Glycosyl transferase UGT76G1 mutant and method for catalytically synthesizing rebaudioside A by using glycosyl transferase UGT76G1 mutant

Abstract

The invention discloses a glycosyl transferase UGT76G1 mutant and a method for catalytically synthesizing rebaudioside A by using the glycosyl transferase UGT76G1 mutant, and belongs to the technical field of biological catalytic synthesis. The glycosyl transferase UGT76G1 mutant is any one of the following (A)-(C): (A) a protein obtained by performing any one or more of the following mutations on the basis of an amino acid sequence as shown in SEQ ID NO.1: the 109th amino acid is mutated into Q from L; the 113th amino acid is mutated from S to C; the 424th amino acid is mutated from I to F; (B) protein which has more than 95% of identity with the amino acid sequence limited by (A) and has the same function with the amino acid sequence limited by (A); and (C) a fusion protein obtained by connecting a tag to the terminal of the protein defined in (A) or (B). The glycosyl transferase UGT76G1 mutant disclosed by the invention is high in enzyme activity, and rebaudioside A can be efficiently synthesized by taking stevioside STV as a substrate.

Description

Technical Field

[0001] The invention relates to the technical field of biocatalytic synthesis, and in particular to a glycosyltransferase UGT76G1 mutant and a method for catalyzing the synthesis of rebaudioside A by the mutant. Background Art

[0002] Rebaudioside A is a natural sweetener extracted from the leaves of the stevia plant. It contains no calories, does not participate in the metabolism of human blood sugar, and is friendly to diabetics. Many international food safety agencies have approved its use as a food additive and believe that it is safe within the prescribed range of use. Compared with other steviol glycosides in stevia extracts, rebaudioside A is known for its taste that is closer to sucrose. It has no obvious bitter or metallic taste, and its taste is purer and sweeter. It is also stable at high temperatures and is suitable for the formulation of heat-processed foods and beverages. It will not undergo significant sweetness changes or degradation due to heating.

[0003] Rebaudioside A is very sweet, generally considered to be 200 to 450 times sweeter than sucrose. Due to its extremely high sweetness, only a very small amount is needed to achieve a sweetness effect equivalent to sucrose, thereby significantly reducing the calorie intake of food or beverages. Due to its low-calorie properties, Rebaudioside A is widely used in the development of various low-sugar, sugar-free, and reduced-sugar products, such as beverages, candies, baked goods, condiments, table sugar, etc., to meet consumers' demand for healthy diets.

[0004] Typically, rebaudioside A is extracted from stevia leaves using separation and purification technology, but the yield of rebaudioside A obtained by this method is relatively low and cannot meet the high demand of the market. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a glycosyltransferase UGT76G1 mutant and a method for catalyzing the synthesis of rebaudioside A, so as to overcome the problem of low rebaudioside A yield in the prior art.

[0006] In a first aspect, the present invention provides a glycosyltransferase UGT76G1 mutant, wherein the UGT76G1 mutant is any one of the following (A)-(C):

[0007] (A) A protein obtained by causing any one or more of the following mutations based on the amino acid sequence shown in SEQ ID NO.1:

[0008] The amino acid at position 109 mutated from L to Q;

[0009] The amino acid at position 113 mutated from S to C;

[0010] The 424th amino acid mutated from I to F;

[0011] (B) a protein having an amino acid sequence with a sequence identity of more than 95% with that of (A) and having the same function;

[0012] (C) Fusion protein obtained by ligating a tag to the end of the protein defined in (A) or (B).

[0013] Compared with the prior art, the glycosyltransferase UGT76G1 mutant provided by the present invention has higher enzyme activity than the wild-type glycosyltransferase UGT76G1, and can efficiently synthesize rebaudioside A using stevioside STV as a substrate. Among them, the optimal mutant 68S can convert 60mM stevioside STV into 60mM rebaudioside A within 18, that is, all stevioside STV is converted into rebaudioside A, and has excellent application prospects in industrial production.

[0014] Furthermore, the amino acid sequence of the glycosyltransferase UGT76G1 mutant is shown in SEQ ID NO.3.

