Soil aspergillus JM-F5-6 and application of soil aspergillus JM-F5-6 in promoting tomato growth and improving soil nutrients

Abstract

The invention provides an aspergillus terreus JM-F5-6 strain and application thereof in promoting tomato growth and improving soil nutrients, and belongs to the technical field of microorganisms. The preservation number of the aspergillus terreus JM-F5-6 is CCTCC (China Center For Type Culture Collection) NO: M20232616. The conidia of the aspergillus terreus JM-F5-6 are spherical or oval, the surface is smooth, hyphae are colorless or slightly colored, the wall is thick, the hyphae are separated, and hypha branches are laterally connected to form a mesh topology. The aspergillus terreus JM-F5-6 has high protein decomposition capacity and acid production capacity, is beneficial to improving the soil environment, can enhance the photosynthesis and nitrogen absorption of plants and improve the health and growth situation of the plants, effectively improves the content of soil hydrolytic nitrogen, available phosphorus, quick-acting potassium and organic matter, improves the soil fertility, and has wide market application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a strain of Aspergillus terreus JM-F5-6 and application thereof in promoting tomato growth and improving soil nutrients. Background Art

[0002] Aspergillus terreus belongs to the genus Aspergillus, belonging to the phylum Ascomycota, class Eurotiomycetes, order Eurotiales, family Trichocomaceae. Aspergillus terreus, an important component of soil microbial communities, is widely distributed in nature and grows better in soil environments rich in organic matter. The rich carbon and nitrogen sources provided to Aspergillus terreus come from the decomposition of plant residues such as fallen leaves and dead branches, allowing it to multiply in large numbers. Aspergillus terreus participates in the regulation of soil fertility and the transformation of organic matter, and has potential interactions with the growth and development of crops.

[0003] At present, agricultural production is facing challenges such as declining soil fertility and frequent pests and diseases, which affect crop yield and quality. Microorganisms play a key role in agricultural ecosystems. Aspergillus terreus is a fungus widely distributed in the soil and has potential agricultural application value. However, there are many species of Aspergillus terreus in the natural environment with different functions. Some of them are important plant pathogens that can cause diseases of many crops, such as wheat crown rot and wheat ear wilt.

[0004] Since there are significant differences in the physiological characteristics, enzyme activity and functional performance of Aspergillus terreus in different environments, there is an urgent need to carry out targeted screening to obtain Aspergillus terreus strains with specific excellent functions, and to deeply explore their functional mechanisms, including the decomposition of organic and inorganic substances in the soil, resistance to salt and alkali, soil-borne diseases and plant growth promotion, etc., so as to provide technical support for plant growth promotion and improvement of soil fertility, and open up a new path for green, efficient and sustainable development, which is of far-reaching significance for improving agricultural production efficiency, reducing the use of chemical inputs and promoting the balance of the agricultural ecological environment. Summary of the invention

[0005] The purpose of the present invention is to provide a strain of Aspergillus terreus JM-F5-6 and its application in promoting tomato growth and improving soil nutrients. The Aspergillus terreus JM-F5-6 described in the present invention has strong protein decomposition ability and high acid production ability, which helps to improve the soil environment, and effectively increases the content of soil hydrolyzable nitrogen, available phosphorus, available potassium and organic matter, improves soil fertility, and provides technical support for plant growth promotion and improving soil fertility.

[0006] In order to achieve the purpose of the above invention, the present invention adopts the following technical solutions: The present invention provides a strain of Aspergillus terreus JM-F5-6, which is classified as Aspergillus terreus , deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: M20232616.

[0007] Furthermore, the conidia of the Aspergillus terreus JM-F5-6 are spherical or elliptical, with a smooth surface and a color of green, pink or reddish brown; the hyphae are colorless or slightly colored, with thick walls and partitions; and the hyphae branches are connected laterally to form a network topology.

[0008] The present invention also provides the use of the Aspergillus terreus JM-F5-6 in a biological preparation for promoting tomato growth.

