Mesenchymal stem cell for overexpressing HDAC9 as well as preparation method and application of mesenchymal stem cell

Abstract

The invention relates to a mesenchymal stem cell for overexpressing HDAC9 as well as a preparation method and application thereof, and belongs to the technical field of stem cell treatment. The mesenchymal stem cell for overexpressing the HDAC9 disclosed by the invention comprises a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 and a dCas9-target plasmid. The HDAC9 gene modified MSCs are constructed for the first time, the inhibition effect of the HDAC9 gene modified MSCs on immune inflammation is improved, and therefore the treatment effect of the HDAC9 gene modified MSCs on the immune inflammation is promoted.

Description

Technical Field

[0001] The present invention relates to the technical field of stem cell therapy, and in particular to a mesenchymal stem cell overexpressing HDAC9 and a preparation method and application thereof. Background Art

[0002] Super enhancers (SE) are composed of high-density clusters of typical enhancers. Super enhancers can activate the expression of identity-determining genes in stem cells, thereby playing an important role in regulating cell fate. They play an important role in maintaining cell identity. Studies have shown that SEs play an important role in the differentiation of stem cells. In addition, some scholars have found that SE plays an important role in the occurrence and development of various inflammatory diseases such as asthma, atherosclerosis, and alcoholic hepatitis.

[0003] Mesenchymal stem cells (MSCs) are stem cells with multidirectional differentiation potential in the human body. They also have strong immunoregulatory ability and play a key role in maintaining the balance of the body's immune environment and promoting damage repair. Abnormal immunoregulation of MSCs themselves is also an important cause of a series of systemic inflammatory diseases. Based on the characteristics of MSCs that inhibit the differentiation of inflammatory cells both in vivo and in vitro, clinical studies have used MSCs infusion to treat patients with refractory rheumatoid arthritis who have poor drug response, reducing joint inflammation and promoting cartilage repair.

[0004] At present, the efficacy of existing MSCs infusion in the treatment of rheumatoid arthritis is poor due to individual differences in patients. Gene editing technology that modifies single or several gene sites has been used to improve the therapeutic effect of MSCs, but the activation of MSCs' immune regulation function is affected by multiple factors, and the therapeutic effect is often unsatisfactory. Therefore, there is an urgent need to develop effective treatment methods. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a mesenchymal stem cell overexpressing HDAC9 for treating immune inflammation and a preparation method and application thereof.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] In a first aspect, the present invention provides a mesenchymal stem cell overexpressing HDAC9, comprising a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 and a dCas9-target plasmid.

[0008] Because super enhancer can promote the expression of its downstream proinflammatory gene, the present invention suppresses the expression of proinflammatory gene by suppressing the activation of super enhancer, and realizes the effect of improving mesenchymal stem cell treatment immune inflammation.Super enhancer can be identified by histone H3 lysine 27 acetylation (H3K27ac), and the level of H3K27ac is subject to the dual regulation of histone acetyl transferase and histone deacetylase (HDA Cs), the former mediates the transfer of acetyl group to histone residue process, and the latter is responsible for removing the acetylation modification on histone, and the two realize the dynamic balance of H3K27ac under stable conditions, so as to regulate the activation of super enhancer.Therefore, the present invention reduces H3K27ac level by overexpressing histone deacetylase (HDAC9), suppresses the activation of super enhancer, and then the expression of its downstream proinflammatory gene, so as to realize the effect of treating immune inflammation.Mesenchymal stem cells modified by overexpressing HDAC9 can improve its inhibitory effect on immune inflammation, so as to promote its therapeutic effect in immune inflammation.

[0009] The present invention uses improved CRISPRa / dCas9 technology to artificially mutate the two domains of Cas9, RuvC and HNH, to make it lose the activity of nuclease endonuclease, and then designs HDAC9-specific gRNA to specifically guide the dCas9 fused with transcription factors VP64, p65 activation domain and Rta to the transcription start site (TSS) of HDAC9, promote the transcription of HDAC9 in MSCs through the activation of transcription factors, successfully construct MSCs that stably overexpress HDAC9, and verify through experiments that the MSCs can effectively treat rheumatoid arthritis.

[0010] As a preferred embodiment of the first aspect, the mesenchymal stem cells are selected from one of mesenchymal stem cells derived from bone marrow, fat, umbilical cord, induced pluripotent stem cells, and embryonic stem cells.

