Na] + (calcd for C 31 H 36 NaO 10 , 591.2201).

[0142] DY-19: 23 (c 0.01, MeOH); ECD (MeOH) λ max (Δε) 212 (0.62), 220 (0.60), 234 (0.99) nm; UV (MeOH) λ max (logε) 201 (4.01), 231 (3.96) nm; IR (KBr) ν max 3648, 3566, 3007, 2987, 2942, 2867, 2817, 1748, 1731, 1716, 1680, 1507, 1362, 1313, 1275, 1261, 1224, 1089, 1037, 967, 764, 750, 711 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ H AcO-1 and AcO-8 [1.88 (3H, s), 1.55 (3H, s)], FuO-6 [8.14 (1H, br s), 7.44 (1H, t, J = 1.8 Hz), 6.81 (1H, d, J = 1.8 Hz)], BzO-9 [7.92 (2H, d, J = 8.0 Hz), 7.57 (1H, t, J = 7.5 Hz), 7.44 (2H, t, J = 7.8 Hz)], AcO-15 [2.42 (3H, s)], H-1 [5.29 (1H, dd, J = 12.3, 4.2 Hz)], H-2α [1.35 (1H, m)], H-2β [1.85 (1H, m)], H-3α [1.74 (1H, m)], H-3β [1.91 (1H, m)], H-6 [6.61 (1H, s)], H-7 [2.60 (1H, d, J = 3.4 Hz)], H-8 [5.72 (1H, dd, J = 9.7, 3.4 Hz)], H-9 [6.05 (1H, d, J = 9.7 Hz)], H-12 [1.72 (3H, s)], H-13 [1.55 (3H, s)], H-14 [1.34 (3H, s)], H-15 [4.89, 4.47 (each 1H, d, J = 12.8 Hz)]; 13 13C NMR data (125 MHz, CDCl3) δ CAcO-1 and AcO-8 [170.0 (s), 170.0 (s), 21.1 (q), 21.0 (q)], FuO-6 [162.1 (s), 149.2 (d), 144.2 (d), 119.2 (s), 109.9 (d)], BzO-9 [165.8 (s), 133.6 (d), 129.7×2 (d), 129.6 (s), 128.9×2 (d)], AcO-15 [170.7 (s), 21.4 (q)], C-1 (77.1, d), C-2 (24.7, t), C-3 (38.6, t), C-4 (70.5, s), C-5 (92.3, s), C-6 (75.6, d), C-7 (52.3, d), C-8 (73.9, d), C-9 (75.5, d), C-10 (50.8, s), C-11 (84.3, s), C-12 (25.8, q), C-13 (29.9, q), C-14 (23.4, q), C-15 (61.3, t); (+)-HRESIMS m / z 665.2212 [M+Na] + (calcd for C 33 H 38 NaO 13 , 665.2205).

[0143] DY-20: -8 (c 0.01, MeOH); ECD (MeOH) λ max (Δε) 217 (0.58) nm; UV (MeOH) λ max (logε) 201 (3.42), 231 (3.23) nm; IR (KBr) ν max 3648, 3566, 3007, 2988, 2871, 2821, 1748, 1732, 1716, 1681, 1559, 1507, 1489, 1362, 1275, 1260, 1040, 835, 764, 750 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ HAcO-1 and AcO-8 [2.05 (3H, s), 1.64 (3H, s)], AcO-6 [2.21 (3H, s)], FuO-9 [8.13 (1H, dd, J = 1.6, 0.8 Hz), 7.42 (1H, t, J = 1.7 Hz), 6.76 (1H, dd, J = 1.9, 0.8 Hz)], AcO-15 [2.27 (3H, s)], H-1 [5.37 (1H, dd, J = 11.9, 4.7 Hz)], H-2α [1.63 (1H, m)], H-2β [1.77 (1H, m)], H-3α [1.46 (1H, m)], H-3β [2.21 (1H, m)], H-4 [2.24 (1H, m)], H-6 [6.62 (1H, s)], H-7 [2.39 (1H, d, J = 3.1 Hz)], H-8 [5.54 (1H, overlap)], H-9 [5.55 (1H, d, J = 6.2 Hz)], H-12 [1.53 (3H, s)], H-13 [1.40 (3H, s)], H-14 [1.02 (3H, d, J = 7.4 Hz)], H-15 [5.06, 4.36 (each 1H, d, J = 13.1 Hz)]; 13 13C NMR data (125 MHz, CDCl3) δ C AcO-1 and AcO-8 [170.1 (s), 170.1 (s), 21.1 (q), 20.9 (q)], AcO-6 [169.9 (s), 21.4 (q)], FuO-9 [161.3 (s), 148.5 (d), 144.3 (d), 118.9 (s), 109.7 (d)], AcO-15 [170.6 (s), 21.7 (q)], C-1 (79.5, d), C-2 (23.1, t), C-3 (26.4, t), C-4 (33.3, d), C-5 (90.8, s), C-6 (74.8, d), C-7 (53.1, d), C-8 (70.4, d), C-9 (72.0, d), C-10 (51.0, s), C-11 (81.1, s), C-12 (24.7, q), C-13 (30.5, q), C-14 (15.3, q), C-15 (60.1, t); (+)-HRESIMS m / z 587.2102 [M+Na] + (calcd for C 28 H 36 NaO 12 , 587.2099).