[0015] In a second aspect, the present invention provides any of the following biomaterials:

[0016] (A) an expressed gene encoding the above-mentioned glycosyltransferase UGT76G1 mutant;

[0017] (B) a recombinant plasmid, the recombinant plasmid being connected to the expression gene described in (A);

[0018] (C) A recombinant cell comprising the recombinant expression plasmid or the expression gene of the UGT76G1 mutant.

[0019] The above-mentioned expressed gene is obtained by one or more of the following mutations in SEQ ID NO.2:

[0020] Positions 325-327 of SEQ ID NO.2 are replaced by CTG to CAG;

[0021] Positions 337-339 of SEQ ID NO.2 are replaced by AGC to TGC;

[0022] Positions 1270-1272 of SEQ ID NO.2 are replaced by ATC to TTG;

[0023] Preferably, the nucleotide sequence of the expressed gene is shown as SEQ ID NO.4.

[0024] In a third aspect, the present invention provides an enzyme composition, comprising: a glycosyltransferase UGT76G1 mutant and a sucrose synthase AtSUS;

[0025] The sucrose synthase AtSUS is as follows (B1) or (B2): the amino acid sequence of (B1) is shown in SEQ ID NO.5;

[0026] (B2) A protein having an amino acid sequence identity of 95% or more to that of (B1) and having the same function.

[0027] In a fourth aspect, the present invention provides a set of recombinant strains expressing the above-mentioned enzyme composition, including recombinant strain A and recombinant strain B: the recombinant strain A contains recombinant plasmid A, which is obtained by constructing the mutant encoding gene of the glycosyltransferase UGT76G1 described in claim 1 or 2 into an expression vector; the recombinant strain B contains recombinant plasmid B, which is obtained by constructing the encoding gene of sucrose synthase AtSUS into a plasmid; the sequence of the encoding gene of sucrose synthase AtSUS is shown in SEQ ID NO.6.

[0028] Furthermore, the host bacteria include but are not limited to Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris or Corynebacterium glutamicum.

[0029] In a fifth aspect, the present invention provides a method for synthesizing rebaudioside A by catalyzing the glycosyltransferase UGT76G1 mutant, comprising the following steps:

[0030] Stevioside STV, UDPG, sucrose and the enzyme composition or the induced expression enzyme product of the complete set of recombinant strains are added into the catalytic reaction system, reacted, inactivated the enzyme, and centrifuged to obtain a supernatant containing rebaudioside A.

[0031] Compared with the prior art, the present invention uses stevioside STV, UDPG and sucrose as reaction substrates, and couples the glycosyltransferase UGT76G1 mutant and sucrose synthase AtSUS to perform a catalytic reaction, which can not only realize the cyclic regeneration of the substrate UDPG and efficiently generate rebaudioside A, but also indirectly measure the activity of the glycosyltransferase based on the quantitative analysis of the product fructose, thereby screening out excellent mutants with high enzyme activity.

[0032] Furthermore, the inducible expression enzyme products of the above-mentioned set of recombinant strains include inducible expression enzyme product A and inducible expression enzyme product B;

[0033] The method for obtaining the induced expression enzyme product A comprises the following steps:

[0034] The seed solution of the recombinant strain A was inoculated into a culture medium containing kanamycin sulfate, and the OD of the culture solution was 600When the pH reaches 0.6-0.8, L-arabinose is added to continue induction culture for 8-40 hours, the bacteria are collected by centrifugation, the cells are broken, centrifuged, and the supernatant is collected as the induced expression enzyme product A; the inoculation amount is 1 v / v%; the final concentration of kanamycin sulfate is 10-100 μg / mL; the final concentration of L-arabinose is 0.1-15 mM;

[0035] The method for obtaining the induced expression enzyme product B comprises the following steps:

[0036] The seed solution of the recombinant strain B was inoculated into a culture medium containing kanamycin sulfate and cultured at 30-40°C and 200-300 r / min until OD 600 When the pH reaches 0.6-0.8, add L-arabinose and continue culturing for 8-40 hours, centrifuge and collect the bacteria, break the cells, centrifuge, and collect the supernatant, which is the induced expression enzyme product B; the inoculation amount is 1v / v%; the final concentration of kanamycin sulfate is 10-100μg / mL; the final concentration of L-arabinose is 0.1-15mM.