[0011] In a second aspect, the present invention provides use of the mesenchymal stem cells described in the first aspect in the preparation of a drug or preparation for treating immune inflammation.

[0012] As a preferred embodiment of the second aspect, the immune inflammation is rheumatoid arthritis.

[0013] As a preferred embodiment of the second aspect, a specific sgRNA is designed according to the TSS site of HDAC9, and dCas9 fused with transcription factors VP64, p65 activation domain and Rta is specifically guided to the TSS site of HDAC9 through sgRNA, and the transcription of HDAC9 in mesenchymal stem cells is promoted through the activation of transcription factors, thereby constructing mesenchymal stem cells overexpressing HDAC9.

[0014] As a preferred embodiment of the second aspect, the sequence of the specific sgRNA designed according to the TSS site sequence of HDAC9 is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0015] As a preferred embodiment of the second aspect, the dCas9 fused with the transcription factor VP64, p65 activation domain and Rta is the plasmid dSp-VP64-p65-RTA.

[0016] In a third aspect, the present invention provides a method for constructing the mesenchymal stem cells described in the first aspect, characterized in that it comprises the following steps:

[0017] S1. Designing a specific sgRNA according to the TSS site of HDAC9, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1 or SEQ ID NO: 2;

[0018] S2, mixing the sgRNA-dCas9 ligated plasmid with opti-MEM medium to obtain a premix 1;

[0019] S3, mixing the auxiliary transfection reagent with the opti-MEM culture medium to obtain a premix 2;

[0020] S4. Premix 1 and premix 2 are mixed and added to the cell culture medium. After incubation at room temperature, the culture medium is added to the well plate for culturing mesenchymal stem cells. Puromycin is then added to the culture medium to select surviving mesenchymal stem cells to obtain mesenchymal stem cells that overexpress HDAC9.

[0021] As a preferred embodiment of the third aspect, the method for constructing the sgRNA-dCas9 connection plasmid in step S2 is: connecting the linearized dSp-VP64-p65-RTA plasmid to the double-stranded sgRNA.

[0022] In a fourth aspect, the present invention provides the use of the construction method described in the third aspect in the preparation of drugs or preparations for treating immune inflammation.

[0023] As a preferred embodiment of the fourth aspect, the immune inflammation is rheumatoid arthritis.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] (1) Compared with the existing gene modification MSCs method, the present invention uses the super enhancer that regulates gene expression as a target to inhibit the expression of the super enhancer. Therefore, the downstream pro-inflammatory genes of the super enhancer inhibited by the present invention are more extensive, the improvement effect is stronger, and the effect of MSCs infusion in treating rheumatoid arthritis is improved. The present invention is aimed at regulating the upstream single target HDAC9 of the super enhancer, which is less likely to have off-target effects than the multi-gene target modification technology, and at the same time improves the effectiveness and safety.

[0026] (2) In the prior art, gene editing technology for MSCs mostly uses viral transfection, which has certain biological risks. The present invention uses CRISPR / dCas9 technology to overexpress and modify MSCs. The vector is a plasmid and does not have the ability to replicate autonomously. It is safer than the viral transfection system. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The experimental flow chart for the construction and effect verification of HDAC9 overexpressing MSCs;

[0028] Figure 2 Schematic diagram of Western blot results of HDAC9 overexpressing MSCs;

[0029] Figure 3 Schematic diagram of the experimental results of the PBMC proliferation ratio after co-culture of HDAC9-overexpressing MSCs with MSCs transfected with blank plasmids (Figure A: PBMC proliferation ratio after co-culture with MSCs transfected with blank plasmids; Figure B: PBMC proliferation ratio after co-culture with MSCs overexpressing HDAC9);

[0030] Figure 4 This is a schematic diagram of the arthritis scoring results;

[0031] Figure 5 This is a photo of mouse joint swelling;

[0032] Figure 6 Schematic diagram of the plasmid map of plasmid dSp-VP64-p65-RTA. DETAILED DESCRIPTION

[0033] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0034] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0035] Example 1 Construction of MSCs stably overexpressing the HDAC9 gene

[0036] according to Figure 1 The experimental process shown here is to construct MSCs that stably overexpress HDAC9 and verify its application effect, as follows:

[0037] 1. Design sgRNA:

[0038] The sgRNA design website (https: / / www.synthego.com / products / bioinformatics / crispr-design-tool) was used to design sgRNA for the TSS site of HDAC9 to guide Cas9 to bind to its transcription start region. The specificity of sgRNA was verified by the BLAT tool in the USUC website, and the sequences 1 and 2 with the highest scores were selected (sequence 1: UGUGAAGUCAGAAGUUCCUG, SEQ ID NO: 1; sequence 2: GUGAAGUCAGAAGUUCCUGU, SEQ ID NO: 2).