[0144] DY-21: 13(c 0.01, MeOH); ECD (MeOH) λ max (Δε) 214 (-1.57), 241 (5.09) nm; UV (MeOH) λ max (logε) 201 (3.94), 231 (3.87) nm; IR (KBr) ν max 3648, 3566, 3009, 2972, 2933, 2866, 2823, 1748, 1731, 1716, 1681, 1507, 1362, 1308, 1276, 1260, 1235, 1161, 1047, 873, 764, 750, 714 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ H AcO-1 [1.67 (3H, s)], BzO-6 [8.20 (2H, d, J = 8.0 Hz), 7.58 (1H, t, J = 7.4 Hz), 7.46 (2H, t, J = 7.7 Hz)], AcO-8 [1.92 (3H, s)], FuO-9 [8.02 (1H, br s), 7.44 (1H, t, J = 1.7 Hz), 6.73 (1H, dd, J = 1.8, 0.8 Hz)], H-1 [5.13 (1H, dd, J = 11.7, 4.0 Hz)], H-2α [1.41 (1H, overlap)], H-2β [1.86 (1H, m)], H-3α [1.68 (1H, m)], H-3β [1.88 (1H, m)], H-6 [5.74 (1H, s)], H-7 [2.62 (1H, d, J = 3.2 Hz)], H-8 [5.38 (1H, dd, J = 9.9, 3.2 Hz)], H-9 [5.88 (1H, d, J = 9.9 Hz)], H-12 [1.66 (3H, s)], H-13 [1.52 (3H, s)], H-14 [1.34 (3H, s)], H-15 [1.41 (1H, s)]; 13 13C NMR data (125 MHz, CDCl3) δ CAcO-1 [170.3 (s), 21.2 (q)], BzO-6 [165.8 (s), 133.6 (d), 130.4×2 (d), 129.7 (s), 128.8×2 (d)], AcO-8 [170.0 (s), 21.0 (q)], FuO-9 [162.0 (s), 148.0 (d), 144.2 (d), 119.2 (s), 109.8 (d)], C-1 (78.2, d), C-2 (24.1, t), C-3 (38.7, t), C-4 (70.7, d), C-5 (92.5, s), C-6 (77.5, d), C-7 (52.1, d), C-8 (73.3, d), C-9 (76.2, d), C-10 (47.9, s), C-11 (84.3, s), C-12 (25.6, q), C-13 (29.8, q), C-14 (23.6, q), C-15 (13.5, q); (+)-HRESIMS m / z 607.2152 [M+Na] + (calcd for C 31 H 36 NaO 11 , 607.2150).

[0145] Celasgemin V (DY-22): (c 0.01, MeOH); ECD (MeOH) λ max (Δε) 245 (0.59) nm; UV (MeOH) λ max (logε) 203 (3.57) nm; IR (KBr) v max 3648, 3566, 2962, 2928, 2856, 2835, 1749, 1732, 1716, 1681, 1646, 1507, 1489, 1456, 1362, 1308, 1224, 1159, 1052, 964, 873, 763, 750 cm -1 ; 1 1H NMR data (500 MHz, CDCl3) δ HAcO-1 [1.74 (3H, s)], FuO-6 and FuO-9 [8.14 (1H, brs), 8.06 (1H, br s), 7.45 (1H, t, J = 1.7Hz), 7.44 (1H, t, J = 1.8Hz), 6.81 (1H, d, J = 1.8Hz), 6.77 (1H, d, J = 1.8Hz)], AcO-8 [1.93 (3H, s)], AcO-15 [2.36 (3H, s)], H-1 [5.33 (1H, dd, J = 12.2, 4.6Hz)], H-2α [1.38 (1H, m)], H-2β [1.94 (1H, m)], H-3α [1.75 (1H, m)], H-3β [1.92 (1H, m)], H-6 [6.07 (1H, s)], H-7 [2.54 (1H, d, J = 3.4Hz)], H-8 [5.80 (1H, dd, J = 6.5, 3.5Hz)], H-9 [5.52 (1H, d, J = 6.5Hz)], H-12 [1.68 (3H, s)], H-13 [1.57 (3H, s)], H-14 [1.32 (3H, s)], H-15 [4.54, 4.51 (each 1H, d, J = 12.5Hz)]; 13 13C NMR data (125 MHz, CDCl3) δ C AcO-1 [169.8 (s), 20.8 (q)], FuO-6 and FuO-9 [162.1 (s), 162.0 (s), 149.2 (d), 148.9 (d), 144.2 (d), 144.1 (d), 119.2 (s), 118.5 (s), 110.0 (d), 109.9 (d)], AcO-8 [169.4 (s), 20.9 (q)], AcO-15 [170.8 (s), 21.3 (q)], C-1 (71.9, d), C-2 (24.0, t), C-3 (38.7, t), C-4 (70.6, d), C-5 (91.1, s), C-6 (76.3, d), C-7 (53.8, d), C-8 (70.1, d), C-9 (68.1, d), C-10 (52.9, s), C-11 (84.7, s), C-12 (26.3, q), C-13 (30.2, q), C-14 (23.8, q), C-15 (64.1, t); (+)-HRESIMS m / z 655.2005 [M+Na] + (calcd for C 31 H 36 NaO 14 , 655.1997).

