High-temperature-resistant xylanase mutant

Abstract

The invention relates to the technical field of genetic engineering and protein modification, in particular to a high-temperature-resistant xylanase mutant and application thereof. The invention provides a mutant comprising mutation sites selected from I24T, G25N, V27Y, T41V, S65N / Q and N160A / M / R on the basis of wild type xylanase PT. The heat resistance of the xylanase mutant is remarkably improved, and after the xylanase mutant is treated at 95 DEG C for 5 min, the enzyme activity residual rate is improved by 13.1%-23.2% compared with that of a wild type; wherein the xylanase single-point mutant containing S65N single-point mutation has the strongest heat resistance, the enzyme activity residual rate is as high as 82.9%, and an unexpected technical effect is achieved.

Description

Technical Field

[0001] The present invention relates to the technical field of gene engineering and protein engineering, and in particular to a thermostable acidic xylanase mutant and application thereof. Background Art

[0002] Xylan is a five-carbon polysaccharide and a key component of plant hemicellulose. It accounts for one-third of plant carbohydrates and is the second most abundant renewable resource in nature after cellulose. It is present in plant cell walls and nearly all other parts of the body.

[0003] Xylanase is a general term for a class of enzymes that can degrade xylan into oligosaccharides or xylose. The complete enzymatic degradation of a xylan molecule requires several enzymatic reactions. Two enzymes act on the main chain: β-1,4-xylanase (1,4-β-D-xylanohydrolase: EC3.1.2.8) and β-xylosidase (1,4-β-D-xylanxylohydrolase: EC3.2.1.37). Generally speaking, the former acts on the xylosidic bonds within the main chain, breaking down xylan into oligosaccharides, while the latter acts on the ends of xylo-oligosaccharides, releasing xylose.

[0004] Many microorganisms produce xylanases. The biochemical properties of xylanases are primarily understood through studies of bacterial and fungal xylanases. Bacterial xylanases can be broadly divided into two categories: high-molecular-weight, acid-resistant xylanases and low-molecular-weight, alkali-resistant xylanases. This distinction is not observed in fungi, however, as low-molecular-weight xylanases are all alkaline-resistant.

[0005] Xylan in feed is difficult for monogastric animals to digest. It also binds to large amounts of water, increasing the volume and viscosity of the chyme in the digestive tract of the feeder, reducing the interaction between nutrients and endogenous enzymes in the digestive tract. This hinders the digestion and absorption of nutrients, especially fat and protein, and reduces feed utilization. Research results show that adding xylanase to feed can significantly reduce the molecular size of arabinoxylan, breaking it down into oligoxylose with a smaller degree of polymerization, thereby improving feed performance and eliminating or reducing the anti-nutritional effects caused by increased viscosity.

[0006] Research on the application of xylanase in the production of wine and Japanese barley shochu has already been conducted. Japanese researchers applied the acid-resistant xylanase Xy1C to the brewing of Japanese barley shochu and found that the enzyme helped improve fermentation efficiency and increase alcohol yield.

[0007] The application value of xylanase in fields such as papermaking, food, energy, feed, and the environment has been recognized. However, due to low expression levels in natural materials, large-scale production is difficult, product purification is difficult, and some properties of xylan do not fully meet application requirements. With the development of genetic engineering technology, using bioreactors to increase its expression level and modifying the xylanase gene at the molecular level to address some of the deficiencies in xylanase activity (such as specific enzyme activity, stress resistance, pH value, and thermal stability) has become a current research hotspot. Summary of the Invention

[0008] The present invention aims to provide a thermostable xylanase mutant and its application. The mutant has significantly improved thermostable properties compared to the wild type, thereby facilitating the wide application of xylanase in the feed field.

[0009] The present invention relates to a xylanase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO: 1 and comprising an amino acid substitution at at least one position selected from the group consisting of 24, 25, 27, 41, 65, and 160 compared to SEQ ID NO: 1.

[0010] In some embodiments of the invention, the amino acid sequence of the mutant is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to SEQ ID NO: 1.

[0011] In some more specific embodiments, the amino acid sequence of the mutant is at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identical to SEQ ID NO:1.

