Schizochytrium limacinum genetic engineering strain for efficiently producing DHA (docosahexaenoic acid), construction method and application

Abstract

The invention discloses a schizochytrium limacinum genetic engineering strain for efficiently producing DHA (docosahexaenoic acid) as well as a construction method and application of the schizochytrium limacinum genetic engineering strain. The genetic engineering strain is obtained by knocking out a peroxisome matrix protein gene PEX10 in a schizochytrium limacinum wild type, destroys a beta oxidation pathway and blocks degradation of fatty acyl coenzyme A; the acetyl coenzyme carboxylase gene ACC1 is overexpressed to provide more malonyl coenzyme A precursors, so that the biosynthesis of fatty acid is promoted; the overexpressed diacylglycerol acyltransferase gene DGAT pulls the accumulation of fatty acid in the form of triglyceride. Under a shake flask condition, the DHA and PUFA generated after fermentation respectively reach 55.10% and 70.47% of the total oil content. Compared with a wild type, DHA and PUFA are respectively increased by 21.6% and 24.77% under the condition that the biomass is not obviously changed, and the strain has extremely high application potential.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and more specifically, to a Schizochytrium genetic engineering strain for efficiently producing DHA, a construction method and an application thereof. Background Art

[0002] In recent years, with people's increasing attention to resource and environmental issues, the use of microorganisms to produce fatty acids and their derivatives to replace the corresponding products from traditional fossil and animal and plant sources is considered a model of green biomanufacturing. Metabolic engineering refers to the modification of target enzymes and genes related to regulatory protein expression through genetic engineering tools to change the metabolism of microorganisms to achieve specific results of enhancing lipid and polyunsaturated fatty acid (PUFA) biosynthesis. As a major member of the Labyrinthulomycetes, Schizochytrium has attracted widespread attention as a potential industrial cell factory for the production of fatty acids and terpenoids. At present, the strain has passed the safety indicator (Generally Recognized as Safe, GRAS) certified by the US Food and Drug Administration (FDA). At the same time, docosahexaenoic acid (DHA, C22:6) produced by its fermentation has also been commercialized. Despite the above advantages, wild-type Schizochytrium still urgently needs to be modified through metabolic engineering to further improve its lipid production capacity. To date, there have been a large number of reports on the modification of Schizochytrium by overexpressing endogenous or heterologous genes to improve lipid production. However, these modification processes are limited by the fact that genetic transformation methods are inefficient and are relatively simple. Summary of the invention

[0003] The purpose of the present invention is to provide a Schizochytrium genetic engineering strain for efficiently producing DHA, a construction method and an application thereof.

[0004] In order to achieve these purposes and other advantages according to the present invention, a genetically engineered strain of Schizochytrium that efficiently produces DHA is provided, wherein the genetically engineered strain is obtained by knocking out the peroxisomal matrix protein gene PEX10 in the wild type of Schizochytrium, and the nucleotide sequence of the peroxisomal matrix protein gene PEX10 is SEQ ID NO: 1.

[0005] Preferably, the nucleotide sequence of the target site in the peroxisome matrix protein gene PEX10 is SEQ ID NO:2.

[0006] Preferably, the genetically engineered strain is obtained by knocking out the peroxisome matrix protein gene PEX10 in the wild type of Schizochytrium and then overexpressing the acetyl-Coenzyme carboxylase gene ACC1, and the nucleotide sequence of the acetyl-Coenzyme carboxylase gene ACC1 is SEQ ID NO:5.

[0007] Preferably, the genetically engineered strain is obtained by knocking out the peroxisome matrix protein gene PEX10 in the wild type of Schizochytrium and then overexpressing the diacylglycerol acyltransferase gene DGAT, and the nucleotide sequence of the diacylglycerol acyltransferase gene DGAT is SEQ ID NO:6.

[0008] Preferably, the genetically engineered strain is obtained by knocking out the peroxisome matrix protein gene PEX10 in the wild type of Schizochytrium and then overexpressing the acetyl-CoA carboxylase gene ACC1 and the diacylglycerol acyltransferase gene DGAT.