[0146] 1α,8β,15-Triacetyloxy-9β-furoyloxydihydro-β-agarofuran(DY-23): 1 H NMR(400MHz,CDCl3)δ H 8.05(1H,br s),7.42(1H,d,J=1.7Hz),6.76(1H,d,J=1.7Hz),5.52(1H,dd,J=6.2,3.4Hz),5.46(1H,d,J=6.3Hz),5.41(1H,dd,J=12.3,4.3Hz),4.53(1H,d,J=12.1Hz),4.40(1H,d,J=12.1Hz),2.23(3H,s),1.91(3H,s),1.73(3H,s),1.53(3H,s),1.20(3H,s),1.08(3H,d,J=7.9Hz);ESIMS m / z 529[M+Na] + 。

[0147] CelaspaculinH(DY-24): 1 H NMR(400MHz,CDCl3)δ H 7.99(1H,br s),7.41(1H,brs),6.71(1H,dd,J=1.8,0.9Hz),6.29(1H,s),5.50(1H,dd,J=11.9,4,6Hz),5.37(1H,s),5.22(1H,d,J=2.7Hz),4.61(1H,d,J=12.5Hz),4.57(1H,d,J=12.5Hz),2.34(1H,d,J=3.0Hz),2.23(3H,s),2.16(3H,s),2.07(3H,s),1.65(3H,s),1.50(3H,s),1.39(3H,s),0.95(3H,d,J=7.1Hz);ESIMSm / z 587[M+Na] + 。

[0148] Celaspaculin D(DY-25): 1 H NMR(400MHz,CDCl3)δ H 7.95(1H,br s),7.40(1H,t,J=1.8

[0149] Hz),6.67(1H,dd,J=1.8,0.8Hz),5.88(1H,d,J=9.8Hz),5.42(1H,dd,J=9.7,3.3Hz),5.29(1H,dd,J=11.8,4.2Hz),5.03(1H,d,J=12.5Hz),4.26(1H,d,J=12.5Hz),2.76(1H,d,J=12.8Hz),2.32(1H,t,J=4.1Hz),2.27(3H,s),1.91(3H,s),1.65(3H,s),1.54(3H,s),1.19(3H,s),1.12(3H,d,J=7.8Hz);ESIMS m / z 529[M+Na] + 。

[0150] 1α,8β,15-Triacetyloxy-9β-benzoyloxydihydro-β-agarofuran(DY-26): 1 H NMR(400MHz,CDCl3)δ H 8.09(2H,d,J=8.0Hz),7.57(1H,t,J=7.6Hz),7.45(2H,t,J=7.8Hz),5.58(2H,s),5.50(1H,dd,J=12.3,4.4Hz),4.57(1H,d,J=12.1Hz),4.42(1H,d,J=12.1Hz),2.25(3H,s),1.89(3H,s),1.62(3H,s),1.52(3H,s),1.22(3H,s),1.10(3H,d,J=7.8Hz);ESIMS m / z 539[M+Na] + 。

[0151] 1α,6β,8β,15-Trtraacetyloxy-9α-benzoyloxydihydro-β-agarofuran(DY-27): 1 H NMR(400MHz,CDCl3)δ H7.90(2H,d,J=8.0Hz),7.55(1H,t,J=7.4Hz),7.43(2H,t,J=7.6Hz),6.33(1H,s),6.01(1H,d,J=9.8Hz),5.59(1H,dd,J=9.8,3.2Hz),5.37(1H,dd,J=11.9,4.5Hz),4.79(1H,d,J=12.5Hz),4.50(1H,d,J=12.5Hz),2.50(1H,d,J=3.2Hz),2.36(3H,s),2.11(3H,s),1.86(3H,s),1.62(3H,s),1.54(3H,s),1.41(3H,s),0.99(3H,d,J=7.5Hz);ESIMS m / z 597[M+Na] + 。

[0152] 1α,8α,15-Triacetyloxy-9α-benzoyloxydihydro-β-agarofuran(DY-28): 1 H NMR(400MHz,CDCl3)δ H 8.04(2H,d,J=8.0Hz),7.55(1H,t,J=7.4Hz),7.44(2H,t,J=7.6Hz),5.67(1H,d,J=5.3Hz),5.54(1H,dd,J=5.3,1.3Hz),5.34(1H,dd,J=11.7,4.7Hz),4.85(1H,d,J=13.0Hz),4.79(1H,d,J=13.0Hz),2.81(1H,d,J=12.8Hz),2.14(3H,s),2.03(3H,s),1.54(3H,s),1.44(3H,s),1.22(3H,s),1.15(3H,d,J=7.8Hz);ESIMS m / z 539[M+Na] + 。

[0153] 1α,8β-Diacetyloxy-9β-benzoyloxydihydro-β-agarofuran(DY-29): 1 H NMR(400MHz,CDCl3)δ H8.10(2H,d,J=8.0Hz),7.56(1H,t,J=7.4Hz),7.45(2H,t,J=7.6Hz),5.42(1H,overlap),5.40(1H,overlap),5.27(1H,d,J=6.1Hz),1.89(3H,s),1.67(3H,s),1.50(3H,s),1.28(3H,s),1.21(3H,s),1.06(3H,d,J=7.8Hz);ESIMS m / z 481[M+Na] + 。

[0154] 1α,6β,8α-Triacetyloxy-9β-furoyloxy-dihydro-β-agarofuran(DY-30): 1 H NMR(400MHz,CDCl3)δ H 8.02(1H,br s),7.40(1H,t,J=1.8Hz),6.73(1H,d,J=1.9Hz),5.68(1H,s),5.32(1H,dd,J=11.9,4.3Hz),5.21(1H,d,J=3.3Hz),2.46(1H,d,J=3.3Hz),2.19(3H,s),2.08(3H,s),1.71(3H,s),1.45(3H,s),1.43(3H,s),1.39(3H,s),1.01(3H,d,J=7.4Hz);ESIMS m / z 529[M+Na] + 。