[0009] Furthermore, the tomato growth includes increased tomato nutrients and growth of tomato root system.

[0010] Furthermore, the Aspergillus terreus JM-F5-6 can increase the length, surface area, and volume of the root system, and improve the root length and root area of ​​the root system.

[0011] Furthermore, Aspergillus terreus JM-F5-6 can increase the chlorophyll content and nitrogen content of tomato leaves.

[0012] The present invention also provides the use of the Aspergillus terreus JM-F5-6 in improving soil nutrients.

[0013] Furthermore, the Aspergillus terreus JM-F5-6 has the ability to produce high amounts of protease, neutral phosphatase and cellulase.

[0014] Furthermore, the Aspergillus terreus JM-F5-6 has the ability to secrete organic acids and is salt- and alkali-resistant.

[0015] Furthermore, the Aspergillus terreus JM-F5-6 can increase the contents of hydrolyzable nitrogen, available phosphorus, quick-acting potassium and organic matter in the soil.

[0016] The present invention also provides the use of the Aspergillus terreus JM-F5-6 in preparing a biological preparation for inhibiting tomato-specific strains of Fusarium oxysporum.

[0017] Compared with the prior art, the advantages and beneficial technical effects of the present invention are: 1. The Aspergillus terreus JM-F5-6 screened by the present invention has the ability to efficiently produce enzymes, specifically including neutral phosphatase, protease, and cellulase, and also has the ability to secrete organic acids. It also shows its role in promoting the dissolution of insoluble nutrients, further improving the nutrients in the soil and improving soil fertility.

[0018] 2. The Aspergillus terreus JM-F5-6 screened by the present invention has the biological function of antagonizing the tomato-specific fungus of Fusarium oxysporum, providing a theoretical basis for the research and development and application of related biological agents in the later stage.

[0019] 3. The Aspergillus terreus JM-F5-6 screened by the present invention has a strong ability to promote plant growth, especially has a positive effect on the roots and leaves of tomatoes. Aspergillus terreus JM-F5-6 can enhance plant photosynthesis and nitrogen absorption, improve plant health and growth trend. The research and development of these substances will provide new ideas and methods for agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Fig. 1 is a morphological diagram of the Aspergillus terreus JM-F5-6 inoculated with Bengal red culture medium; Figure 2 This is a colony morphology diagram of the Aspergillus terreus JM-F5-6 inoculated with protein culture medium; Figure 3 It is a graph showing the secretion protease content of Aspergillus terreus JM-F5-6; Figure 4 This is a graph showing the activation of inorganic phosphorus by Aspergillus terreus JM-F5-6; Figure 5 It is the activation diagram of organic phosphorus by Aspergillus terreus JM-F5-6; Figure 6 It is a data diagram of neutral phosphatase produced by Aspergillus terreus JM-F5-6; Figure 7 This is a plate identification result of the cellulose decomposition function of Aspergillus terreus JM-F5-6; Figure 8 It is a data diagram of cellulase production by Aspergillus terreus JM-F5-6; Fig. 9 This is a morphological diagram of the Aspergillus terreus JM-F5-6 inoculated into saline-alkali culture medium; Fig.10 It is a morphological diagram of the antagonism between Aspergillus terreus JM-F5-6 and the tomato-specific strain of Fusarium oxysporum; Fig.11 This is a diagram of the root growth of tomatoes after being treated with the Aspergillus terreus JM-F5-6 bacterial solution; Fig.12 This is a scan of the tomato root system after being treated with the Aspergillus terreus JM-F5-6 bacterial solution; Fig.13 The data chart of leaf chlorophyll changes after applying soil Aspergillus JM-F5-6 bacterial solution to potted tomatoes; Fig.14 This is a data graph showing the changes in nitrogen content in the leaves of potted tomatoes after application of Aspergillus niger JM-F5-6 bacterial solution. DETAILED DESCRIPTION

[0021] The present invention is further described below in conjunction with specific implementation methods. It should be pointed out that the following implementation methods are only illustrative descriptions of the present invention in the form of examples, but the protection scope of the present invention is not limited thereto. All equivalent replacements made by technicians in this field to the present invention in the spirit of the present invention fall within the protection scope of the present invention.