[0039] 2. Construction of sgRNA-Cas9 plasmid

[0040] 1) First, add sgRNA and its complementary strand into the PCR tube according to the system, shake and mix, put it into the PCR instrument and react at 37℃ for 30min, 95℃ for 5min, and then step-down to 25℃. This step prepares double-stranded sgRNA;

[0041] 2) The existing finished tool plasmid dSp-VP64-p65-RTA (addgene, #99670) was subjected to restriction enzyme digestion to prepare a linearized plasmid. Subsequently, the synthesized double-stranded sgRNA and linearized plasmid were supplemented to 10ul according to 50ng vector, 1ul sgRNA, 1ul 10×T4 Ligation Buffer, and ddH2O, mixed evenly, and incubated at room temperature for 10min. The final product of this step was the sgRNA-dCas9 ligated plasmid. After plasmid amplification, Sanger sequencing was used to determine whether the sgRNA was successfully connected to the plasmid.

[0042] 2. Transfection and screening

[0043] 1) Premix 1: Mix 5 μg of the successfully constructed sgRNA-dCas9 plasmid with opti-MEM (ThermoFisher, 31985070) culture medium to a total volume of 150 μl;

[0044] 2) Premix 2: Mix auxiliary transfection reagent Lipofectamine 3000 (ThermalFish, L3000-015) and opti-MEM to 150 μl;

[0045] 3) Transfection: Mix premix 1 and premix 2, incubate at room temperature for 15 minutes, aspirate the original culture medium in the well plate, add the premix to DMEM complete culture medium, and then add 1×10 5 MSCs / well in a six-well plate and cultured for 48 h;

[0046] 4) Screening: Puromycin (1 μg / ml) is added to the culture medium to screen cells through the puromycin resistance gene carried by the plasmid. The surviving MSCs are the MSCs with normal overexpression after plasmid transfer.

[0047] 5) Verification: MSCs were selected after puromycin screening, and the overexpression efficiency of HDAC9 was verified by Western blot (e.g. Figure 2 used in subsequent experiments.

[0048] It should be noted that the mesenchymal stem cells in this embodiment can be any one of bone marrow-derived mesenchymal stem cells, adipose-derived mesenchymal stem cells, umbilical cord-derived mesenchymal stem cells, induced pluripotent stem cells, and embryonic stem cells.

[0049] Example 2 Functional Verification

[0050] 1. Evaluation of the immunomodulatory capacity of HDAC9-overexpressing MSCs by in vitro co-culture experiments:

[0051] Pre- 5 The density of cells / well was set, and MSCs were inoculated on a 24-well plate. The control group was set as MSCs transfected with a blank vector plasmid, and the experimental group was MSCs overexpressing HDAC9 successfully constructed in Example 1; PBMCs (peripheral blood mononuclear cells) were separated from peripheral blood donated by healthy volunteers by density gradient method, and CFSE (carboxyfluorescein diacetate succinimidyl ester) staining was performed for subsequent detection of cell proliferation, and after counting, MSCs:PBMCs were added to the plate seeded with MSCs at a ratio of 1:10, and CD3 antibodies (1μg / ml), CD28 (1μg / ml), and IL-2 (10μg / ml) were added to stimulate PB MC proliferation. The MSC-PBMC co-culture plate was transferred to a cell culture incubator, taken out after 5 days, the supernatant (containing suspended PBMCs) was aspirated, and the intensity of the FITC fluorescence channel was detected by flow cytometry after centrifugation and washing, and the difference in the inhibitory ability of MSCs on PBMC proliferation before and after overexpression of HDAC9 was compared.