[0012] In some embodiments of the present invention, the mutant comprises substitution of at least one amino acid selected from the group consisting of I24T, G25N, V27Y, T41V, S65N / Q, and N160A / M / R.

[0013] In some embodiments of the present invention, the mutant comprises a substitution or combination of substitutions selected from the following substitutions and combinations of substitutions: I24T; G25N; V27Y; T41V; S65N; S65Q; N160A; N160M; N160R;

[0014] I24T / G25N;

[0015] I24T / V27Y;

[0016] I24T / T41V;

[0017] I24T / S65N;

[0018] I24T / S65Q;

[0019] I24T / N160A;

[0020] I24T / N160M;

[0021] I24T / N160R;

[0022] G25N / V27Y;

[0023] G25N / T41V;

[0024] G25N / S65N;

[0025] G25N / S65Q;

[0026] G25N / N160A;

[0027] G25N / N160M;

[0028] G25N / N160R;

[0029] V27Y / T41V;

[0030] V27Y / S65N;

[0031] V27Y / S65Q;

[0032] V27Y / N160A;

[0033] V27Y / N160M;

[0034] V27Y / N160R;

[0035] T41V / S65N;

[0036] T41V / S65Q;

[0037] T41V / N160A;

[0038] T41V / N160M;

[0039] T41V / N160R;

[0040] S65N / N160A;

[0041] S65N / N160M;

[0042] S65N / N160R;

[0043] S65Q / N160A;

[0044] S65Q / N160M;

[0045] S65Q / N160R;

[0046] I24T / G25N / V27Y;

[0047] I24T / G25N / T41V;

[0048] I24T / G25N / S65N;

[0049] I24T / G25N / S65Q;

[0050] I24T / G25N / N160A;

[0051] I24T / G25N / N160M;

[0052] I24T / G25N / N160R;

[0053] I24T / V27Y / T41V;

[0054] I24T / V27Y / S65N;

[0055] I24T / V27Y / S65Q;

[0056] I24T / V27Y / N160A;

[0057] I24T / V27Y / N160M;

[0058] I24T / V27Y / N160R;

[0059] I24T / T41V / S65N;

[0060] I24T / T41V / S65Q;

[0061] I24T / T41V / N160A;

[0062] I24T / T41V / N160M;

[0063] I24T / T41V / N160R;

[0064] G25N / T41V / S65N;

[0065] G25N / T41V / S65Q;

[0066] G25N / T41V / N160A;

[0067] G25N / T41V / N160M;

[0068] G25N / T41V / N160R;

[0069] I24T / S65N / N160A;

[0070] I24T / S65N / N160M;

[0071] I24T / S65N / N160R;

[0072] I24T / S65Q / N160A;

[0073] I24T / S65Q / N160M;

[0074] I24T / S65Q / N160R;

[0075] G25N / S65N / N160A;

[0076] G25N / S65N / N160M;

[0077] G25N / S65N / N160R;

[0078] G25N / S65Q / N160A;

[0079] G25N / S65Q / N160M;

[0080] G25N / S65Q / N160R;

[0081] T41V / S65N / N160A;

[0082] T41V / S65N / N160M;

[0083] T41V / S65N / N160R;

[0084] T41V / S65Q / N160A;

[0085] T41V / S65Q / N160M;

[0086] T41V / S65Q / N160R;

[0087] I24T / G25N / V27Y / T41V;

[0088] I24T / G25N / V27Y / S65N;

[0089] I24T / G25N / V27Y / S65Q;

[0090] I24T / G25N / V27Y / N160A;

[0091] I24T / G25N / V27Y / N160M;

[0092] I24T / G25N / V27Y / N160R;

[0093] I24T / G25N / T41V / S65N;

[0094] I24T / G25N / T41V / S65Q;

[0095] I24T / G25N / T41V / N160A;

[0096] I24T / G25N / T41V / N160M;

[0097] I24T / G25N / T41V / N160R;

[0098] I24T / V27Y / T41V / S65N;

[0099] I24T / V27Y / T41V / S65Q;

[0100] I24T / V27Y / T41V / N160A;

[0101] I24T / V27Y / T41V / N160M;