[0022] Example 1: Strain sources and screening 1. Strain source The samples were collected from the soil in a greenhouse in Qingtianhu Village, Daotian Town, Shouguang City. The five-point sampling method was used to mix and refine the soil, which was the original sample. After returning to the laboratory, some samples were stored at -80℃ for strain isolation and screening.

[0023] 2. Strain Isolation and Purification (1) Red Bengal culture medium Glucose 10g, peptone 5g, potassium dihydrogen phosphate 1.0g, magnesium sulfate (anhydrous) 0.5g, rose Bengal (concentration 10g / L) 3.3ml, agar 15g / L, dissolved in 1000ml distilled water, add 0.1g / 3.3ml of streptomycin per liter of culture medium before use.

[0024] (2) Fungal isolation and screening Initial screening: Select Bengal rose culture medium. Take 1 mL and dilute to 10 -4 The soil solution was applied to the plate culture medium, and repeated 3 times. The plate was placed in a constant temperature incubator at 28℃ for 3-5 days, and the colony growth was observed. The conidia chain and hyphae structure were observed under a microscope. The strains with typical morphological characteristics of Aspergillus terreus were selected, and the colony numbers were recorded for purification.

[0025] Rescreening: Obtain pure culture by single spore isolation method to ensure the purity of the strain. Inoculate the purified strain onto red Bengal slant medium and store at 4°C for later use.

[0026] (3) Purification and culture of fungi Purification culture is performed from the suspected Aspergillus terreus colonies obtained by screening to obtain pure Aspergillus terreus strains. To ensure the purity of the strain, multiple purification cultures may be required. After each purification, the strain must be identified under a microscope to confirm whether it is a single Aspergillus terreus strain. Finally, a suspected Aspergillus terreus strain was screened out and named Aspergillus terreus JM-F5-6.

[0027] Example 2: Strain Identification 1. Morphological identification Aspergillus terreus can form characteristic colonies on a suitable red Bengal medium. Figure 1. The surface of the colony appears velvety or granular, with irregular or feathery edges. Combined with the observation of the microscopic structure of hyphae, spores, etc. under a microscope, conidiophores are usually straight or slightly curved, with conidial heads (conidialheads) formed at the top. The conidial heads are radial or spherical, which is an important morphological feature of Aspergillus terreus. The conidia of Aspergillus terreus are usually spherical or elliptical, with a smooth surface, and may be green, pink or reddish brown in color. The hyphae of Aspergillus terreus are colorless or slightly colored, with thick walls and septates. Under a microscope, the septa of the hyphae can be clearly seen, which is a common feature of Aspergillus fungi. The hyphae branches are connected laterally to form a network topology, which significantly increases the contact area with the culture medium and promotes nutrient absorption efficiency.

[0028] 2. Identification of strains using ITS method (1) The sequences of the primers used for PCR amplification of ITS rDNA are as follows (synthesized by TSINGKE, 5'→3'): ITS1: CCGTAGGTGAACCTGCGG (SEQ ID No.1); ITS4: TCCTCCGCTTATTGATATGC (SEQ ID No. 2).

[0029] (2) Method of extracting genomic DNA from fungi using a kit: Because fungal cells have thick cell walls on the outside, the effect of thermal lysis is poor, so a special silica gel column method is generally used to extract the genome. This experiment used the Solarbio Fungal Genomic DNA Extraction Kit (D2300).

[0030] (3) PCR reaction system (50ul) Table 1: PCR reaction system

[0031] (4) PCR reaction conditions 95℃, 5min; (95℃, 15s; 58℃, 30s; 72℃, 10s) 30cycle; 72℃, 10min; 4℃, ∞.