[0037] Furthermore, the concentration of stevioside STV in the catalytic reaction system is 10-100 mM, the concentration of UDPG is 0.1-5 mM, the concentration of sucrose is 50-800 mM, the amount of the induced expression enzyme product added by the recombinant strain A is 0.1-50 mL, and the amount of the induced expression enzyme product added by the recombinant strain B is 0.1-50 mL.

[0038] Furthermore, in the above catalytic reaction system, the pH value is 5.0-8.0, the temperature is 25-60° C., and the reaction time is 5-30 hours. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 The yield of rebaudioside A (RA) under the catalysis of different glycosyltransferase UGT76G1 mutants in Example 3.

[0040] Figure 2 The figure shows the changing trend of the yield of rebaudioside A (RA) in Example 4 with the conversion time. DETAILED DESCRIPTION

[0041] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0042] Example 1

[0043] Preparation of recombinant bacteria expressing sucrose synthase AtSUS

[0044] Using Inf-pYB1k-atsus-F and Inf-pYB1k-atsus-R as primers, and the cDNA of sucrose synthase AtSUS from Arabidopsis thaliana as a template, PCR amplification was performed using a high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct atsus gene fragment. The sequence of the coding gene of sucrose synthase AtSUS is shown in SEQ ID NO.6. The amino acid sequence of sucrose synthase AtSUS is shown in SEQ ID NO.5.

[0045] Inf-pYB1k-atsus-F:GCTAACAGGAGGAATTAACCATGGAAAATAAAACG GAGACC(SEQ IDNO.7)

[0046] Inf-pYB1k-atsus-R:CCAGATCTACCCTCGAGTTACAACGATGAAATGTAA GAAAC(SEQ IDNO.8)

[0047] Using pYB1k-F and pYB1k-R as primers, pYB1k empty vector as template, and high-fidelity DNA polymerase (Wuhan Abotek Biotechnology Co., Ltd.) was used for PCR amplification to obtain the correct pYB1k expression vector fragment. (You R, Wang L, Shi C, Chen H, Zhang S, Hu M, Tao Y. Efficient production of myo-inositol in Escherichia coli through metabolic engineering. Microb. Cell Fact. 2020 May 24; 19(1): 109. The pYB1k vector has been published.)

[0048] pYB1k-F:CTCGAGGGTAGATCTGGTAC (SEQ ID NO.9)

[0049] pYB1k-R:GGTTAATTCCTCCTGTTAGC (SEQ ID NO.10)

[0050] The atsus gene fragment and the pYB1k expression vector fragment were connected by the Gibson assembly method.

[0051] The Gibson ligation product was added to E. coli DH5α competent cells (Beijing Quanshijin Biotechnology Co., Ltd.), reacted on ice for 30 minutes, then reacted in a 42°C water bath for 90 seconds, and then placed on ice for 2 minutes. The E. coli was added to 1 mL LB medium, placed in a 37°C shaker for 1 hour, and finally spread on an LB plate containing kanamycin and cultured at 37°C overnight. Multiple single clones were selected for culture, and PCR verification was performed using primers pBAD-F and atsus-F300-R. Positive clones with the correct target sequence size were selected for culture, and plasmids were extracted to obtain positive clone plasmid pYB1k-atsus.

[0052] pBAD-F:GATTATTTGCACGGCGTCAC(SEQ ID NO.11)

[0053] atsus-F300-R:CTTGTGGGTCGTTGTCGAGGATG(SEQ ID NO.12)

[0054] The plasmid pYB1k-atsus was transformed into competent E. coli BW25113 cells, then spread on LB plates containing kanamycin and cultured overnight at 37°C. The positive clones containing the pYB1k-atsus plasmid were selected, which were recombinant E. coli expressing sucrose synthase AtSUS.