[0102] I24T / V27Y / T41V / N160R;

[0103] G25N / V27Y / T41V / S65N;

[0104] G25N / V27Y / T41V / S65Q;

[0105] G25N / V27Y / T41V / N160A;

[0106] G25N / V27Y / T41V / N160M;

[0107] G25N / V27Y / T41V / N160R;

[0108] I24T / G25N / V27Y / T41V / S65N;

[0109] I24T / G25N / V27Y / T41V / S65Q;

[0110] I24T / G25N / V27Y / T41V / N160A;

[0111] I24T / G25N / V27Y / T41V / N160M;

[0112] I24T / G25N / V27Y / T41V / N160R;

[0113] I24T / G25N / V27Y / S65N / N160A;

[0114] I24T / G25N / V27Y / S65N / N160M;

[0115] I24T / G25N / V27Y / S65N / N160R;

[0116] I24T / G25N / V27Y / S65Q / N160A;

[0117] I24T / G25N / V27Y / S65Q / N160M;

[0118] I24T / G25N / V27Y / S65Q / N160R;I24T / G25N / T41V / S65N / N160A;

[0119] I24T / G25N / T41V / S65N / N160M;

[0120] I24T / G25N / T41V / S65N / N160R;

[0121] I24T / G25N / T41V / S65Q / N160A;

[0122] I24T / G25N / T41V / S65Q / N160M;

[0123] I24T / G25N / T41V / S65Q / N160R;

[0124] I24T / V27Y / T41V / S65N / N160A;

[0125] I24T / V27Y / T41V / S65N / N160M;

[0126] I24T / V27Y / T41V / S65N / N160R;

[0127] I24T / V27Y / T41V / S65Q / N160A;

[0128] I24T / V27Y / T41V / S65Q / N160M;

[0129] I24T / V27Y / T41V / S65Q / N160R;

[0130] G25N / V27Y / T41V / S65N / N160A;

[0131] G25N / V27Y / T41V / S65N / N160M;

[0132] G25N / V27Y / T41V / S65N / N160R;

[0133] G25N / V27Y / T41V / S65Q / N160A;

[0134] G25N / V27Y / T41V / S65Q / N160M;

[0135] G25N / V27Y / T41V / S65Q / N160R;

[0136] I24T / G25N / V27Y / T41V / S65N / N160A;

[0137] I24T / G25N / V27Y / T41V / S65N / N160M;

[0138] I24T / G25N / V27Y / T41V / S65N / N160R;

[0139] I24T / G25N / V27Y / T41V / S65Q / N160A;

[0140] I24T / G25N / V27Y / T41V / S65Q / N160M;

[0141] I24T / G25N / V27Y / T41V / S65Q / N160R.

[0142] The present invention also relates to a DNA molecule encoding the above xylanase mutant.

[0143] The present invention also relates to a recombinant expression vector comprising the above DNA molecule.

[0144] When the above expression vector is transferred into host cells, the heat resistance of the recombinantly expressed xylanase mutant is significantly improved.

[0145] In some embodiments of the present invention, a host cell comprising the above-mentioned recombinant expression vector is provided, which is a non-plant cell.

[0146] In some embodiments of the present invention, the host cell is Pichia pastoris.

[0147] In some embodiments of the present invention, the host cell is Trichoderma reesei.

[0148] The present invention also provides application of the xylanase mutant in the field of feed.

[0149] Based on the wild-type xylanase PT, the present invention provides mutants containing at least one mutation site among I24T, G25N, V27Y, T41V, S65N, S65Q, N160A, N160M, and N160R. Compared to the wild-type xylanase PT, the xylanase single-point mutants provided by the present invention exhibit 13.1%-23.2% higher residual enzyme activity after treatment at 95°C for 5 minutes. The xylanase mutant containing the S65N single-point mutation exhibits the strongest heat resistance, with a residual enzyme activity of up to 82.9%, achieving unexpected technical benefits.