[0155] 1α,6β,8β-Triacetyloxy-9β-benzoyloxydihydro-β-agarofuran(DY-31): 1 H NMR(400MHz,CDCl3)δ H 8.08(2H,d,J=8.0Hz),7.57(1H,t,J=7.4Hz),7.45(2H,t,J=7.8Hz),5.57(1H,dd,J=6.3,3.2Hz),5.44(1H,dd,J=11.9,4.2Hz),5.33(1H,s),5.28(1H,d,J=6.3Hz),2.46(1H,d,J=3.1Hz),2.12(3H,s),1.88(3H,s),1.64(3H,s),1.54(3H,s),1.41(3H,s),1.37(3H,s),0.99(3H,d,J=7.4Hz);ESIMS m / z 539[M+Na]+ 。

[0156] 1α,8β,15-Triacetyloxy-9α-benzoyloxydihydro-β-agarofuran(DY-32): 1 H NMR(400MHz,CDCl3)δ H 7.90(2H,d,J=7.8Hz),7.54(1H,t,J=7.4Hz),7.42(2H,t,J=7.7Hz),5.99(1H,d,J=9.8Hz),5.49(1H,dd,J=9.7,3.3Hz),5.33(1H,dd,J=12.1,4.3Hz),4.89(1H,d,J=12.5Hz),4.41(1H,d,J=12.5Hz),2.75(1H,d,J=12.8Hz),2.35(1H,t,J=4.0Hz),2.29(3H,s),2.07(1H,dd,J=12.8,4.8Hz),1.87(3H,s),1.56(3H,s),1.52(3H,s),1.20(3H,s),1.12(3H,d,J=7.8Hz);ESIMS m / z 539[M+Na] + 。

[0157] 1α,6β,8β-Triacetyloxy-9α-benzoyloxydihydro-β-agarofuran(DY-33): 1 H NMR(400MHz,CDCl3)δ H 8.01(2H,d,J=7.8Hz),7.56(1H,t,J=7.4Hz),7.44(2H,t,J=7.7Hz),5.92(1H,d,J=9.9Hz),5.47(1H,s),5.29(1H,dd,J=9.9,3.1Hz),5.21(1H,dd,J=11.7,4.3Hz),2.51(1H,d,J=3.0Hz),2.12(3H,s),1.86(3H,s),1.59(3H,s),1.50(3H,s),1.38(3H,s),1.36(3H,s),1.00(3H,d,J=7.5Hz);ESIMS m / z 539[M+Na] + 。

[0158] 1α,6β,8α-Triacetyloxy-9α-benzoyloxydihydro-β-agarofuran(DY-34): 1H NMR(400MHz,CDCl3)δ H 8.01(2H,d,J=7.8Hz),7.56(1H,t,J=7.4Hz),7.43(2H,t,J=7.7Hz),5.92(1H,s),5.52(1H,dd,J=5.5,2.4Hz),5.52(1H,d,J=5.5Hz),5.21(1H,dd,J=11.2,4.9Hz),2.49(1H,d,J=3.9Hz),2.10(3H,s),2.09(3H,s),1.55(3H,s),1.48(3H,s),1.42(3H,s),1.40(3H,s),1.04(3H,d,J=7.4Hz);ESIMS m / z 539[M+Na] + 。

[0159] (1S,4S,5S,6R,7R,8S,9R,10S)-1,8-Diacetyloxy-6,9-dibenzoyloxy-4-hydroxydihydro-β-agarofuran(DY-35): 1 H NMR(400MHz,CDCl3)δ H 8.21(2H,d,J=7.8Hz),8.09(2H,d,J=7.8Hz),7.60(2H,t,J=7.3Hz),7.48(4H,t,J=7.6Hz),5.74(1H,dd,J=6.2,3.3Hz),5.65(1H,s),5.39(1H,d,J=6.0Hz),5.36(1H,dd,J=12.2,4.1Hz),3.04(1H,s),2.61(1H,d,J=3.2Hz),2.22(1H,t,J=7.6Hz),1.91(3H,s),1.67(3H,s),1.65(3H,s),1.56(3H,s),1.48(3H,s),1.36(3H,s);ESIMS m / z 617[M+Na] + 。

[0160] 1α,8α-Diacetyloxy-6β,9α-dibenzoyloxy-4β-hydroxydihydro-β-agarofuran(DY-36): 1 H NMR(400MHz,CDCl3)δ H8.20(2H,d,J=7.8Hz),8.04(2H,d,J=7.8Hz),7.59(2H,t,J=7.4Hz),7.47(4H,t,J=7.6Hz),6.25(1H,s),5.64(1H,d,J=5.3Hz),5.58(1H,dd,J=4.8,4.2Hz),5.17(1H,dd,J=11.8,3.9Hz),2.63(1H,d,J=4.3Hz),2.18(3H,s),1.66(3H,s),1.61(3H,s),1.55(3H,s),1.43(3H,s),1.40(3H,s);ESIMS m / z 617[M+Na] + 。

[0161] Celaspene A(DY-37): 1 H NMR(400MHz,C5D5N)δ H 8.34(2H,d,J=7.9Hz),8.27(2H,d,J=

[0162] 7.9Hz),7.56(1H,t,J=7.9Hz),7.48(1H,t,J=7.9Hz),7.47(2H,t,J=7.9Hz),7.35(2H,t,J=7.9Hz),7.07(1H,s),6.20(1H,d,J=5.6Hz),6.13(1H,dd,J=5.6,3.7Hz),5.87(1H,dd,J=11.7,4.7Hz),5.24(1H,d,J=13.2Hz),5.06(1H,d,J=13.2Hz),2.66(1H,d,J=3.7Hz),2.18(3H,s),2.17(3H,s),1.59(3H,s),1.57(3H,s),1.48(3H,s),1.06(3H,d,J=7.0Hz);ESIMS m / z 659[M+Na] + 。