[0055] Example 2

[0056] Preparation of recombinant bacteria expressing wild-type glycosyltransferase UGT76G1

[0057] Using Inf-pRB1k-ugt76g1-F and Inf-pRB1k-ugt76g1-R as primers and the cDNA of wild-type stevia-derived glycosyltransferase UGT76G1 as a template, PCR amplification was performed using a high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct ugt76g1 gene fragment.

[0058] Inf-pRB1k-ugt76g1-F:

[0059] CTAACAGGAGGAATTAACCATATGGCCGAAAACAAGACCGA(SEQ ID NO.13)

[0060] Inf-pRB1k-ugt76g1-R:

[0061] GTACCAGATCTACCCTCGAGTTACAAAGAGGAAATGTAAGA(SEQ ID NO.14)

[0062] Using pRB1k-XhoI-F and pRB1k-NcoI-R as primers and pRB1k empty vector as template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct expression vector fragment of pRB1k. (Qun Liu, Baixue Lin, Yong Tao. Improved methylation in E. coli via an efficient methyl supply system driven by betaine. Metabolic Engineering, Volume 72, 2022, 46-55, the pRB1k vector was disclosed).

[0063] pRB1k-XhoI-F:CTCGAGGGTAGATCTGGTAC (SEQ ID NO.15)

[0064] pRB1k-NcoI-R:GGTTAATTCCTCCTGTTAGC (SEQ ID NO.16)

[0065] The above ugt76g1 gene fragment and pRB1k expression vector fragment were connected by Gibson assembly method. The Gibson connection product was added to Escherichia coli DH5α competent cells (Beijing Quanshijin Biotechnology Co., Ltd.), reacted on ice for 30 minutes, then reacted in a 42°C water bath for 90 seconds, and then placed on ice for 2 minutes, then added to 1mL LB medium, put on a 37°C shaker to recover for 1 hour, and finally spread on an LB plate containing kanamycin and cultured at 37°C overnight. Multiple monoclonal strains were selected for culture, and PCR verification was performed using primers pBAD-F and ugt76g1-F300-R. The positive clone strain with the correct target sequence size was selected for culture, and the plasmid was extracted to obtain the positive clone plasmid pRB1k-ugt76g1.

[0066] pBAD-F:GATTATTTGCACGGCGTCAC(SEQ ID NO.11)

[0067] ugt76g1-F300-R:CTGCAGTTCCAGTTCACGAC(SEQ ID NO.17)

[0068] The plasmid pRB1k-ugt76g1 was transformed into competent E. coli BW25113 cells, then spread on LB plates containing kanamycin and cultured overnight at 37°C. The next day, positive clones containing pRB1k-ugt76g1 were selected, which were recombinant E. coli expressing wild-type glycosyltransferase UGT76G1.

[0069] Example 3

[0070] Construction of mutant library of glycosyltransferase UGT76G1 and screening of superior mutants

[0071] The wild-type glycosyltransferase UGT76G1 gene sequence was randomly mutated by error-prone PCR to construct a mutant library. ep-PCR amplification was performed using rTaq DNA polymerase (TAKARA) with low fidelity using ugt76g1-ATG-F and ugt76g1-TAA-R as primers and pRB1k-ugt76g1 plasmid as template. The amplification system and amplification procedure are shown in Tables 1 and 2.

[0072] ugt76g1-ATG-F:ATGGCCGAAAACAAGACCGA(SEQ ID NO.18)

[0073] ugt76g1-TAA-R:TTACAAAGAGGAAATGTAAG(SEQ ID NO.19)

[0074] Table 1 Error-prone PCR amplification system

[0075]

[0076] Table 2 Error-prone PCR amplification procedures

[0077]

[0078]

[0079] After PCR product purification, the mutant gene fragment of UGT76G1 was obtained, and the UGT76G1 mutant gene fragment was connected to the vector pRB1k using a Gibson seamless ligation kit to obtain a complete plasmid mutant library containing the UGT76G1 mutant gene. The Gibson ligation reaction system is shown in Table 3.