[0009] The present invention also provides a method for constructing the first Schizochytrium engineering strain, comprising the following steps: The endogenous tRNA promoter sequence was obtained by PCR amplification using the DNA genome of Schizochytrium as a template and the primer pair tRNA-F / R; Using the gRNA scaffold fragment shown in SEQ ID No: 3 as a template and the primer pair PEX10-N20-1F / 1R as primers, the sgRNA PEX10 sequence was obtained by PCR amplification; The endogenous tRNA promoter sequence was fused with the sgRNA PEX10 sequence, and the fused fragment was inserted into the BcuI site of the backbone vector pCB322 by homologous recombinase to obtain the PEX10 gene editing expression vector; The PEX10 gene editing expression vector was transferred into Schizochytrium through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ΔPEX10 transformants.

[0010] The present invention also provides a method for constructing the second Schizochytrium engineering strain, comprising the following steps: The endogenous tRNA promoter sequence was obtained by PCR amplification using the DNA genome of Schizochytrium as a template and the primer pair tRNA-F / R; Using the gRNA scaffold fragment shown in SEQ ID No: 3 as a template and the primer pair PEX10-N20-1F / 1R as primers, the sgRNA PEX10 sequence was obtained by PCR amplification; The endogenous tRNA promoter sequence was fused with the sgRNA PEX10 sequence, and the fused fragment was inserted into the BcuI site of the backbone vector pCB322 by homologous recombinase to obtain the PEX10 gene editing expression vector; The PEX10 gene editing expression vector was transferred into Schizochytrium through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ΔPEX10 transformants; The plasmid pC322-GFP is used as a backbone, and the C16 elongase gene E16 is inserted into the backbone to obtain the pCA322-E16 expression vector, and the nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 4; Inserting acetyl-CoA carboxylase gene ACC1 into pCA322-E16 expression vector to obtain recombinant vector pCA322-ACC1; The recombinant vector pCA322-ACC1 was transferred into Schizochytrium SR21-ΔPEX10 transformants by Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ACC1 transformants.

[0011] The present invention also provides a method for constructing the third Schizochytrium engineering strain, comprising the following steps: The endogenous tRNA promoter sequence was obtained by PCR amplification using the DNA genome of Schizochytrium as a template and the primer pair tRNA-F / R; Using the gRNA scaffold fragment shown in SEQ ID No: 3 as a template and the primer pair PEX10-N20-1F / 1R as primers, the sgRNA PEX10 sequence was obtained by PCR amplification; The endogenous tRNA promoter sequence was fused with the sgRNA PEX10 sequence, and the fused fragment was inserted into the BcuI site of the backbone vector pCB322 by homologous recombinase to obtain the PEX10 gene editing expression vector; The PEX10 gene editing expression vector was transferred into Schizochytrium through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ΔPEX10 transformants; The plasmid pC322-GFP is used as a backbone, and the C16 elongase gene E16 is inserted into the backbone to obtain the pCA322-E16 expression vector, and the nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 4; Inserting diacylglycerol acyltransferase gene DGAT into pCA322-E16 expression vector to obtain recombinant vector pCA322-DGAT; The recombinant vector pCA322-DGAT was transferred into Schizochytrium SR21-ΔPEX10 transformants by Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-DGAT transformants.