[0163] Celaspaculin Q(DY-38): 1 H NMR(400MHz,CDCl3)δ H 8.17(1H,dd,J=1.7,0.7Hz),8.06

[0164] (1H,dd,J=1.7,0.7Hz),7.45(1H,t,J=1.6Hz),7.44(1H,t,J=1.6Hz),6.83(1H,dd,J=1.9,0.6Hz),6.77(1H,dd,J=1.9,0.6Hz),5.65(1H,dd,J=6.3,3.2Hz),5.54(1H,brs),5.26(1H,d,J=6.3Hz),5.25(1H,dd,J=11.8,4.0Hz),2.57(1H,d,J=3.2Hz),1.93(3H,s),1.76(3H,s),1.66(3H,s),1.54(3H,s),1.43(3H,s),1.32(3H,s);ESIMS m / z 597[M+Na] + 。

[0165] Celaspaculin F(DY-39): 1 H NMR(400MHz,CDCl3)δ H 8.14(1H,br s),8.00(1H,brs),7.43(1H,t,J=1.6Hz),7.42(1H,t,J=1.6Hz),6.80(1H,dd,J=1.8,0.6Hz),6.71(1H,dd,J=1.8,0.6Hz),5.84(1H,d,J=9.9Hz),5.64(1H,br s),5.32(1H,dd,J=9.9,3.2Hz),5.09(1H,dd,J=11.8,3.8Hz),2.57(1H,d,J=3.1Hz),1.90(3H,s),1.64(3H,s),1.64(3H,s),1.49(3H,s),1.37(3H,s),1.30(3H,s);ESIMS m / z 597[M+Na] + 。

[0166] Celaspaculin K(DY-40): 1 H NMR(400MHz,CDCl3)δ H 8.06(1H,dd,J=1.8,0.6Hz),7.42

[0167] (1H,t,J=1.7Hz),6.78(1H,d,J=1.6Hz),5.82(1H,d,J=6.4Hz),5.47(1H,dd,J=6.4,3.4Hz),5.45(1H,dd,J=12.3,4.3Hz),4.22(1H,dd,J=11.8,3.7Hz),3.89(1H,dd,J=11.8,6.7Hz),2.48(1H,d,J=12.8Hz),2.12(1H,dd,J=12.8,5.0Hz),1.92(3H,s),1.75(3H,s),1.53(3H,s),1.19(3H,s),1.06(3H,d,J=7.0Hz);ESIMS m / z 487[M+Na] + 。

[0168] Celaspaculin L(DY-41): 1 H NMR(400MHz,CDCl3)δ H 8.09(1H,dd,J=1.8,0.6Hz),7.43

[0169] (1H,t,J=1.7Hz),6.80(1H,dd,J=1.6,0.7Hz),5.75(1H,d,J=10.9Hz),5.49(1H,dd,J=6.2,3.1Hz),5.45(1H,d,J=6.2Hz),5.02(1H,ddd,J=11.4,11.4,4.5Hz),4.61(1H,d,J=12.2Hz),4.43(1H,d,J=12.2Hz),2.24(3H,s),1.93(3H,s),1.89(3H,s),1.79(3H,s),1.55(3H,s),1.21(3H,s),1.19(3H,d,J=7.0Hz);ESIMS m / z 587[M+Na] + 。

[0170] 1α,6β-Diacetyloxy-9α-benzoyloxy-8α-hydroxydihydro-β-agarofuran(DY-42): 1 H NMR(400MHz,CDCl3)δ H8.08(2H,d,J=7.8Hz),7.59(1H,t,J=7.4Hz),7.47(2H,t,J=7.7Hz),6.08(1H,s),5.45(1H,d,J=4.7Hz),5.18(1H,dd,J=11.5,4.6Hz),4.38(1H,dd,J=4.7,4.3Hz),2.49(1H,d,J=4.3Hz),2.11(3H,s),1.50(3H,s),1.47(3H,s),1.42(3H,s),1.41(3H,s),1.03(3H,d,J=7.4Hz);ESIMS m / z 497[M+Na] + 。

[0171] 1α,6β,15-Triacetyloxy-8β,9β-difiuroyloxy-4β-hydroxydihydro-β-agarofuran(DY-43): 1 H NMR(400MHz,CDCl3)δ H 8.01(1H,br s),7.73(1H,br s),7.44(1H,t,J=1.8Hz),7.34(1H,t,J=1.8Hz),6.69(1H,d,J=1.8Hz),6.52(1H,d,J=1.8Hz),6.09(1H,s),5.86(1H,dd,J=6.5,3.5Hz),5.59(1H,d,J=6.5Hz),5.35(1H,dd,J=12.5,4.1Hz),4.57(1H,d,J=12.3Hz),4.49(1H,d,J=12.3Hz),2.52(1H,d,J=3.5Hz),2.35(3H,s),2.12(3H,s),1.73(3H,s),1.73(3H,s),1.57(3H,s),1.32(3H,s);ESIMS m / z 655[M+Na] + 。

[0172] 1α-Acetyloxy-9α-benzoyloxy-8α-cinnamoloxy-6β-furoyloxy-4-hydroxydihydro-β-agarofuran(DY-44): 1 H NMR(400MHz,CDCl3)δ H8.14 (2H, dd, J = 1.8, 0.7Hz), 7.96 (2H, d, J = 7.8Hz), 7.72 (1H, d, J = 16.0Hz), 7.55 (2H, m), 7.49 (1H, t, J=7.5Hz), 7.41 (1H, t, J=1.8Hz), 7.38 (3H, m), 7.36 (2H, t, J=7.9Hz), 6.79 (1H, d, J=1.8Hz), 6.47 (1H, d, J=16.0Hz), 6.34 (1H, s), 5.71 (1H, dd, J=5.2, 4.2Hz), 5.65 (1H, d, J=5.2Hz), 5.13 (1H, dd, J=11.8, 4 .0Hz), 2.58 (1H, d, J = 4.2Hz), 1.66 (3H, s), 1.59 (3H, s), 1.55 (3H, s), 1.38 (3H, s), 1.36 (3H, s); ESIMS m / z 497[M+Na] + .