[0150] In summary, the heat resistance of the xylanase mutant provided by the present invention is significantly improved, which is beneficial to reducing the production cost of xylanase and promoting its wide application in the feed field. DETAILED DESCRIPTION

[0151] The present invention discloses a xylanase mutant, its preparation method and application, a DNA molecule encoding the xylanase mutant, a vector, and a host cell. Those skilled in the art can refer to the contents herein and appropriately modify the process parameters to achieve the desired results. The methods and applications of the present invention have been described through preferred embodiments. It is apparent that those skilled in the art can modify, alter, and combine the methods and applications described herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.

[0152] The present invention uses the conventional techniques and methods used in the field of genetic engineering and molecular biology, such as the methods described in MOLECMLACONE:ALBORATORMANE,3rd Ed.(Sambrook,2001) and CURRENT PROTOCOLS INMOLECMLACONE(Ausubel,2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can, based on the technical solutions described in the present invention, adopt other conventional methods, experimental protocols and reagents in this area, without being limited to the specific embodiments of the present invention. For example, the present invention can use the following experimental materials and reagents:

[0153] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vectors pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0154] Enzymes and kits: PCR enzyme and ligase were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.

[0155] Culture medium formula:

[0156] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0157] Yeast culture medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

[0158] Yeast screening medium (MD medium): 2% peptone, 2% agarose;

[0159] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol;

[0160] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol;

[0161] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;

[0162] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0;

[0163] The present invention will be further described below in conjunction with the embodiments:

[0164] Example 1 Construction of recombinant plasmid

[0165] The synthetic xylanase gene (GeneBank MK138894.1) was optimized based on the codon preference of Pichia pastoris. Six bases, GAATTC (an EcoR I restriction site), were added before the ATG start codon, and GCGGCCGC (a Not I restriction site) was added after the TAA stop codon. The optimized nucleotide sequence was synthesized by Shanghai Jierui Bioengineering Co., Ltd. This xylanase was named PT, with its amino acid sequence as SEQ ID NO: 1 and its encoding nucleotide sequence as SEQ ID NO: 2.

[0166] The xylanase gene was digested with restriction enzymes EcoR I and Not I (Fermentas). Simultaneously, the plasmid pPIC9K was digested with restriction enzymes EcoR I and Not I. The digestion products were purified using a gel purification kit and ligated using T4 DNA ligase (Fermentas). The ligated products were transformed into DH5α Escherichia coli (Invitrogen) and selected with ampicillin. Several clones were sequenced (Sangon) for accuracy.

[0167] The plasmid was purified from the E. coli clone with the correct sequencing results using a plasmid miniprep kit (Omega) to obtain a recombinant plasmid, which was named pPIC9K-PT.

[0168] Example 2 Screening of thermotolerant xylanase mutants

[0169] To further enhance the enzymatic activity of xylanase PT, the applicants conducted protein structural analysis. This protein, a GHI1 family xylanase, has a β-jellyroll structure. Using directed evolution, the applicants screened a large number of mutations in the enzyme.

[0170] 1.1 Design of PCR primers PT-F1 and PT-R1:

[0171] PT-F1: GGC GAATTC CAAAGTTTCTGTAGTTCAGCTTCTC (the underline indicates the restriction endonuclease EcoRI recognition site);

[0172] PT-R1: ATA GGCGGCCG CTTATCATTAATCACCAATGTAAACCTT (the underline is the restriction endonuclease NotI recognition site).

[0173] The PT gene (SEQ ID NO: 2) was used as a template and PCR amplification was performed using the above-mentioned primers using the GeneMorph II Random Mutation PCR Kit (Bomais). The PCR product was recovered from a gel, digested with EcoRI and NotI, and ligated with the pET21a vector that had been digested with the same enzymes. The product was then transformed into Escherichia coli BL21 (DE3), plated on LB+Amp plates, and cultured in an inverted manner at 37°C. After transformants appeared, they were picked individually with a toothpick into a 96-well plate. 150 μL of LB+Amp medium containing 0.1 mM IPTG was added to each well of the plate. The cells were cultured at 37°C and 220 rpm for approximately 6 h. The supernatant was discarded after centrifugation, and the cells were resuspended in buffer and repeatedly frozen and thawed to break the cell wall to obtain an E. coli cell lysate containing xylanase.