[0052] Figure 3Flow cytometry was used to detect the CFSE signal intensity in PBMCs. The signal intensity of proliferating PBMCs was weaker than the initial peak. Based on this principle, it was found that the proliferation of PBMCs co-cultured with MSCs overexpressing HDAC5 (B) was significantly weakened compared with the control group (A), indicating that overexpression of HDAC5 can enhance the inhibition of MSCs on the proliferation of PBMCs.

[0053] 2. Evaluation of the ability of HDAC9-overexpressing MSCs to inhibit inflammation in vivo using the SKG mouse model:

[0054] SKG mice are BALB / c mice with the W163C mutation of the Zap70 gene. After being induced by β-glucan (Curdlan), they show autoimmune arthritis and can be used as an animal model for studying rheumatoid arthritis. Four groups of mice were set up, namely the normal control group (no intervention), the induced control group (Curdlan injection), the MSC treatment group (vector-MSC group, MSC transfected with blank vector was infused after Curdlan injection), and the HDAC9 overexpression MSC treatment group (OE-HDAC9-MSC group, HDAC9 overexpression MSC was infused after Curdlan injection). After the induction was completed, the mice were observed once a week and the arthritis score was performed (the higher the score, the more severe the arthritis) until 8 weeks. The ankle joints were sliced ​​and HE stained to evaluate the degree of inflammatory infiltration and compare the disease progression between different groups.

[0055] The results are as follows Figure 4 As shown in Figure 3, the arthritis score of the OE-HDAC9-MSC group was significantly lower than that of the induced control group and the vector-MSC group. Figure 5 As shown, there was no swelling in the joints of mice in the OE-HDAC9-MSC group, indicating that HDAC9 overexpression MSCs can effectively treat rheumatoid arthritis

[0056] The present invention modifies MSCs by overexpressing histone deacetylase HDAC9, thereby inhibiting the formation of super enhancers and widely inhibiting the expression of pro-inflammatory genes in mesenchymal stem cells (MSCs), thereby enhancing the inhibitory effect of MSCs on immune inflammation and improving the effect of MSCs in treating rheumatoid arthritis.

[0057] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A mesenchymal stem cell overexpressing HDAC9, characterized in that: It includes a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 and a dCas9-target plasmid.

2. The mesenchymal stem cell according to claim 1, wherein The mesenchymal stem cells are selected from mesenchymal stem cells derived from bone marrow, fat, umbilical cord, induced pluripotent stem cells, and embryonic stem cells.

3. Use of the mesenchymal stem cells as claimed in claim 1 or 2 in the preparation of drugs or preparations for treating immune inflammation.

4. The use according to claim 3, characterized in that The immune inflammation is rheumatoid arthritis.

5. The use according to claim 4, characterized in that A specific sgRNA was designed according to the TSS site of HDAC9. Through the sgRNA, dCas9 fused with transcription factors VP64, p65 activation domain and Rta was specifically guided to the TSS site of HDAC9. The transcription of HDA C9 in mesenchymal stem cells was promoted through the activation of transcription factors, and mesenchymal stem cells overexpressing HDAC9 were constructed.

6. The use according to claim 5, characterized in that The sequence of the specific sgRNA designed according to the TSS site sequence of HDAC9 is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

7. The use according to claim 5, characterized in that The dCas9 fused with transcription factor VP64, p65 activation domain and Rta is the plasmid dSp-VP64-p65-RTA.

8. A method for constructing the mesenchymal stem cells according to claim 1 or 2, characterized in that: The steps include: S1. Designing a specific sgRNA according to the TSS site of HDAC9, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1 or SEQ ID NO: 2; S2, mixing the sgRNA-dCas9 ligated plasmid with opti-MEM medium to obtain a premix 1; S3, mixing the auxiliary transfection reagent with the opti-MEM culture medium to obtain a premix 2; S4. Premix 1 and premix 2 are mixed and added to the cell culture medium. After incubation at room temperature, the culture medium is added to the well plate for culturing mesenchymal stem cells. Puromycin is then added to the culture medium to select surviving mesenchymal stem cells to obtain mesenchymal stem cells that overexpress HDAC9.

9. The method according to claim 8, characterized in that The method for constructing the sgRNA-dCas9 connection plasmid in step S2 is: connecting the linearized dSp-VP64-p65-RTA plasmid with the double-stranded sgRNA.

10. Use of the construction method according to any one of claims 7 to 9 in the preparation of drugs or preparations for treating immune inflammation.

Images