[0173] Biological activity test examples

[0174] (1) Experimental materials and instruments

[0175] Materials: Fetal bovine serum, α-MEM medium, penicillin / streptomycin were purchased from Gibco; DMSO, MTT, cytokines such as IL-1β were purchased from Peprotech; cell lysate was purchased from Promega; PBS was purchased from WISENT; 5-day-old C57BL / 6 mice were purchased from Slack.

[0176] Instruments: CO2 incubator from Thermo scientific, inverted microscope from Olympus, BiacoreT200 from GE.

[0177] (2) Cell preparation and culture

[0178] Under sterile conditions, the knee joints of 5-day-old C57BL / 6 mice were removed and minced with a sterile blade. The articular cartilage was then rinsed three times with PBS and then exposed to 2% type II collagenase and digested in a 37°C incubator for 4 hours. The digested cartilage tissue was centrifuged at 3000 rpm for 5 minutes. After the supernatant was extracted, the pellet of chondrocytes was resuspended in a medium filled with DMEM / F12 and FBS (10%) and penicillin / streptomycin antibiotics (1%), and stored in an incubator at 37°C in CO2 (5%). When the chondrocytes reached 80% to 90% fusion, the cells were collected with trypsin-EDTA (0.25%) and the cells were plated at an appropriate concentration (about 1×10 5 cells / ml) were seeded in 10 cm 2In order to reduce experimental errors, the second generation of chondrocytes were used.

[0179] (3) CCK-8 assay to detect the effects of compounds on chondrocyte proliferation:

[0180] In the presence of an electron coupling agent, the CCK-8 reagent can be reduced by the dehydrogenase in the mitochondria to generate a highly water-soluble orange-yellow formazan product. The depth of the color is proportional to the proliferation of the cells and inversely proportional to the cytotoxicity. CCK-8 can be used to evaluate the effect of the compound on the survival of bone marrow osteoclast precursor cells. This experiment set up an experimental group and a negative control group, with 3 replicates in each group. The second-generation chondrocytes were inoculated into a 96-well plate at a concentration of 2500 per well, 100 μL per well, and cultured overnight. The next day, the cells were treated differently: Experimental group: After the compound of the present invention was dissolved and diluted with DMSO, a solution with a final concentration of 40 μM / 20 μM was prepared with the same culture medium in step (2), and added to the experimental group well plate; Blank control group: Add culture medium with the same concentration of DMSO as the experimental group. After culturing in a 37°C incubator for 48 hours, the original culture medium was removed, and 100 μL of CCK-8 reagent was added to each well for 2 hours. The OD value was measured at 450 nM (reference 650 nM) on an ELISA instrument. It was expressed as: mean ± standard deviation. The proliferation rate was calculated as follows:

[0181]

[0182] The results are shown in Table 1, where the data show that the dihydro-β-agarwood furan-type sesquiterpenoid compounds of the present invention can significantly promote the proliferation of chondrocytes, especially compounds DY-12, DY-15, DY-19, DY-28, DY-37 and DY-39, which have significant effects and show obvious dose-dependent relationships.

[0183] Table 1 Proliferation rate of chondrocytes by compounds (%)

[0184]

[0185]

[0186] (4) Polymerase chain reaction (PCR) detection of the effects of compounds at the genetic level

[0187] The purpose of this experiment is to detect the effects of dihydro-β-agarwood furan-type sesquiterpenoids on the mRNA expression levels of key genes Co12A1, SOX-9, and MMP-13 in chondrocytes induced by pro-inflammatory factors (IL-1β). The specific experimental steps are as follows:

[0188] The second generation cells were cultured at 4 × 10 4The concentration of 20 μmol·L was inoculated into 6-well plates, 2 mL per well. After 24 h of culture, the experimental group was added with 40 μmol·L -1 The compound of the present invention and the culture medium containing 1 ng / mL IL-1β, the negative control group added an equal amount of culture medium (D+, containing 1 ng / mL IL-1β) to each well, and the blank group added an equal amount of culture medium (D-, not containing 1 ng / mL IL-1β) to each well (n=3), and placed in 5% CO2. After culturing in a 37°C incubator for 48 hours, total RNA was extracted, and the mRNA expression levels of Col2A1, SOX-9, and MMP-13 were detected by Real-time RT-PCR. The primers were synthesized by TaKaRa, and the sequences are as follows. The total RNA was extracted using the Trizol one-step method, and the purity was detected by a UV spectrophotometer and the concentration was adjusted to 50 ng·μL -1 The reverse transcription system, PCR amplification system and reaction conditions were set according to the kit instructions. The relative expression of the target gene was obtained after internal reference correction. Each cDNA sample was measured three times. All values ​​are expressed as mean ± SD.