[0174] 30 μL of lysate was taken out to two new 96-well plates, one of which was treated at 95°C for 5 minutes. 30 μL of substrate was added to both 96-well plates. After reacting at 37°C for 30 minutes, the reducing sugar generated was determined by DNS method. Different mutants maintained different activities after high temperature treatment.

[0175] Experimental results showed that some mutations had no effect on the thermotolerance of xylanase, while others even worsened its thermotolerance or enzymatic activity. Furthermore, while some mutations improved the temperature tolerance of xylanase, their enzymatic properties were significantly altered, failing to meet the requirements. Ultimately, the following mutations were identified: I24T, G25N, V27Y, T41V, S65N, S65Q, N160A, N160M, and N160R. These mutations significantly improved the thermotolerance of xylanase without affecting its activity or original enzymatic properties.

[0176] Based on the above-mentioned wild-type xylanase PT, the present invention provides mutants containing single mutation sites of I24T, G25N, V27Y, T41V, S65N, S65Q, N160A, N160M, and N160R, respectively.

[0177] Example 3 Expression of Xylanase in Pichia pastoris, 3.1 Construction of Expression Vector

[0178] The gene sequences of xylanase PT and its mutants were optimized according to the codon preference of Pichia pastoris and synthesized by Shanghai Jierui Bioengineering Co., Ltd., and two restriction sites, EcoRI and NotI, were added to the 5' and 3' ends of the synthetic sequence, respectively.

[0179] According to the method described in Example 1, the gene sequences of the synthesized xylanase PT and its mutants were double-digested with EcoRI and NotI, respectively, and then ligated with the pPIC-9K vector digested with the same enzymes overnight at 16°C. The cells were then transformed into Escherichia coli DH5a, plated on LB+Amp plates, and inverted cultured at 37°C. After transformants appeared, colony PCR was performed (reaction system: template-picked single clone, rTaq DNA polymerase 0.5 μL, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5'AOX primer (10 mM): 0.5 μL, 3'AOX primer: 0.5 μL, ddH2O 14.5 μL, reaction procedure: 95°C pre-denaturation for 5 min, 30 cycles of: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). Positive clones were verified by sequencing, and the correct recombinant expression plasmid was obtained.

[0180] 3.2 Construction of Pichia pastoris engineered strains

[0181] 3.2.1 Preparation of competent yeast

[0182] The Pichia pastoris GS115 strain was activated on a YPD plate and cultured at 30°C for 48 h. The activated GS115 single clone was inoculated into 6 mL YPD liquid medium and cultured at 30°C and 220 rpm for about 12 h. The bacterial solution was then transferred to a 30 mL The cells were cultured in a triangular flask of YPD liquid medium at 30°C and 220 rpm for about 5 h. The cell density was detected by UV spectrophotometer. After the OD600 value was in the range of 1.1-1.3, 4 mL of cells were collected into sterilized EP tubes by centrifugation at 9000 rpm at 4°C for 2 min. The supernatant was gently discarded and the remaining supernatant was absorbed with sterilized filter paper. The cells were resuspended in 1 mL of pre-cooled sterile water, centrifuged at 9000 rpm at 4°C for 2 min, the supernatant was gently discarded, and the cells were washed again with 1 mL of sterile water. The cells were centrifuged at 9000 rpm at 4°C for 2 min, the supernatant was gently discarded, and the cells were resuspended in 1 mL of pre-cooled sorbitol (1 mol / L); the cells were centrifuged at 9000 rpm at 4°C for 2 min, the supernatant was gently discarded, and the cells were gently resuspended in 100-150 μL of pre-cooled sorbitol (1 mol / L).

[0183] 3.2.2 Transformation and screening

[0184] The recombinant expression plasmids constructed in 3.1 were linearized with Sac I, and the linearized fragments were purified and recovered and transformed into Pichia pastoris GS115 by electroporation. The recombinant Pichia pastoris strains were screened on MD plates, and then multi-copy transformants were screened on YPD plates containing different concentrations of geneticin (0.5 mg / mL-8 mg / mL).