[0032] (5) Single strain sequencing analysis The purified PCR product was subjected to base sequence determination (the product sequence is shown in SEQ ID No. 3). The forward and reverse sequences with good peaks in the successful sequencing were spliced ​​to obtain the 16s rDNA sequence of the strain. After sequence comparison, it was confirmed that the Aspergillus terreus JM-F5-6 belonged to Aspergillus terreus.

[0033] The screened Aspergillus terreus JM-F5-6 strain was preserved in the China Center for Type Culture Collection; address: Wuhan University, Wuhan, China; preservation date: December 21, 2023; Aspergillus terreus The deposit number of JM-F5-6 is CCTCC NO: M 20232616.

[0034] Example 3: Identification of the protein degradation function of Aspergillus terreus JM-F5-6 1. Preparation of protease identification medium: A: 5 g skim milk powder was dissolved in 500 ml distilled water and sterilized by autoclave at 115°C for 10 min; B: Dissolve 15 g of agar powder in 500 ml of distilled water and sterilize at 121°C for 20 min.

[0035] Mix the sterilized A and B and pour into a plate for later use. After inoculation, incubate in a 30℃ incubator for 3 days to observe the presence of a transparent circle and record its size.

[0036] 2. Protein decomposition characteristics In the clean bench, inoculate the Aspergillus terreus strain into the protein culture medium to ensure that the operation area is sterile. After the inoculation is completed, the plate is inverted and placed in a constant temperature incubator. Culture it according to the suitable growth temperature of Aspergillus terreus at 28°C for 3-5 days, and observe the colony growth and transparent circle formation every day.

[0037] like Figure 2 As shown, Aspergillus terreus secretes proteases during its growth, which gradually decompose the proteins in the culture medium to form transparent circles (observe the front and back images of the strain). The size and clarity of the transparent circles are proportional to the enzyme activity. The higher the enzyme activity, the larger and clearer the transparent circles.

[0038] 3. Protease production Commercially available Bacillus subtilis was used as CK, and purified Aspergillus terreus JM-F5-6 and CK were inoculated into Bengal red liquid culture medium, respectively, and cultured at 28°C and 150 rpm for 3-5 days. The fermentation broth was collected and centrifuged (4000 rpm, 10 min), and the supernatant was used for enzyme activity determination. The total amount of protease was determined using a plant neutral phosphatase (NLP) enzyme-linked immunosorbent assay kit.

[0039] The results showed that Figure 3 The average enzyme content of Aspergillus terreus JM-F5-6 was 42.09 μg / L, which was significantly higher than that of the control group (13.81 μg / L), indicating that Aspergillus terreus JM-F5-6 had a strong protease secretion ability.

[0040] Example 4: Identification of the phosphate solubilization function of Aspergillus terreus JM-F5-6 1. Identification of the ability of Aspergillus terreus to decompose inorganic phosphorus Calcium phosphate medium preparation: glucose 10g, (NH4)2SO4 0.5 g, NaCl 0.3 g, KC10.3g, MgSO 4· 7H2O 0.3 g, FeSO 4· 7 H2O 0.03 g, MnSO 4· 4H2O 0.03g, Ca3(PO4) 25.0g, agar 20g. Distilled water 1000ml, pH 7.0, sterilized at 121℃ for 20 min.

[0041] Inoculation: Perform sterile operation in a clean bench and inoculate Aspergillus terreus into calcium phosphate plate culture medium. After inoculation, place the plate upside down in a constant temperature incubator and culture it at 28°C, which is suitable for the growth of Aspergillus terreus, for 3-5 days, and observe the colony growth and the formation of phosphate dissolution ring every day.

[0042] Observation: If Figure 4 As shown in the figure, when Aspergillus terreus was inoculated into a culture medium containing an insoluble phosphorus source (such as calcium phosphate), the hyphae expanded rapidly and formed a dense network structure. Within 48 hours after inoculation, obvious colony formation could be observed, and a transparent circle was formed around the colony. This indicates that the Aspergillus terreus enzyme has an activation effect on inorganic phosphorus.

