Mesenchymal stem cells overexpressing hdac9 and preparation method and application thereof
By overexpressing HDAC9 in mesenchymal stem cells using CRISPR/dCas9 technology and inhibiting super-enhancer activation, the problem of poor efficacy of MSCs in treating rheumatoid arthritis has been solved, achieving stronger immunomodulatory effects and better safety.
Patent Information
- Application Number
- CN202510071137.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-16
- Publication Date
- 2026-02-17
- Estimated Expiration
- 2045-01-16
AI Technical Summary
The efficacy of current MSC infusion therapy for rheumatoid arthritis is poor due to individual patient differences and limitations of gene editing technology. Existing technologies are unable to effectively activate the immunomodulatory function of MSCs.
By overexpressing HDAC9 using CRISPR/dCas9 technology and utilizing dCas9 to specifically target the transcription start site of HDAC9, the activation of super enhancers is inhibited, thereby suppressing the expression of pro-inflammatory genes. This allows for the construction of mesenchymal stem cells that stably overexpress HDAC9 and enhance their immunomodulatory capabilities.
It significantly enhanced the inhibitory effect of MSCs on immune inflammation, improved the efficacy of treating rheumatoid arthritis, and made the use of vector plasmids safer, avoiding the biological risks of viral transfection.
Smart Images

Figure CN119931953B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of stem cell therapy technology, and in particular to a mesenchymal stem cell overexpressing HDAC9, its preparation method, and its application. Background Technology
[0002] Super enhancers (SEs) are composed of high-density clusters of typical enhancers. Super enhancers can activate the expression of identity-determining genes in stem cells, thus playing a crucial role in regulating cell fate. They are important in maintaining cell identity recognition, and studies have shown that SEs play a significant role in stem cell differentiation. Furthermore, researchers have found that SEs play an important role in the development and progression of various inflammatory diseases such as asthma, atherosclerosis, and alcoholic hepatitis.
[0003] Mesenchymal stem cells (MSCs) are multipotent stem cells in the human body with strong immunomodulatory capabilities. They play a crucial role in maintaining the body's immune balance and promoting damage repair. Abnormal immunomodulation of MSCs is also a significant cause of a range of systemic inflammatory diseases. Based on the ability of MSCs to inhibit the differentiation of inflammatory cells both in vitro and in vivo, clinical studies have used MSC infusion to treat patients with refractory rheumatoid arthritis who do not respond well to medication, reducing joint inflammation and promoting cartilage repair.
[0004] Currently, the efficacy of existing MSC infusion therapy for rheumatoid arthritis is unsatisfactory due to individual patient differences and other factors. Gene editing technologies targeting single or multiple gene loci have limited effectiveness in improving MSC treatment, and the activation of MSC immune regulatory function is influenced by multiple factors, often resulting in unsatisfactory treatment outcomes. Therefore, there is an urgent need to develop effective treatment methods. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a mesenchymal stem cell that overexpresses HDAC9 and has therapeutic effects on immune inflammation, as well as its preparation method and application.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0007] In a first aspect, the present invention provides a mesenchymal stem cell overexpressing HDAC9, comprising a nucleotide sequence as shown in SE Q ID NO:1 or SEQ ID NO:2 and a dCas9-target plasmid.
[0008] Since super-enhancers can promote the expression of their downstream pro-inflammatory genes, this invention inhibits the activation of super-enhancers, thereby suppressing the expression of pro-inflammatory genes and enhancing the therapeutic effect of mesenchymal stem cells on immune inflammation. Super-enhancers can be identified by acetylation at lysine 27 of histone H3 (H3K27ac). The level of H3K27ac is dually regulated by histone acetyltransferases and histone deacetylases (HDA Cs). The former mediates the transfer of acetyl groups to histone residues, while the latter is responsible for removing acetylation modifications from histones. Under stable conditions, these two enzymes maintain a dynamic equilibrium of H3K27ac, thus regulating the activation of super-enhancers. Therefore, this invention reduces H3K27ac levels by overexpressing histone deacetylase (HDAC9), inhibiting the activation of super-enhancers and subsequently suppressing the expression of their downstream pro-inflammatory genes, thereby achieving a therapeutic effect on immune inflammation. Mesenchymal stem cells modified with HDAC9 overexpression exhibit enhanced inhibitory effects on immune inflammation, thus promoting their therapeutic efficacy in treating immune inflammation.