[0189] Primer sequences Col2A1-F CCACACCAAATTCCTGTTCA (SEQ ID NO: 1) Col2A1-R ACTGGTAAGTGGGGCAAGAC (SEQ ID NO: 2) SOX9-F GAGCCGGATCTGAAGAGGGA (SEQ ID NO: 3) SOX9-R GCTTGACGTGTGGCTTGTTC (SEQ ID NO: 4) MMP-13-F TTGATGCCATTACCAGTCTCC (SEQ ID NO: 5) MMP-13-R ACATGGTTGGGAAGTTCTGG (SEQ ID NO: 6) β-ACTIN-F GGCTGTATTCCCCTCCATC (SEQ ID NO: 7) β-ACTIN-R CCAGTTGGTAACAATGCCATGT (SEQ ID NO: 8)

[0190] The expression levels of Col2A1, SOX-9, and MMP-13 were calculated using the mRNA value of β-actin as the internal reference gene: the detection gene template amount / the internal reference gene template amount. Figure 2-3 shown.

[0191] The COL2A1 gene is located on human autosome 12q13.11-q13.2. It mainly encodes the synthesis of type II collagen and participates in the regulation of intraperiosteal and endochondral ossification. Its mutation will cause abnormal structure of type II collagen. One of the characteristics of osteoarthritis is that the expression of the COL2A1 gene will be greatly reduced after the induction of proinflammatory factors. Figure 2 As shown, the mRNA level of COL2A1 in chondrocytes was significantly downregulated in the blank control group (D+) induced by adding IL-1β compared with the control group (D-) without adding the induction factor. The COL2A1 gene expression level of the D- group was positioned at 1 unit, and the 15 compounds of the present invention (DY-2, DY-5, DY-12, DY-13, DY-15, DY-16, DY-17, DY-28, DY-34, DY-36, DY-37, DY-38, DY-39, DY-40, DY-44) were able to reverse the trend of COL2A1 downregulation, so that the gene expression level increased to 0.8 units and above. Figure 3It shows that the dihydro-β-agarwood furan-type sesquiterpenoid compound DY-12 can also reverse the low expression of the marker gene SOX-9 mRNA in chondrocytes induced by IL-1β; at the same time, it can also downregulate the inflammation-induced chondrocyte matrix metalloproteinase-13 (MMP-13) mRNA expression and inhibit the degradation of the extracellular matrix of chondrocytes.

[0192] From the above experiments and results, it can be seen that the compounds of the present invention have the effects of promoting chondrocyte proliferation, reversing the expression of the marker genes Col2A1, SOX-9, and MMP-13 in chondrocytes induced by inflammation, and inhibiting the degradation of the extracellular matrix of chondrocytes.

Claims

1. A dihydro-β-agarwood furan-type sesquiterpenoid compound represented by formula (I) or a pharmaceutically acceptable salt thereof: In formula (I), R1, R2, R3, R5, R6, R7 and R8 are independently selected from: -H, -OH, =O, -COOH, C1-C10 alkyl, C2-C8 alkenyl, C2-C8 alkynyl and -OCOR a ; R4 is selected from: -H, -OH; in, R a Selected from: C1-C5 alkyl, C6-C12 aryl, 5-12 membered heteroaryl, C2-C6 alkenyl, C6-C12 aryl C2-C6 alkenyl, 5-12 membered heteroaryl C2-C6 alkenyl; One or more ring atoms in the heteroaryl group are heteroatoms selected from N, O or S, and the remaining ring atoms are carbon.

2. The dihydro-β-agarwood furan-type sesquiterpenoid compound represented by formula (I) or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that: (I), R1, R2, R3, R5, R6, R7 and R8 are independently selected from: -H, -OH, =O, C1-C5 alkyl (preferably C1-C3 alkyl, especially methyl, ethyl), C2-C4 alkenyl, C2-C4 alkynyl and -OCOR a ; R4 is selected from: -H, -OH; Among them, R a Selected from: C1-C5 alkyl (preferably C1-C3 alkyl, especially methyl, ethyl), C6-C10 aryl (e.g. phenyl), 5-10 membered heteroaryl (e.g. furyl), C2-C4 alkenyl, C6-C10 aryl C2-C4 alkenyl (e.g. styryl), 5-10 membered heteroaryl C2-C4 alkenyl.

3. The dihydro-β-agarwood furan-type sesquiterpenoid compound represented by formula (I) or a pharmaceutically acceptable salt thereof according to claim 1 or 2, characterized in that: In formula (I), R1 and R5 are independently selected from: -H, -OH, -OAc, -OBz, -OCin, -ONic and -OFu; preferably selected from: H, -OH, -OAc, -OBz, -ONic and -OFu; and / or R2, R3, R6, R7 and R8 are independently selected from: -H, -OH, -OAc, -OBz, -OCin, -ONic, -OFu, =O; preferably selected from: -H, -OH, -OAc, -OBz, -OCin, -ONic, -OFu.

4. The dihydro-β-agarwood furan-type sesquiterpenoid compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 3, characterized in that: In formula (I), R1 and R5 are independently selected from: OH, OBz, ONic and OAc; R2, R3, R6, R7 and R8 are independently selected from: OBz, OAc and ONic; R4 is selected from: H and OH; or R1 and R5 are independently selected from: -H, -OH, -OAc, -OBz ​​and -ONic; R2 and R3 are independently -H or -OAc; preferably, R2 and R3 are both -H; R4 is selected from: -H, -OH; R6 is selected from: -H, -OAc, -OFu; R7 is selected from: -OFu, OBz, -OCin; R8 is selected from: -H, -OH, -OAc.

5. The dihydro-β-agarwood furan-type sesquiterpenoid compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 4, characterized in that: The compound of formula (I) is selected from the structure shown in the following formula (I-1): Wherein, R1, R2, R3, R4, R5, R6, R7 and R8 are defined as described in any one of claims 1-4.