[0043] 2. Identification of the ability of Aspergillus terreus to decompose organic phosphorus Preparation of calcium phytate medium: glucose 10g, (NH4)2SO4 0.5g, NaCl 0.3g, KCl 0.3g, MgSO 4· 7H2O 0.3g, FeSO 4· 7H2O 0.03g, MnSO4H2O 0.03g, calcium phytate 5.0g, agar 15g, distilled 1L, pH 7.0.

[0044] Inoculation: Perform sterile operation in a clean bench and inoculate Aspergillus terreus into calcium phytate plate culture medium. After inoculation, place the plate upside down in a constant temperature incubator and culture it at 28°C, which is suitable for the growth of Aspergillus terreus, for 3-5 days, and observe the colony growth and the formation of phosphate dissolution ring every day.

[0045] Observation: If Figure 5 As shown, when Aspergillus terreus was inoculated into calcium phytate culture medium, obvious colony formation could be observed within 3 days after inoculation. By observing the front and back sides, transparent circles were formed around the colonies, indicating that the strain had a strong ability to decompose organic phosphorus.

[0046] 3. Determination of the ability of Aspergillus terreus to produce neutral phosphatase Using commercially available Bacillus subtilis as CK, purified Aspergillus terreus JM-F5-6 and CK were inoculated into Bengal red liquid culture medium, respectively, and cultured at 28°C and 150 rpm for 3-5 days. The fermentation broth was collected and centrifuged (4000 rpm, 10 min), and the supernatant was used for enzyme activity determination. The neutral phosphatase activity was determined using a plant neutral phosphatase (NLP) enzyme-linked immunosorbent assay kit.

[0047] like Figure 6 The neutral phosphatase production of Aspergillus terreus strains and CK was shown. The neutral phosphatase production of Aspergillus terreus strains was significantly higher than that of the control group. The neutral phosphatase production of Aspergillus terreus strains was 80.00 ng / L, while the production of the control group was 38.41 ng / L, indicating that Aspergillus terreus strains have a strong ability to produce neutral phosphatase, which can significantly increase the effective phosphorus content in the culture solution and soil and enhance the activation effect of phosphorus.

[0048] Example 5: Cellulose decomposition properties of Aspergillus terreus 1. Identification of the ability of Aspergillus terreus to decompose cellulose Preparation of cellulose culture medium: 10 g of peptone, 10 g of yeast powder, 10 g of sodium hydroxymethyl cellulose, 5 g of sodium chloride, 1 g of potassium dihydrogen phosphate, 15 g of agar powder, dissolved in 1000 ml of distilled water, and sterilized at 121°C for 20 min.

[0049] In the clean bench, the purified Aspergillus terreus JM-C14-2 was inoculated into the cellulase culture medium and cultured at 28°C for 3-5 days. The colony diameter, color, edge characteristics and surface structure were regularly observed and recorded. If a transparent hydrolysis zone was formed around the colony, it indicated that the cellulase secreted by the strain had the ability to degrade the cellulose substrate.

[0050] like Figure 7 As shown, Aspergillus terreus JM-F5-6 can reproduce rapidly in cellulose culture medium, covering the entire culture medium in 2 days, making the cellulose culture medium transparent, and has a strong ability to decompose cellulose.

[0051] 2. Characteristics of cellulase secretion by Aspergillus terreus Commercially available Bacillus subtilis was used as CK, and purified Aspergillus terreus JM-F5-6 and CK were inoculated into Bengal red liquid culture medium, respectively, and cultured at 28°C and 150 rpm for 3-5 days. The fermentation broth was collected and centrifuged (4000 rpm, 10 min), and the supernatant was used for enzyme activity determination. The total amount of cellulase was determined using the plant cellulase (CE) enzyme-linked immunosorbent assay kit.