[0009] This invention utilizes a modified CRISPRa / dCas9 technology. By artificially mutating the two domains RuvC and HNH of Cas9, it loses the activity of the endonuclease. Then, by designing HDAC9-specific gRNA, dCas9 fused with transcription factors VP64, p65 activation domains and Rta is specifically directed to the transcription start site (TSS) of HDAC9. Through the activation of transcription factors, the transcription of HDAC9 in MSCs is promoted, and MSCs that stably overexpress HDAC9 are successfully constructed. Experiments have verified that these MSCs can effectively treat rheumatoid arthritis.
[0010] In a preferred embodiment of the first aspect, the mesenchymal stem cells are selected from one of the following: bone marrow, adipose tissue, umbilical cord, induced pluripotent stem cells, and embryonic stem cells.
[0011] In a second aspect, the present invention provides the use of the mesenchymal stem cells described in the first aspect in the preparation of drugs or preparations for treating immune inflammation.
[0012] In a preferred embodiment of the second aspect, the immune inflammation is rheumatoid arthritis.
[0013] As a preferred embodiment of the second aspect, a specific sgRNA is designed based on the TSS site of HDAC9. The dCas9, which is fused with the transcription factors VP64, p65 activation domain and Rta, is specifically directed to the TSS site of HDAC9 via the sgRNA. The transcription factor activation promotes the transcription of HDAC9 in mesenchymal stem cells, thereby constructing mesenchymal stem cells that overexpress HDAC9.
[0014] As a preferred embodiment of the second aspect, the sequence of the specific sgRNA designed based on the TSS site sequence of HDAC9 is shown in SEQ ID NO:1 or SEQ ID NO:2.
[0015] As a preferred embodiment of the second aspect, the dCas9 fused with transcription factors VP64, p65 activation domains and Rta is the plasmid dSp-VP64-p65-RTA.
[0016] Thirdly, the present invention provides a method for constructing the mesenchymal stem cells described in the first aspect, characterized by comprising the following steps:
[0017] S1. Design a specific sgRNA based on the TSS site of HDAC9, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO:1 or SEQ ID NO:2;
[0018] S2. Mix the sgRNA-dCas9 ligation plasmid with opti-MEM medium to obtain premix 1;
[0019] S3. Mix the auxiliary transfection reagent with Opti-MEM medium to obtain premix solution 2;
[0020] S4. After mixing premix 1 and premix 2, add them to the cell culture medium. After incubation at room temperature, add the culture medium to the well plate for culturing mesenchymal stem cells. Then add puromycin to the culture medium to screen for surviving mesenchymal stem cells to obtain mesenchymal stem cells overexpressing HDAC9.
[0021] As a preferred embodiment of the third aspect, the method for constructing the sgRNA-dCas9 ligation plasmid in step S2 is as follows: ligating the linearized dSp-VP64-p65-RTA plasmid with double-stranded sgRNA.
[0022] Fourthly, the present invention provides the application of the construction method described in the third aspect in the preparation of drugs or preparations for treating immune inflammation.
[0023] In a preferred embodiment of the fourth aspect, the immune inflammation is rheumatoid arthritis.
[0024] Compared with the prior art, the beneficial effects of the present invention are:
[0025] (1) Compared with existing gene-modified MSCs methods, this invention targets super-enhancers that regulate gene expression, inhibiting their expression. Therefore, this invention inhibits a wider range of downstream pro-inflammatory genes of the super-enhancers, resulting in a stronger improvement effect and enhancing the efficacy of MSCs infusion therapy for rheumatoid arthritis. This invention targets a single upstream target, HDAC9, which regulates the super-enhancers, making it less prone to off-target effects compared to multi-gene target modification techniques, while also improving efficacy and safety.
[0026] (2) In the prior art, gene editing technology for MSCs mostly uses viral transfection, which poses certain biological risks. In this invention, CRISPR / dCas9 technology is used to overexpress and modify MSCs. The vector is a plasmid, which does not have autonomous replication ability, and is safer than the viral transfection system. Attached Figure Description
[0027] Figure 1 The experimental flowchart for the construction and efficacy validation of HDAC9-overexpressing MSCs;
[0028] Figure 2 A schematic diagram of the Western blot results for HDAC9-overexpressing MSCs;
[0029] Figure 3 Figure A shows the experimental results of PBMC proliferation ratio after co-culturing HDAC9 overexpressing MSCs with MSCs transfected with blank plasmids (Figure A: PBMC proliferation ratio after co-culturing with MSCs transfected with blank plasmids; Figure B: PBMC proliferation ratio after co-culturing with HDAC9 overexpressing MSCs).
[0030] Figure 4 A diagram illustrating the results of an arthritis score.