[0012] The present invention also provides a method for constructing the fourth Schizochytrium engineering strain, comprising the following steps: The endogenous tRNA promoter sequence was obtained by PCR amplification using the DNA genome of Schizochytrium as a template and the primer pair tRNA-F / R; Using the gRNA scaffold fragment shown in SEQ ID No: 3 as a template and the primer pair PEX10-N20-1F / 1R as primers, the sgRNA PEX10 sequence was obtained by PCR amplification; The endogenous tRNA promoter sequence was fused with the sgRNA PEX10 sequence, and the fused fragment was inserted into the BcuI site of the backbone vector pCB322 by homologous recombinase to obtain the PEX10 gene editing expression vector; The PEX10 gene editing expression vector was transferred into Schizochytrium through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ΔPEX10 transformants; The plasmid pC322-GFP is used as a backbone, and the C16 elongase gene E16 is inserted into the backbone to obtain the pCA322-E16 expression vector, and the nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 4; Inserting acetyl-CoA carboxylase gene ACC1 into pCA322-E16 expression vector to obtain recombinant vector pCA322-ACC1; Inserting diacylglycerol acyltransferase gene DGAT into the recombinant vector pCA322-ACC1 to obtain the recombinant vector pCA322-ACC1-DGAT; The recombinant vector pCA322-ACC1-DGAT was transferred into Schizochytrium SR21-ΔPEX10 transformants by Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ΔPEX10- ACC1-DGAT transformants.

[0013] The present invention also provides a method for producing DHA by fermentation of the above-mentioned Schizochytrium genetically engineered strain, comprising the following steps: The engineered strain of Schizochytrium was spread on a solid plate medium and cultured at a temperature of 20-30°C for 12-96 h; Select a single colony and inoculate it into the secondary seed liquid culture medium, and culture it at 20-30°C and 160-220 rpm on a shaker for 12-96 h to obtain a liquid seed solution; Inoculate the liquid seed solution into the fermentation medium at a ratio of 1% to 10%, culture at a temperature of 20 to 30°C and at a shaking speed of 160 to 220 rpm for 12 to 120 hours, and collect the bacteria after the culture is completed; The composition of the solid plate medium is as follows: 30 g / L glucose, 8 g / L yeast powder, 20 g / L sea crystal, 20 g / L agar powder, and the pH is adjusted to 6.5; The composition of the secondary seed liquid medium is: glucose 30 g / L, yeast powder 8 g / L, sea crystal 20 g / L, pH adjusted to 6.5; The composition of the fermentation broth medium is: glucose 80 g / L, yeast powder 5 g / L, NaCl 0.3 g / L, K2SO4 1 g / L, KH2PO4 0.1 g / L, MgSO4·7H2O 4 g / L, CaCl2 0.05 g / L, and the pH is adjusted to 6.5.

[0014] The present invention has at least the following beneficial effects: First, the present invention can significantly improve the proportion of fatty acids and reduce the production cost of unsaturated fatty acids produced by oil-producing fungi fermentation by knocking out an endogenous peroxisomal matrix protein gene PEX10 of Schizochytrium.

[0015] Second, the present invention further overexpresses endogenous ACC1 and DGAT genes in the engineered Schizochytrium with the PEX10 gene knocked out, and proposes to increase the production of DHA and PUFA through a "push-pull-resistance" approach.

[0016] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1A is a comparison of the sequence editing results of the transformant SR21-ΔPEX10 of the present invention; Figure 1B It is a comparison diagram of the fermentation results of the transformant SR21-ΔPEX10 of the present invention and the wild type SR21-WT of Schizochytrium; Figure 2A It is a comparison diagram of the fermentation results of the transformant SR21-ACC1 of the present invention and the wild type SR21-WT of Schizochytrium; Figure 2B It is a comparison diagram of the fermentation results of the transformant SR21-DGAT of the present invention and the wild type SR21-WT of Schizochytrium; Figure 3 It is a comparison chart of the fermentation results of the transformant SR21-ΔPEX10-ACC1-DGAT of the present invention and the wild type SR21-WT of Schizochytrium. DETAILED DESCRIPTION