6. The dihydro-β-agarwood furan-type sesquiterpenoid compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 4, characterized in that: The compound of formula (I) is selected from the following group:

7. A method for preparing a dihydro-β-agarwood furan-type sesquiterpenoid compound represented by formula (I) according to any one of claims 1 to 6, characterized in that: The method comprises the following steps: (1) extracting dried Celastrus orbiculatus seeds with an ethanol solution, concentrating the extract to obtain extract A; preferably, the ethanol solution is 80-99%, v / v ethanol aqueous solution, preferably 95%, v / v ethanol aqueous solution; preferably, the mass volume ratio of Celastrus orbiculatus seeds to the ethanol solution is 10 kg: 3-8 L; preferably, the extraction is repeated 3-8 times, each extraction lasting 3-10 days; (2) extract A is separated by eluting with 48-52%, 68-72%, 78-82%, 88-92%, v / v methanol / water on a C18 reverse phase silica gel column, respectively, to obtain four fractions Fr.1-Fr.4; preferably, extract A is separated by eluting with 50%, 70%, 80%, 90%, v / v methanol / water on a C18 reverse phase silica gel column, respectively, to obtain four fractions Fr.1-Fr.4; (3) Fraction Fr.2 was subjected to gradient elution using a Diol column with petroleum ether / acetone in a volume ratio of 10:1 to 5:1 as the eluent, and the eluent was collected in equal volumes. The ultraviolet absorption peak of the eluent at 200 nm was monitored, and the eluents with the same or similar absorption peaks were combined to obtain seven subfractions Fr.2-1 to Fr.2-7; (4) Fraction Fr.2-3 was separated by gradient elution with 30%-85%, v / v methanol / water on a C18 reverse phase silica gel column, and then separated and purified by a semi-preparative ODS column with 75%, v / v acetonitrile / water as the mobile phase to obtain compounds DY-8, DY-11, DY-12, DY-13, DY-14, DY-15, DY-16, DY-19, DY-20, DY-21, DY-22, DY-38, DY-39, DY-40, DY-41, DY-42, DY-43 and DY-44; (5) Fraction Fr.2-1 is eluted with 38-42%, 58-62%, 68-72%, 78-82%, v / v methanol / water on a C18 reverse phase silica gel column to obtain four fractions Fr.21-1 to Fr.21-4 respectively; preferably, fraction Fr.2-1 is eluted with 40%, 60%, 70%, 80%, v / v methanol / water on a C18 reverse phase silica gel column to obtain four fractions Fr.21-1 to Fr.21-4 respectively; (6) Fraction Fr.21-3 was separated by gradient elution using a Diol column chromatography with petroleum ether / acetone in a volume ratio of 12:1 to 6:1 as the eluent, and then separated and purified by a semi-preparative ODS column with 70%, v / v acetonitrile / water as the mobile phase to obtain compounds DY-1, DY-2, DY-3, DY-4, DY-5, DY-6, DY-7, DY-9, DY-10, DY-17, DY-18, DY-29, DY-30, DY-31, DY-32, DY-33, DY-34, DY-35, DY-36 and DY-37; (7) Fraction Fr.21-2 was separated by gradient elution using Diol column chromatography with petroleum ether / acetone in a volume ratio of 10:1 to 5:1 as the eluent, and then separated and purified using a semi-preparative ODS column with 65%, v / v acetonitrile / water as the mobile phase to obtain compounds DY-23, DY-24, DY-25, DY-26, DY-27 and DY-28.

8. A composition comprising one or more of the dihydro-β-agarwood furan-type sesquiterpenoid compounds of formula (I) or pharmaceutically acceptable salts thereof according to any one of claims 1 to 6, and optionally an acceptable carrier or excipient; Preferably, the composition is a pharmaceutical composition, a dietary supplement, a nutritional supplement or a reagent.

9. An extract of Celastrus gemmatus Loes., comprising one or more compounds selected from the group consisting of: DY-1, DY-2, DY-3, DY-4, DY-5, DY-6, DY-7, DY-8, DY-9, DY-10, DY-11, DY-12, DY-13, DY-14, DY-15, DY-16, DY-17, DY-18, DY-19, DY-20, DY-21, DY-22; The structures of the compounds are shown in claim 6.

10. The dihydro-β-agarwood furan-type sesquiterpenoid compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 6, the compound of formula (I) obtained by the preparation method according to claim 7, the composition according to claim 8 and / or the Celastrus gemmatus Loes. extract according to claim 9 for one or more of the following uses: (a) Use in preparing a product for preventing and / or treating diseases or symptoms caused by abnormal chondrocyte activity, and / or improving bone and joint movement function; preferably, the abnormal chondrocyte activity includes: Chondrocyte apoptosis, down-regulation of mRNA expression of COL2A1 and / or SOX-9 in chondrocytes, up-regulation of mRNA expression of MMP-13 in chondrocytes, and degradation of chondrocyte extracellular matrix; preferably, the disease caused by abnormal chondrocyte activity refers to a disease caused by abnormal metabolism of chondrocytes or induced by various types of inflammation, including cartilage damage caused by metabolic diseases; Bone and joint injuries; preferably, the metabolic disease is rheumatoid arthritis or osteoarthritis; (b) Use in the preparation of products for promoting chondrocyte proliferation and / or inhibiting chondrocyte extracellular matrix degradation; (c) Use of a product for reversing the down-regulation of COL2A1 and / or SOX-9 mRNA expression in chondrocytes, or reversing the up-regulation of MMP-13 mRNA expression in chondrocytes; preferably, the down-regulation of COL2A1 and SOX-9 mRNA expression or the up-regulation of MMP-13 mRNA expression is induced by inflammation; Preferably, the product comprises a medicament, a reagent, a dietary or nutritional supplement.

Images