[0080] Table 3 Gibson ligation reaction system

[0081]

[0082] After reacting in a 50°C water bath for 1 hour, the Gibson ligation product was transferred to E. coli DH5α competent cells for culture. After the culture was completed, the E. coli was placed in a shaker for 1 hour to recover. After the recovery was completed, the E. coli was spread on a plate and placed in a 37°C incubator for 12 hours. After the colonies grew, 5 monoclonal strains were randomly selected, and their plasmids were extracted for sequencing after culture. Subsequently, the colonies on the plate were scraped with a glass rod, and the plasmids were extracted to obtain a plasmid mutant library, which was stored at -20°C for subsequent high-throughput screening of mutant libraries.

[0083] The steps of high-throughput screening are as follows:

[0084] (1) After the construction of the glycosyltransferase UGT76G1 mutant library was completed, a single clone colony on the plate was picked with a high-temperature and high-pressure sterilized toothpick and inoculated into a 96-well deep-well plate containing 800 μL LB medium (containing kanamycin sulfate). The seed solution was obtained by shaking and culturing in a 96-well plate shaker at 37°C and 900 rpm for 24 h.

[0085] (2) Use an inoculation needle to dip the seed solution and transfer it to another new 96-well plate containing LB medium containing kanamycin sulfate (final concentration of 50 μg / mL) and culture at 37°C and 900 rpm until the OD 600 When the pH value is 0.6-0.8, add L-arabinose with a final concentration of 1mM, and continue induction culture for 22h at 30℃ and 900rpm in a 96-well plate shaker. After the induction culture is completed, centrifuge at 3000×g for 20min to collect the bacteria. Add lysozyme solution to each well, mix thoroughly, let lysozyme fully act on the cells, break the bacteria and release the intracellular enzymes. After the cell breakage is completed, centrifuge at 4℃ and 3000×g for 20min in a refrigerated centrifuge to obtain the glycosyltransferase UGT76G1 mutant enzyme solution.

[0086] (3) Preparation of AtSUS enzyme solution: Use an inoculation needle to dip the seed solution of recombinant Escherichia coli expressing sucrose synthase AtSUS and transfer it to a conical flask containing 10 mL of LB medium containing kanamycin sulfate (final concentration of 50 μg / mL). Cultivate in a shaking incubator at 37°C and 220 r / min. When the OD 600 When the pH value reached 0.6-0.8, L-arabinose was added at a final concentration of 1 mM. The culture was continued at 30°C and 220 r / min for 22 h. The cells were collected by centrifugation and ultrasonically disrupted. The cells were centrifuged at 5000×g for 5 min to obtain the sucrose synthase AtSUS enzyme solution.

[0087] (4) 25 mM stevioside STV, 150 mM sucrose, 2.5 mM UDPG, 0.16 mL AtSUS enzyme solution, 0.16 mL UGT76G1 mutant enzyme solution, and 100 mM sodium phosphate buffer were mixed and reacted in a 37° C. water bath for 7 h, and then heated for 5 min to terminate the reaction. The pH value of the reaction system was 7.

[0088] (5) DNS detection: Centrifuge at 4°C, 3000×g for 20 min in a refrigerated centrifuge and collect the supernatant. Add 70 μL of the reaction supernatant and 210 μL of DNS to a clean 96-well plate, mix well, and heat for 5 min to perform DNS color reaction. After cooling to room temperature, centrifuge at 3000×g for 18 min, take 200 μL of the supernatant to a 96-well ELISA plate, and detect its OD using an ELISA reader. 540 OD 540 Reactions with high values ​​used the UGT76G1 mutant and were replicated in vials.

[0089] (6) Vial verification: OD obtained by 96-well plate screening 540 After the mutants used in the reaction solution with high values ​​were selected, the single colonies of the UGT76G1 mutant, the single colonies of the wild-type UGT76G1, and the single colonies of the recombinant E. coli expressing sucrose synthase AtSUS were picked and inoculated into test tubes respectively, and placed in a shaker at 37°C and 220rpm for 12h to obtain seed solution. The seed solution was inoculated into 20mL LB medium (containing kanamycin sulfate with a final concentration of 50μg / mL) at a volume ratio of 1%, and continued to be shaken at 37°C and 220rpm until the OD 600 When the pH value was 0.6-0.8, L-arabinose with a final concentration of 1 mM was added for induction, and the induction culture was carried out at 30°C and 220 rpm for 18 hours. After the culture was completed, the bacteria were collected by centrifugation (5000×g for 10 min), resuspended with 0.51 mL of 100 mM pH 8.0 sodium phosphate buffer, and the bacteria were crushed and centrifuged to obtain UGT76G1 mutant enzyme solution, wild-type UGT76G1 enzyme solution and sucrose synthase AtSUS enzyme solution for subsequent experiments.