[0018] The present invention is further described in detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0019] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0020] Example 1: Validation of knocking out the peroxisomal biogenesis factor 10 (PEX10) gene to disrupt the β-oxidation pathway and block the degradation of fatty acyl-CoA The specific method is as follows: 1. Primers 2. Fragment amplification and homologous recombination procedures 3. Experimental methods To construct the PEX10 deletion cassette, plasmid pCB322 was first digested with restriction endonuclease BcuI (Thermo Scientific) and the primer pairs tRNA-F / PEX10-N20-1R and PEX10-N20-1F / tRNA-R were used to generate the PEX10 deletion cassette from the wild type ( Aurantiochytrium limacinum SR21, the Schizochytrium has been disclosed in patent CN119307499A) genome, tRNA amplified from pCB332 Gly and the upstream 300 bp sequence and the scaffold sequence of sgRNA. Then the fragments were fused, and then the fusion fragments were connected to the pCB322 plasmid after enzyme digestion to form the PEX10 gene editing expression vector pCB322-ΔPEX10-1. Subsequently, pCB322-ΔPEX10-1 was first transformed into Agrobacterium AGL-1, and the obtained positive transformants were then used for Schizochytrium infection. The specific method of infection was referred to the previous patent CN119307499A of this laboratory, and Schizochytrium SR21-ΔPEX10 transformants were obtained. Finally, the transformants were passaged on the plates of the corresponding resistance genes for multiple rounds, and the transformants were verified.

[0021] Fermentation verification of transformants. First, the transformants of Schizochytrium SR21-ΔPEX10 were spread on seed solid plates for culture (temperature 28°C, culture time 48 h). Then, single colonies were selected and inoculated into secondary seed liquid culture medium for culture (temperature 28°C, 200 rpm, culture time 48 h) to obtain liquid seed liquid. Then, the liquid seed liquid was inoculated into fermentation liquid culture medium at an inoculation rate of 1-10% (temperature 28°C, 220 rpm, culture time 120 h). Finally, the cells were collected after the culture was completed, and the fatty acid composition of lipids was determined by gas chromatography (GC-2010, Shimadzu, Japan), which was equipped with an sp-2560 column (100 m×0.25 mm×0.20 μm, Supelco, USA) and a flame ionization detector, and then converted into fatty acid methyl esters by a modified standard method. The relative content of each component was calculated by chromatographic peak area normalization method.

[0022] Among them, the composition of the solid plate culture medium is: glucose 30 g / L, yeast powder 8 g / L, sea crystal 20 g / L, agar powder 20 g / L, and the pH is adjusted to 6.5; the composition of the secondary seed liquid culture medium is: glucose 30 g / L, yeast powder 8 g / L, sea crystal 20 g / L, and the pH is adjusted to 6.5; the composition of the fermentation liquid culture medium is: glucose 80g / L, yeast powder 5g / L, NaCl 0.3g / L, K2SO41g / L, KH2PO40.1g / L, MgSO4·7H2O 4g / L, CaCl20.05g / L, and the pH is adjusted to 6.5.

[0023] The nucleotide sequence of PEX10 is SEQ ID NO: 1: The nucleotide sequence of the target site of PEX10 is shown in SEQ ID NO: 2: CAGTCGTAAGAGACAAGCTG The gRNA scaffold fragment sequence is as shown in SEQ ID NO:3: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT 4. Results Figure 1B The results showed that compared with the wild type of Schizochytrium (hereinafter referred to as SR21-WT), the TFA accumulation capacity was improved without significant changes in biomass. 71.98% TFA was accumulated in DCW (cell dry weight method) Figure 1B ). In addition, the composition ratio of TFA (unsaturated fatty acids) also changed significantly. Compared with SR21-WT, the proportions of DPA (docosapentaenoic acid), DHA and PUFA in the Schizochytrium SR21-ΔPEX10 transformant (hereinafter referred to as SR21-ΔPEX10) increased by 2.1%, 10.32% and 9.43%, respectively. This may be because in the late fermentation, due to nutrient limitation conditions, SR21-WT will decompose the synthesized DHA and other fatty acids through the β-oxidation process to maintain metabolism. After knocking out PEX10, the β-oxidation pathway is destroyed and the degradation of fatty acyl-CoA is blocked, so the lipid degradation caused by β-oxidation can be alleviated.