[0031] Figure 5 Photograph of swollen joints in mice;
[0032] Figure 6 This is a schematic diagram of the plasmid dSp-VP64-p65-RTA. Detailed Implementation
[0033] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.
[0034] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.
[0035] Example 1: Construction of MSCs stably overexpressing the HDAC9 gene
[0036] according to Figure 1 The experimental procedure shown is as follows: MSCs stably overexpressing HDAC9 are constructed, and their application effect is verified.
[0037] 1. Design sgRNA:
[0038] sgRNAs targeting the TSS site of HDAC9 were designed using the sgRNA design website (https: / / www.synthego.com / products / bioinformatics / crispr-design-tool) to guide Cas9 binding to its transcription initiation region. The specificity of the sgRNAs was verified using the BLAT tool on the USUC website, and the sequences with the highest scores (Sequence 1: UUGUGAAGUCAGAAGUUCCUG, SEQ ID NO:1; Sequence 2: GUGAAGUCAGAAGUUCCUGU, SEQ ID NO:2) were selected.
[0039] 2. Constructing the sgRNA-Cas9 plasmid
[0040] 1) First, add the sgRNA and its complementary strand to the PCR tube according to the system, vortex to mix, and place it in the PCR instrument to react at 37℃ for 30 min, 95℃ for 5 min, and then gradually cool down to 25℃. This step is used to prepare double-stranded sgRNA.
[0041] 2) Linearize the existing commercially available tool plasmid dSp-VP64-p65-RTA (addgene, #99670) by enzyme digestion. Then, add the synthesized double-stranded sgRNA and linearized plasmid to a final volume of 10 μL, along with 50 ng of vector, 1 μL of sgRNA, 1 μL of 10×T4 Ligation Buffer, and ddH2O. Incubate at room temperature for 10 min. The final product of this step is the sgRNA-dCas9 ligation plasmid. After plasmid amplification, Sanger sequencing is used to determine whether the sgRNA has been successfully ligated into the plasmid.
[0042] 2. Transfection and Screening
[0043] 1) Premix 1: Mix 5 μg of the successfully constructed sgRNA-dCas9 plasmid with opti-MEM (ThermoFisher, 31985070) medium to a total volume of 150 μl;
[0044] 2) Premix 2: Mix the auxiliary transfection reagent Lipofectamine 3000 (Thermal Fish, L3000-015) with opti-MEM to a final volume of 150 μl;
[0045] 3) Transfection: Mix premix 1 and premix 2, incubate at room temperature for 15 minutes, then aspirate the original culture medium from the well plate. Add the premixed mixture to DMEM complete medium, and then add 1×10⁻⁶ cells that were seeded 24 hours ago. 5 In a six-well plate containing MSCs / well, culture for 48 hours;
[0046] 4) Screening: Cells are screened by adding puromycin (1 μg / ml) to the culture medium using the puromycin resistance gene carried by the plasmid. The MSCs that survive are the MSCs that have been transformed into plasmid and are overexpressed normally.
[0047] 5) Validation: MSCs selected after puromycin screening were used to verify the overexpression efficiency of HDAC9 using Western blot (e.g., Figure 2 (As shown) and then used for subsequent experiments.
[0048] It should be noted that the mesenchymal stem cells in this embodiment can be any one of bone marrow-derived mesenchymal stem cells, adipose-derived mesenchymal stem cells, umbilical cord-derived mesenchymal stem cells, induced pluripotent stem cells, or embryonic stem cells.
[0049] Example 2 Functional Verification
[0050] 1. Evaluate the immunomodulatory capacity of HDAC9-overexpressing MSCs through in vitro co-culture experiments:
[0051] Pre-filled with 0.5×10 5 MSCs were seeded into 24-well plates at a density of cells / well. The control group consisted of MSCs transfected with a blank vector plasmid, while the experimental group consisted of MSCs overexpressing HDAC9 successfully constructed in Example 1. PBMCs (peripheral blood mononuclear cells) were isolated from peripheral blood donated by healthy volunteers using a density gradient method and stained with CFSE (carboxyfluorescein diacetate succinimide) for subsequent cell proliferation detection. After counting, MSCs were added to the wells containing MSCs at a ratio of 1:10. CD3 antibody (1 μg / ml), CD28 (1 μg / ml), and IL-2 (10 μg / ml) were added to stimulate PBMC proliferation. The MSC-PBMC co-culture plates were transferred to a cell culture incubator. After 5 days, the plates were removed, and the supernatant (containing suspended PBMCs) was aspirated, centrifuged, washed, and then flow cytometry was performed to detect the intensity of the FITC fluorescence channel. The difference in the inhibitory effect of MSCs on PBMC proliferation before and after HDAC9 overexpression was compared.