[0052] like Figure 8The cellulase production of Aspergillus terreus JM-F5-6 and CK was shown. The cellulase production of the control group was 26.95 ng / L, and the Aspergillus terreus strain was able to produce 99.20 ng / L of cellulase, which was significantly higher than CK. This shows that Aspergillus terreus JM-F5-6 has a strong ability to produce cellulase, which plays an important role in decomposing and transforming organic matter in the soil.

[0053] Example 6: Function of Aspergillus terreus to secrete organic acids 1. Czapek liquid medium: 5g peptone, 10g glucose, 1.0g potassium dihydrogen phosphate, 0.5g magnesium sulfate (anhydrous), 3.3ml Bengal red (concentration 10g / L), dissolved in 11ml distilled water, add 0.1g / 3.3ml streptomycin per liter of culture medium before use.

[0054] 2. Strain culture: The prepared liquid culture medium was divided into 250 mL conical flasks, 100 mL per flask, sterilized by high pressure at 121°C for 20 minutes, and cooled to room temperature. Under sterile conditions, a small amount of Aspergillus terreus hyphae was inoculated into the liquid culture medium with an inoculation loop, and the inoculated conical flask was placed in a constant temperature shaker, set at 28°C and 150 rpm, and cultured for 3-5 days.

[0055] 3. Determination of oxalic acid production by strains After the culture is completed, take 10 mL of culture medium, centrifuge (3000 rpm, 10 minutes) to remove the bacteria, take 5 mL of supernatant in a 100 mL conical flask, add 10 mL of 1:1 sulfuric acid solution, and place the conical flask on an electric stove to heat to 70-80°C to promote the reaction between oxalic acid and potassium permanganate. Titrate with 0.02 mol / L potassium permanganate standard solution while hot, slowly add dropwise at first, and continue titrating after the purple-red color fades until the solution turns slightly red and does not fade within 30 seconds, and record the volume of potassium permanganate consumed (V1). At the same time, set up a blank control, replace the supernatant with distilled water, repeat the above steps, and record the volume of potassium permanganate consumed (V0).

[0056] The calculation formula of oxalic acid content is:

[0057] Parameter Description: V1: Volume of potassium permanganate standard solution consumed in sample titration (mL) V0: Volume of potassium permanganate standard solution consumed in blank test (mL) C: Concentration of potassium permanganate standard solution (mol / L) 90.03: Molar mass of oxalic acid (g / mol) V: Sample volume (mL) 4. Analysis of oxalic acid production and pH value From the data in Table 2, it can be seen that there are significant differences in oxalic acid content and pH value between Aspergillus terreus and CK treatment groups. The oxalic acid content of Aspergillus terreus is as high as 42.88g / L, which is much higher than 6.05g / L of the CK treatment group, indicating that the Aspergillus terreus has a strong ability to synthesize oxalic acid. The pH value of the Aspergillus terreus strain treatment is 6.51, which is significantly lower than 7.05 of the CK treatment group, which is related to the synthesis and secretion of a large amount of oxalic acid by Aspergillus terreus. The oxalic acid secreted by Aspergillus terreus plays an important role in the dissolution of soil nutrients and the decomposition of organic matter.

[0058] Table 2: Oxalic acid production and pH value

[0059] Example 7: Identification of the salt-alkali resistance of Aspergillus terreus 7.5% sodium chloride medium: 3.0 g beef extract, 5.0 g peptone, 75.0 g sodium chloride, 15.0 g agar, 1000 mL distilled water, pH 7.0, 1000 ml distilled water, sterilize at 121 ℃ for 20 min.

[0060] Inoculation: Take the activated Aspergillus terreus strain and inoculate it onto the saline-alkali plate using the spot seeding method. Culture it at a constant temperature of 28°C for 3-5 days and observe the growth of the colonies.