[0024] Example 2: Verification of overexpression of ACC1 to provide more malonyl-CoA precursors and thus promote fatty acid biosynthesis The specific method is as follows: 1. Primers 2. Fragment amplification and homologous recombination procedures 3. Experimental methods Construction of expression vector. First, the existing expression plasmid pC322-GFP in the laboratory was digested with restriction endonuclease ApaI to obtain the basic skeleton. Second, the primer pair PA-F / R and CYC-F11 / R11 were used to extract the wild type of Schizochytrium ( Aurantiochytrium limacinumSR21, the endogenous promoter PA and terminator CYC sequences were amplified from the DNA genome of Schizochytrium (which has been disclosed in patent CN119307499A), and the codon-optimized C16 elongase gene E16 was obtained by amplification with primer pair E16-F / R. Subsequently, it was connected to the pC322-GFP expression vector after restriction digestion by homologous recombinase. Next, it was transformed with Escherichia coli DH5α and single colonies were selected for PCR verification to verify the positive transformants, thus successfully constructing pCA322-E16.

[0025] Obtaining transformants. Use restriction endonuclease XmaJI to digest plasmid pCA322-E16, and use primer pair ACC1-F / R to amplify the codon-optimized acetyl-CoA carboxylase gene ACC1, and then connect it to the pCA322-E16 expression vector after enzyme digestion by homologous recombinase. Then, after it is transformed with Escherichia coli DH5α, a single colony is selected for PCR verification to verify the positive transformants, and pCA322-ACC1 is successfully constructed. Finally, pCA322-ACC1 is first transferred into Agrobacterium AGL-1, and the obtained positive transformants are then used for infection with Schizochytrium SR21-ΔPEX10 to obtain Schizochytrium SR21-ACC1 transformants. For specific methods, refer to Example 1.

[0026] The fermentation verification of Schizochytrium SR21-ACC1 transformants was carried out according to the method of Example 1.

[0027] The nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 4: ATGGAGTCTGGTCCTATGCCTGCTGGTATCCCTTTCCCTGAGTACTACGACTTCTTCATGGACTGGAAGACCCCTCTCGCTATTGCTGCTACCTACACCGTCGCTGTCGGTCTCTTCAACCCTAAGGTCGGTAAGGTCTCTCGCGTCGTCGCTAAGTCTGCTAACGCTAAGCCTGCTGAGCGCACTCAGTCTGGTGCTGCTATGACCGCTTTCGTCTTCGTCCACAACCTCATCCTCTGCGTCTACTCTGGTATCACCTTCTACCACATGTTCCCTGCTATGGTCAAGAACTTCCGCACCCACACCCTCCACGAGGCTTACTGCGACACCGATCAGTCTCTCTGGAACAACGCTCTCGGTTACTGGGGTTATCTCTTTTACCTCTCTAAGTTCTACGAGGTCATCGACACCATCATTATCATCCTCAAGGGTCGCCGCTCTTCTCTCCTTCAGACCTACCACCACGCTGGTGCTATGATCACCATGTGGTCTGGTATCAACTACCAAGCTACCCCTATCTGGATCTTCGTCGTCTTCAACTCTTTCATCCACACCATCATGTACTGCTACTACGCTTTCACCTCTATCGGTTTCCACCCTCCTGGTAAGAAGTACCTCACCTCTATGCAGATCACTCAGTTCCTCGTCGGTATCACCATCGCTGTCTCTTACCTCTTCGTCCCTGGTTGCATCCGCACCCCTGGTGCTCAGATGGCTGTCTGGATCAACGTCGGTTACCTCTTCCCTCTTACCTACCTCTTCGTTGATTTTGCTAAGCGCACCTACTCTAAGCGCACCGCTATCGCTGCTCAAAAAAAGGCTCAGTAG The nucleotide sequence of ACC1 is SEQ ID NO: 5: 4. Results The fatty acid content and fatty acid composition of the obtained strain SR21-ACC1 are as follows Figure 2A Compared with SR21-WT, the lipid content of SR21-ACC1 increased from 66.34% to 75.65%; the DPA production of SR21-ACC1 increased from 8.03% to 14.49%; the DHA production of SR21-ACC1 increased from 33.50% to 49.40%. The PUFA ratio of SR21-ACC1 increased from 45.70% to 64.80%.