[0052] Figure 3Flow cytometry was used to detect the CFSE signal intensity in PBMCs. The signal intensity of proliferating PBMCs was weakened compared with the initial peak. Based on this principle, it was found that the proliferation of PBMCs co-cultured with MSCs overexpressing HDAC5 (B) was significantly weakened compared with the control group (A), suggesting that overexpression of HDAC5 can enhance the inhibition of PBMC proliferation by MSCs.
[0053] 2. Evaluate the in vivo anti-inflammatory ability of HDAC9-overexpressing MSCs using the SKG mouse model:
[0054] SKG mice, BALB / c background mice carrying the Zap70 gene W163C mutation, exhibit autoimmune arthritis after β-glucan (Curdlan) induction, serving as an animal model for studying rheumatoid arthritis. Four groups of mice were established: a normal control group (no intervention), an induction control group (Curdlan injection), an MSC treatment group (vector-MSC group, Curdlan injection followed by infusion of MSCs transfected with a blank vector), and an HDAC9 overexpression MSC treatment group (OE-HDAC9-MSC group, Curdlan injection followed by infusion of HDAC9 overexpression MSCs). Mice were observed weekly after induction, and arthritis scores were calculated (higher scores indicate more severe arthritis) for up to 8 weeks. Ankle sections were collected for HE staining to assess the degree of inflammatory infiltration and compare disease progression among different groups.
[0055] The results are as follows Figure 4 As shown, the arthritis score in the OE-HDAC9-MSC group was significantly lower than that in the induction control group and the vector-MSC group, as... Figure 5 As shown, no joint swelling was observed in the OE-HDAC9-MSC group mice, indicating that HDAC9 overexpression of MSCs can effectively treat rheumatoid arthritis.
[0056] This invention modifies MSCs by overexpressing histone deacetylase HDAC9, thereby inhibiting the formation of super enhancers and broadly suppressing the expression of pro-inflammatory genes in mesenchymal stem cells (MSCs), thus enhancing the inhibitory effect of MSCs on immune inflammation and improving the efficacy of MSCs in the treatment of rheumatoid arthritis.
[0057] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. The application of HDAC9-overexpressing mesenchymal stem cells in the preparation of a drug for treating rheumatoid arthritis, characterized in that, The method for constructing HDAC9-overexpressing mesenchymal stem cells includes the following steps: S1. Design a specific sgRNA based on the TSS site of HDAC9, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO:1 or SEQ ID NO:2; S2. Mix the sgRNA-dCas9 ligation plasmid with opti-MEM medium to obtain premix 1; S3. Mix the auxiliary transfection reagent with Opti-MEM medium to obtain premix solution 2; S4. After mixing premix 1 and premix 2, add them to the cell culture medium. After incubating at room temperature, add the culture medium to the well plate for culturing mesenchymal stem cells. Then add puromycin to the culture medium to screen for surviving mesenchymal stem cells and obtain mesenchymal stem cells overexpressing HDAC9. In step S1, a specific sgRNA is designed based on the TSS site of HDAC9. This sgRNA specifically directs a dCas9 fused with transcription factors VP64, p65 activation domains, and Rta to the TSS site of HDAC9, thereby promoting HDAC9 transcription in mesenchymal stem cells through the activation of transcription factors. The dCas9 fused with transcription factors VP64, p65 activation domains, and Rta is the plasmid dSp-VP64-p65-RTA. The method for constructing the sgRNA-dCas9 ligation plasmid in step S2 is as follows: the linearized dSp-VP64-p65-RTA plasmid is ligated with double-stranded sgRNA; The mesenchymal stem cells are selected from any one of bone marrow, adipose tissue, or umbilical cord-derived mesenchymal stem cells.
2. The application as described in claim 1, characterized in that, The auxiliary transfection reagent in step S2 is Lipofectamine 3000; the incubation time at room temperature in step S4 is 15 minutes; and the culture time in step S4 after adding the culture medium to the well plate of mesenchymal stem cells is 48 hours, after which puromycin is added to the culture medium.
Citation Information
Patent Citations
Construction of ELMO2 overexpression mesenchymal stem cells (MSCs) and application of ELMO2 overexpression MSCs in fracture treatment
CN113215105A
Production of therapeutics potential mesenchymal stem cells
US20200392454A1