[0061] Observation: If Fig. 9 As shown in the figure, the terreus fungus can still maintain relatively stable growth and morphological construction in a saline-alkali environment by observing the front and back morphology of the strain. The colony as a whole maintains a relatively regular circular outline, without obvious damage or growth inhibition, indicating that its cell structure and physiological function can remain relatively intact and stable within a certain range of saline-alkali concentrations, and has the ability to metabolize and reproduce under saline-alkali conditions. This shows that the terreus fungus can be used to improve the soil in saline-alkali land.

[0062] Example 8: Identification of resistance of Aspergillus terreus JM-F5-6 to soil-borne diseases PDA culture medium: 200g potatoes, 15-20g glucose, 15-20g agar powder, 1000ml distilled water.

[0063] Inoculation: In a clean bench, inoculate the pathogen onto PDA solid medium aseptically, and then use a pipette to inoculate 3 ml of 10-fold dilution of Aspergillus terreus supernatant. Set up 3 replicates for each treatment. In a sterile environment, inoculate the tomato-specific strain of Fusarium oxysporum as the treatment group, and also set up 3 replicates. Culture in a 28°C constant temperature incubator for 3-5 days. Regularly observe and record the growth of the colonies in the two treatments.

[0064] like Fig.10As shown in the figure, compared with the control group (right), the colonies of Aspergillus terreus JM-F5-6 in the treatment group (left) grew more vigorously around the inoculation point and on the entire plate, and significantly inhibited the growth of Fusarium oxysporum tomato-specific type ( Fusarium oxysporum f. sp. Lycopersici, FOL ) and prevented it from spreading at the inoculation site, indicating that the substances secreted by Aspergillus terreus JM-F5-6 can prevent the spread and growth of pathogens and have a strong effect against soil-borne Fusarium oxysporum tomato-specific diseases.

[0065] Example 9: Effect of Aspergillus terreus on soil nutrient decomposition Take 500 g of soil sample and evenly put it into 1L plastic cups to ensure the soil is consistent in tightness. The plastic cups are randomly divided into experimental group and control group, with 5 replicates in each group. Add 30mL of Aspergillus terreus liquid (OD 600 =0.3), then add 180ml of sterile water, and add an equal amount of 210ml of sterile water to the control group to make the soil reach saturated water holding capacity and ensure that the soil is in suitable humidity conditions. Cover the plastic cup with a layer of film and seal it, place it in a constant temperature incubator, and culture it at 25℃ and 60% for 30 days. During the culture period, weigh and add sterile water regularly to maintain constant soil humidity. After the culture, the soil indicators are measured using soil agrochemical analysis methods.

[0066] Table 3: Soil fertility of different treatments

[0067] According to Table 3, it can be observed that compared with CK, the application of Aspergillus terreus to the soil can significantly increase the content of soil hydrolyzable nitrogen, available phosphorus, fast-acting potassium, and organic matter. There is no significant difference in pH between Aspergillus terreus treatment and CK, indicating that Aspergillus terreus can significantly increase the content of hydrolyzable nitrogen, available phosphorus, and fast-acting potassium and organic matter in the soil, promote the decomposition and transformation of nutrients, and play a positive role in improving soil fertility.

[0068] Example 10: Effect of Aspergillus terreus on tomato growth 1. Indoor sand culture test Material preparation: Wash the sand several times with clean water, air dry it, and put it into a 500ml plastic cup. Put 200g of sand into each cup. Wash all the substrates of the root system of the 4-leaf tomato seedlings with uniform growth, and plant them in the sand for sand culture test. The nutrient solution used is Hogland nutrient solution.

[0069] Inoculation treatment: First, pour 30 ml of nutrient solution into each potted plant to fully soak the sand. Then, take 30 ml of activated bacteria from each group and dilute it 10 times for use. Pour 30 ml of diluted bacterial solution into each treatment. One group is the control group, which only pours 30 ml of nutrient solution and 30 ml of sterile water. Repeat each treatment 5 times.

[0070] Growth index measurement: After the tomato plants grow to 15 days old, use a plant nutrient rapid tester to measure the chlorophyll content and nitrogen content of the leaves. Use a root scanner to measure the root growth status.