[0028] Example 3: Verification of overexpression of DGAT to promote the accumulation of fatty acids in the form of triacylglycerol (TAG) The specific method is as follows: 1. Primers 2. Fragment amplification and homologous recombination procedures 3. Experimental methods The pCA322-E16 expression vector was constructed. The specific method is as shown in Example 2.

[0029] The plasmid pCA322-E16 was digested with restriction endonuclease XmaJI, and the codon-optimized acetyl-CoA carboxylase gene DGAT was amplified with primer pair DGAT-F / R, and then connected to the pCA322-E16 expression vector after restriction digestion by homologous recombinase. Then, it was transformed with Escherichia coli DH5α and single colonies were selected for PCR verification to verify the positive transformants, thus successfully constructing pCA322-DGAT. Finally, pCA322-DGAT was first transferred into Agrobacterium AGL-1, and the obtained positive transformants were then used for infection with Schizochytrium SR21-ΔPEX10 to obtain Schizochytrium SR21-DGAT transformants. The specific method is shown in Example 1.

[0030] For the fermentation verification of the transformants, the method is as in Example 1.

[0031] The nucleotide sequence of DGAT is SEQ ID NO: 6: 4. Results The fatty acid content and fatty acid composition of the obtained strain SR21-DGAT are as follows Figure 2B As shown. Compared with SR21-WT, the lipid content of SR21-DGAT increased from 66.34% to 73.14%; the DPA production of SR21-DGAT increased from 8.03% to 15.16%; the DHA production of SR21-DGAT increased from 33.50% to 53.21%. The PUFA ratio of SR21-DGAT increased from 45.70% to 66.63%.

[0032] Example 4: Co-expression of ACC1 and DGAT to design the “push-pull-block” process of TAG synthesis 1. Primers 2. Fragment amplification and homologous recombination procedures 3. Experimental methods The pCA322-E16 expression vector was constructed. The specific method is as shown in Example 2.

[0033] The plasmid pCA322-ACC1 was digested with restriction endonuclease BcuI, and the sequences of the endogenous promoter PATP and terminator TA were amplified from the DNA genome of SR21-WT with primer pairs PATP-F / R and TA-F / R, and the acetyl-CoA carboxylase gene DGAT after codon optimization was amplified with primer pair DGAT-F1 / R1, and then connected to the pCA322-ACC1 expression vector after enzyme digestion by homologous recombinase. Then, it was transformed with Escherichia coli DH5α and single colonies were selected for PCR verification to verify the positive transformants, and thus pCA322-ACC1-DGAT was successfully constructed. Finally, pCA322-ACC1-DGAT was first transferred into Agrobacterium AGL-1, and the obtained positive transformants were then used for infection with Schizochytrium SR21-ΔPEX10 to obtain Schizochytrium SR21-ΔPEX10-ACC1-DGAT transformants. The specific method is shown in Example 1.

[0034] 4. Results By overexpressing ACC1 in the SR21-ΔPEX10 strain to provide more malonyl-CoA precursors, the biosynthesis of TFA was promoted. At the same time, DGAT was also overexpressed to promote the accumulation of TFA in the form of TAG. The fatty acid content and fatty acid composition of the resulting strain SR21-ΔPEX10-ACC1-DGAT are shown in Figure 2. Figure 3As shown. Compared with SR21-WT, the lipid content of SR21-ΔPEX10-ACC1-DGAT increased from 66.34% to 77.14%; the DPA production of SR21-ΔPEX10-ACC1-DGAT increased from 8.03% to 15.80%; the DHA production of SR21-ΔPEX10-ACC1-DGAT increased from 33.50% to 55.10%. The PUFA ratio of SR21-ΔPEX10-ACC1-DGAT increased from 45.70% to 70.47%. This increase in ratio is significantly greater than that reported in the literature.