[0090] The reaction system in the vial was as follows: 25 mM stevioside STV, 150 mM sucrose, 2.5 mM UDPG, 0.5 mL UGT76G1 mutant enzyme solution or wild-type UGT76G1 enzyme solution, 0.2 mL AtSUS enzyme solution, and 100 mM sodium phosphate buffer was added to make up to 10 mL of the total system. The pH value of the reaction system was 7. After the reaction was placed in a water bath at 37 ° C for 7 hours, the reaction was terminated by boiling water bath for 5 minutes, and the reaction supernatant was taken for DNS detection after centrifugation at 10,000 × g for 2 minutes. The OD 540The reaction products catalyzed by the mutants with values ​​higher than that of wild-type UGT76G1 were detected by HPLC to verify the production of rebaudioside A (RA).

[0091] After multiple initial screenings and vial rescreenings of the UGT76G1 mutant library using a 96-well plate, six excellent mutants were finally screened out from nearly 35,000 mutants. Their enzyme activities were all higher than the wild type, and the efficiency of catalyzing stevioside STV to synthesize rebaudioside A was also greatly improved. The yield of rebaudioside A of the excellent mutant in the vial retest was as follows: Figure 1 As shown. Among them, the yield of rebaudioside A synthesized by mutant 68S was increased by more than 30 times compared with wild-type UGT76G1. The mutant 68S was sequenced to be the amino acid sequence shown in SEQ ID NO.1 obtained by the following mutations: the 109th amino acid was mutated from L to Q, the 113th amino acid was mutated from S to C, and the 424th amino acid was mutated from I to F.

[0092] Example 4

[0093] Scale-up study on the synthesis of rebaudioside A by the best mutant 68S

[0094] The seed liquid of mutant 68S and sucrose synthase AtSUS was inoculated into 400 ml LB medium (containing kanamycin sulfate with a final concentration of 50 μg / mL) at a volume ratio of 1%, and cultured at 37°C and 220 rpm. 600 When the pH value was 0.6-0.8, L-arabinose with a final concentration of 1 mM was added for induction, and the induction culture was carried out at 30°C and 220 rpm for 18 hours. After the culture was completed, the bacteria were collected by centrifugation (5000×g for 10 min), resuspended with 10.5 mL of 100 mM pH 8.0 sodium phosphate buffer, and the bacteria were crushed and centrifuged to obtain UGT76G1 mutant 68S enzyme solution and sucrose synthase AtSUS enzyme solution.

[0095] The reaction system is as follows: 60 mM stevioside STV, 360 mM sucrose, 3 mM UDPG, 10 mL AtSUS enzyme solution, 10 mL 68S enzyme solution, and 100 mM sodium phosphate buffer is added to 100 mL. The reaction is carried out at 37° C. for 18 hours. The pH value of the reaction system is 7.

[0096] The reaction solution was sampled every 4 hours and the yield of rebaudioside A was detected by HPLC as a function of conversion time. Figure 2 As shown, the optimal mutant 68S can convert 60 mM stevioside STV into 60 mM rebaudioside A within 18 h, that is, stevioside STV can be completely converted into rebaudioside A.

[0097] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A glycosyltransferase UGT76G1 mutant, characterized in that: The UGT76G1 mutant is any one of the following (A)-(C): (A) A protein obtained by causing any one or more of the following mutations based on the amino acid sequence shown in SEQ ID NO.1: The amino acid at position 109 mutated from L to Q; The amino acid at position 113 mutated from S to C; The 424th amino acid mutated from I to F; (B) a protein having an amino acid sequence with a sequence identity of more than 95% with that of (A) and having the same function; (C) Fusion protein obtained by ligating a tag to the end of the protein defined in (A) or (B).