[0071] 2. Effect of strains on the growth of tomato seedlings (1) Effect on tomato root growth By setting up a control group (CK, without bacterial solution) and a treatment group (adding Aspergillus terreus suspension), the study was conducted from two perspectives: root morphology comparison and data analysis after scanning.

[0072] Comparative analysis of root morphology Fig.11 and Fig.12 It can be seen intuitively that the tomato plants treated with Aspergillus terreus have obvious differences in root morphology compared with the control (CK). The tomato root system in the treatment group is more developed, the main root is longer, and the number of lateral roots is relatively large, showing a more vigorous growth trend; while the root system of the control group is relatively thin and weak, and the number of lateral roots is small. This morphological difference shows that Aspergillus terreus promotes the growth and development of tomato roots.

[0073] According to the root scanning data analysis, the root index values ​​of the treatment group and the control group (CK) in terms of multiple root indexes are shown in Table 4.

[0074] Table 4: Various indexes of tomato plant roots in the experimental group and the control group

[0075] Combining Table 4 and Fig.12 The data showed that the various root indexes of tomato plants in the experimental group with Aspergillus terreus liquid were significantly different from those in the control group. The total root length, total root surface area, total root projection area, total root volume, average root diameter and total number of root tips in the Aspergillus terreus treatment were significantly higher than those in the control group CK. This indicates that Aspergillus terreus has caused the tomato root system to form a larger surface area, increased the contact area between the root system and the soil, further improved the efficiency of the plant in obtaining various resources in the soil, improved the morphological structure and function of the root system, and had a positive impact on the growth and development of tomato plants.

[0076] (2) Effect on nutrients in tomato leaves The nutrient content of tomato seedling leaves was measured using a leaf nutrient rapid tester. Fig.13 and Fig.14 shown.

[0077] Depend on Fig.13 and Fig.14 It can be seen that Fig.13In terms of chlorophyll SPAD value, the average value of the treatment group (A. terreus) was 41.22, which was higher than the control group 37.30, indicating that the bacterial solution can increase the chlorophyll content of tomato leaves and enhance photosynthesis; according to Fig.14 The results showed that in terms of nitrogen content, the average value of the treatment group was 2.83 mg / kg, which was greater than the control group's 2.56 mg / kg, indicating that Aspergillus terreus can promote the absorption and accumulation of nitrogen in tomato leaves. Nitrogen is a component of important substances such as proteins and nucleic acids in plant growth and development, which helps the growth and development of leaves and promotes plant growth.

[0078] The above embodiments only illustrate the technical solutions of the present invention, rather than limiting it. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A strain of Aspergillus terreus JM-F5-6, characterized in that: Its classification name is Aspergillus terreus , deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: M20232616.

2. Use of the Aspergillus terreus JM-F5-6 described in claim 1 in the preparation of a biological agent for promoting tomato growth.

3. The use according to claim 2, characterized in that: The tomato growth includes tomato nutrient increase and tomato root growth.

4. The use according to claim 2, characterized in that: The Aspergillus terreus JM-F5-6 can increase the chlorophyll content and nitrogen content of tomato leaves.

5. Use of the Aspergillus terreus JM-F5-6 described in claim 1 in improving soil nutrients.

6. The use according to claim 5, characterized in that: The Aspergillus terreus JM-F5-6 has the ability to produce high amounts of protease, neutral phosphatase and cellulase.

7. The use according to claim 5, characterized in that: The Aspergillus terreus JM-F5-6 has the ability to secrete organic acid and is salt- and alkali-resistant.

8. The use according to claim 5, characterized in that: The Aspergillus terreus JM-F5-6 can increase the contents of hydrolyzable nitrogen, available phosphorus, quick-acting potassium and organic matter in the soil.

9. Use of the Aspergillus terreus JM-F5-6 described in claim 1 in the preparation of a biological agent for inhibiting the tomato-specific strain of Fusarium oxysporum.

Images