[0035] The number of equipment and processing scales described here are used to simplify the description of the present invention. Applications, modifications and variations of the endogenous tRNA promoters and their use of the present invention will be apparent to those skilled in the art.

[0036] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. A genetically engineered strain of Schizochytrium for efficiently producing DHA, characterized in that: The genetically engineered strain is obtained by knocking out the peroxisomal matrix protein gene PEX10 in the wild type of Schizochytrium, and the nucleotide sequence of the peroxisomal matrix protein gene PEX10 is SEQ ID NO:

1.

2. The genetically engineered strain of Schizochytrium for efficiently producing DHA according to claim 1, characterized in that The nucleotide sequence of the target site in the peroxisomal matrix protein gene PEX10 is SEQ ID NO:

2.

3. The genetically engineered strain of Schizochytrium for efficiently producing DHA according to claim 1, characterized in that The genetically engineered strain is obtained by knocking out the peroxisomal matrix protein gene PEX10 in the wild type of Schizochytrium and then overexpressing the acetyl-Coenzyme carboxylase gene ACC1. The nucleotide sequence of the acetyl-Coenzyme carboxylase gene ACC1 is SEQ ID NO:

5.

4. The genetically engineered strain of Schizochytrium for efficiently producing DHA according to claim 1, characterized in that The genetically engineered strain is obtained by knocking out the peroxisomal matrix protein gene PEX10 in the wild type of Schizochytrium and then overexpressing the diacylglycerol acyltransferase gene DGAT, and the nucleotide sequence of the diacylglycerol acyltransferase gene DGAT is SEQ ID NO:

6.

5. The genetically engineered strain of Schizochytrium for efficiently producing DHA according to claim 1, characterized in that The genetically engineered strain is obtained by knocking out the peroxisomal matrix protein gene PEX10 in the wild type of Schizochytrium and then overexpressing the acetyl-CoA carboxylase gene ACC1 and the diacylglycerol acyltransferase gene DGAT.

6. The method for constructing an engineered strain of Schizochytrium according to claim 1, characterized in that: The steps include: The endogenous tRNA promoter sequence was obtained by PCR amplification using the DNA genome of Schizochytrium as a template and the primer pair tRNA-F / R; Using the gRNA scaffold fragment shown in SEQ ID No: 3 as a template and the primer pair PEX10-N20-1F / 1R as primers, the sgRNA PEX10 sequence was obtained by PCR amplification; The endogenous tRNA promoter sequence was fused with the sgRNA PEX10 sequence, and the fused fragment was inserted into the BcuI site of the backbone vector pCB322 by homologous recombinase to obtain the PEX10 gene editing expression vector; The PEX10 gene editing expression vector was transferred into Schizochytrium through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ΔPEX10 transformants.

7. The method for constructing an engineered strain of Schizochytrium according to claim 3, characterized in that: The steps include: The endogenous tRNA promoter sequence was obtained by PCR amplification using the DNA genome of Schizochytrium as a template and the primer pair tRNA-F / R; Using the gRNA scaffold fragment shown in SEQ ID No: 3 as a template and the primer pair PEX10-N20-1F / 1R as primers, the sgRNA PEX10 sequence was obtained by PCR amplification; The endogenous tRNA promoter sequence was fused with the sgRNA PEX10 sequence, and the fused fragment was inserted into the BcuI site of the backbone vector pCB322 by homologous recombinase to obtain the PEX10 gene editing expression vector; The PEX10 gene editing expression vector was transferred into Schizochytrium through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ΔPEX10 transformants; The plasmid pC322-GFP is used as a backbone, and the C16 elongase gene E16 is inserted into the backbone to obtain the pCA322-E16 expression vector, and the nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 4; Inserting acetyl-CoA carboxylase gene ACC1 into pCA322-E16 expression vector to obtain recombinant vector pCA322-ACC1; The recombinant vector pCA322-ACC1 was transferred into Schizochytrium SR21-ΔPEX10 transformants through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ACC1 transformants.