2. The glycosyltransferase UGT76G1 mutant according to claim 1, characterized in that The amino acid sequence of the UGT76G1 mutant is shown in SEQ ID NO.

3.

3. Any of the following biological materials: (A) an expressed gene encoding the UGT76G1 mutant of claim 1 or 2; (B) a recombinant plasmid, the recombinant plasmid being connected to the expression gene described in (A); (C) A recombinant cell comprising the recombinant plasmid or the expression gene of the UGT76G1 mutant.

4. An enzyme composition, characterized in that The enzyme composition comprises: a glycosyltransferase UGT76G1 mutant and a sucrose synthase AtSUS; the glycosyltransferase UGT76G1 mutant is as shown in claim 1 or 2; The sucrose synthase AtSUS is as follows (B1) or (B2): the amino acid sequence of (B1) is shown in SEQ ID NO.5; (B2) A protein having an amino acid sequence identity of 95% or more to that of (B1) and having the same function.

5. A set of recombinant strains expressing the enzyme composition of claim 4, characterized in that: The invention comprises a recombinant strain A and a recombinant strain B: the recombinant strain A contains a recombinant plasmid A, which is obtained by constructing the coding gene of the glycosyltransferase UGT76G1 mutant according to claim 1 or 2 into an expression vector; the recombinant strain B contains a recombinant plasmid B, which is obtained by constructing the coding gene of sucrose synthase AtSUS into a plasmid.

6. The set of recombinant strains according to claim 5, characterized in that: The host bacteria include but are not limited to Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris or Corynebacterium glutamicum.

7. A method for synthesizing rebaudioside A using a glycosyltransferase UGT76G1 mutant, characterized in that: The following steps are involved: Stevioside STV, UDPG, sucrose and the enzyme composition of claim 4 or the induced expression enzyme product of the complete set of recombinant strains of claim 5 are added to the catalytic reaction system, reacted, inactivated the enzyme, and centrifuged to obtain a supernatant containing rebaudioside A.

8. The method according to claim 7, characterized in that The inducible expression enzyme products of the set of recombinant strains in claim 5 include inducible expression enzyme product A and inducible expression enzyme product B; The method for obtaining the induced expression enzyme product A comprises the following steps: The seed solution of the recombinant strain A in claim 5 is inoculated into a culture medium containing kanamycin sulfate, and the OD of the culture solution is 600 When the pH reaches 0.6-0.8, L-arabinose is added to continue induction culture for 8-40 hours, the bacteria are collected by centrifugation, the cells are broken, centrifuged, and the supernatant is collected as the induced expression enzyme product A; the inoculation amount is 1 v / v%; the final concentration of kanamycin sulfate is 10-100 μg / mL; the final concentration of L-arabinose is 0.1-15 mM; The method for obtaining the induced expression enzyme product B comprises the following steps: The seed solution of the recombinant strain B in claim 5 is inoculated into a culture medium containing kanamycin sulfate, and cultured at 30-40°C and 200-300 r / min until the OD 600 When the pH reaches 0.6-0.8, add L-arabinose and continue culturing for 8-40 hours, centrifuge and collect the bacteria, break the cells, centrifuge, and collect the supernatant, which is the induced expression enzyme product B; the inoculation amount is 1v / v%; the final concentration of kanamycin sulfate is 10-100μg / mL; the final concentration of L-arabinose is 0.1-15mM.

9. The method according to claim 7 or 8, characterized in that: In the catalytic reaction system, the concentration of stevioside STV is 10-100mM, the concentration of UDPG is 0.1-5mM, the concentration of sucrose is 50-800mM, the amount of the induced expression enzyme product of the recombinant strain A added is 0.1-50mL, and the amount of the induced expression enzyme product of the recombinant strain B added is 0.1-50mL.

10. The method according to claim 7, characterized in that The pH value of the catalytic reaction system is 5.0-8.0, the temperature is 25-60° C., and the reaction time is 5-30 hours.

Images