8. The method for constructing an engineered strain of Schizochytrium according to claim 4, characterized in that: The steps include: The endogenous tRNA promoter sequence was obtained by PCR amplification using the DNA genome of Schizochytrium as a template and the primer pair tRNA-F / R; Using the gRNA scaffold fragment shown in SEQ ID No: 3 as a template and the primer pair PEX10-N20-1F / 1R as primers, the sgRNA PEX10 sequence was obtained by PCR amplification; The endogenous tRNA promoter sequence was fused with the sgRNA PEX10 sequence, and the fused fragment was inserted into the BcuI site of the backbone vector pCB322 by homologous recombinase to obtain the PEX10 gene editing expression vector; The PEX10 gene editing expression vector was transferred into Schizochytrium through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ΔPEX10 transformants; The plasmid pC322-GFP is used as a backbone, and the C16 elongase gene E16 is inserted into the backbone to obtain the pCA322-E16 expression vector, and the nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 4; Inserting diacylglycerol acyltransferase gene DGAT into pCA322-E16 expression vector to obtain recombinant vector pCA322-DGAT; The recombinant vector pCA322-DGAT was transferred into Schizochytrium SR21-ΔPEX10 transformants through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-DGAT transformants.

9. The method for constructing an engineered strain of Schizochytrium according to claim 5, characterized in that: The steps include: The endogenous tRNA promoter sequence was obtained by PCR amplification using the wild-type DNA genome of Schizochytrium as a template and the primer pair tRNA-F / R; Using the gRNA scaffold fragment shown in SEQ ID No: 3 as a template and the primer pair PEX10-N20-1F / 1R as primers, the sgRNA PEX10 sequence was obtained by PCR amplification; The endogenous tRNA promoter sequence was fused with the sgRNA PEX10 sequence, and the fused fragment was inserted into the BcuI site of the backbone vector pCB322 by homologous recombinase to obtain the PEX10 gene editing expression vector; The PEX10 gene editing expression vector was transferred into Schizochytrium through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ΔPEX10 transformants; The plasmid pC322-GFP is used as a backbone, and the C16 elongase gene E16 is inserted into the backbone to obtain the pCA322-E16 expression vector, and the nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 4; Inserting acetyl-CoA carboxylase gene ACC1 into pCA322-E16 expression vector to obtain recombinant vector pCA322-ACC1; Inserting diacylglycerol acyltransferase gene DGAT into the recombinant vector pCA322-ACC1 to obtain the recombinant vector pCA322-ACC1-DGAT; The recombinant vector pCA322-ACC1-DGAT was transferred into Schizochytrium SR21-ΔPEX10 transformants through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ΔPEX10-ACC1-DGAT transformants.

10. The method for producing DHA by fermentation of a genetically engineered Schizochytrium strain according to any one of claims 1 to 5, characterized in that: The following steps are involved: The engineered strain of Schizochytrium was spread on a solid plate medium and cultured at a temperature of 20-30°C for 12-96 h; Select a single colony and inoculate it into the secondary seed liquid culture medium, and culture it at 20-30°C and 160-220 rpm on a shaker for 12-96 h to obtain a liquid seed solution; Inoculate the liquid seed solution into the fermentation medium at a ratio of 1% to 10%, culture at a temperature of 20 to 30°C and at a shaking speed of 160 to 220 rpm for 12 to 120 hours, and collect the bacteria after the culture is completed; The composition of the solid plate medium is as follows: 30 g / L glucose, 8 g / L yeast powder, 20 g / L sea crystal, 20 g / L agar powder, and the pH is adjusted to 6.5; The composition of the secondary seed liquid medium is: glucose 30 g / L, yeast powder 8 g / L, sea crystal 20 g / L, pH adjusted to 6.5; The composition of the fermentation medium was: glucose 80 g / L, yeast powder 5 g / L, NaCl 0.3 g / L, K2SO4 1 g / L, KH2PO4 0.1 g / L, MgSO4·7H2O 4 g / L, CaCl2 0.05 g / L, and the pH was adjusted to 6.5.

Images