[0185] The obtained transformants were transferred to BMGY medium and cultured with shaking at 30°C and 250 rpm for 1 day; then transferred to BMMY medium and cultured with shaking at 30°C and 250 rpm; 0.5% methanol was added every day to induce expression for 4 days; and the bacteria were removed by centrifugation at 9000 rpm for 10 minutes to obtain fermentation supernatants containing xylanase PT and xylanase mutants, respectively.

[0186] 1. Xylanase activity determination method

[0187] (1) Definition of xylanase activity unit

[0188] Under the conditions of 37°C and pH 5.5, the amount of enzyme required to release 1 μmol of reducing sugar from a 5 mg / mL xylan solution per minute is one enzyme activity unit (U).

[0189] (2) Enzyme activity determination method

[0190] Take 2mL of 1% xylan substrate (prepared with pH5.5 acetic acid-sodium acetate buffer), add it to a colorimetric tube, balance at 37℃ for 10min, then add 2mL of acid xylanase solution appropriately diluted with pH5.5 acetic acid-sodium acetate buffer and balanced at 37℃, mix well at 37℃, and react for 30min. After the reaction is completed, add 5mL of DNS reagent and mix well to terminate the reaction. Then boil in a boiling water bath for 5min, cool to room temperature with tap water, distilled water to 25mL, mix well, and use the standard blank sample as a blank control, and measure the absorbance value A at 540nm. E .

[0191] Enzyme activity calculation formula:

[0192] X D =[(A E -A B )×K+C0]×N×1000 / (M×t).

[0193] Where: X D is the activity of xylanase in the diluted enzyme solution, U / mL; A E is the absorbance of the enzyme reaction solution; A B is the absorbance of the enzyme blank solution; K is the slope of the standard curve; C O is the intercept of the standard curve; M is the molar mass of xylose, 150.2 g / mol; t is the enzymatic reaction time, min; N is the enzyme solution dilution multiple; 1000 is the conversion factor, 1 mmol = 1000 μmol.

[0194] (3) Enzyme activity assay results

[0195] Enzyme activity was detected according to the above method, and the results showed that the enzyme activity of the fermentation supernatant of the recombinant Pichia pastoris strain expressing the recombinant xylanase PT and its mutants was 330-790 U / mL.

[0196] Example 4 Analysis of the Heat Tolerance of Xylanase Mutants

[0197] The fermentation supernatant of the recombinant Pichia pastoris strain expressing xylanase PT and its mutants described in Example 3 was diluted to approximately 20 U / mL with acetic acid-sodium acetate buffer (pH 5.5). After treatment at 95°C for 5 minutes, the residual enzyme activity was measured. The residual enzyme activity rate was calculated, with the enzyme activity of the untreated sample set as 100%. The results are shown in Table 1.

[0198] Table 1 Analysis of thermotolerance of xylanase single-point mutants

[0199] Xylanase mutants Residual enzyme activity after 95℃ treatment for 5 min Wild-type PT 67.3％ I24T 80.0％ G25N 82.7％ V27Y 77.6％ T41V 81.6％ S65N 82.9％ S65Q 82.1％ N160A 76.5％ N160M 77.5％ N160R 76.1％

[0200] As shown in Table 1, compared to wild-type xylanase PT, the xylanase mutants provided by the present invention containing the I24T, G25N, V27Y, T41V, S65N, S65Q, N160A, N160M, and N160R single-point mutations, respectively, showed an increase in residual enzyme activity of 13.1%-23.2% after treatment at 95°C for 5 minutes. Among them, the xylanase mutant containing the S65N single-point mutation exhibited the strongest heat resistance, with a residual enzyme activity of up to 82.9%. This demonstrates that the I24T, G25N, V27Y, T41V, S65N, S65Q, N160A, N160M, and N160R mutations provided by the present invention can significantly improve the heat resistance of xylanase PT, achieving unexpected technical benefits.

[0201] In summary, the xylanase mutant provided by the present invention has stronger heat resistance and is more suitable for use as a feed additive than the wild type.

Claims

1. A xylanase mutant, characterized in that The mutant is a xylanase having an amino acid sequence of SEQ ID NO: 1, comprising a substitution of amino acid at position 65: S65Q.

2. The xylanase mutant according to claim 1, characterized in that The mutant further comprises substitution of at least one amino acid in the following group: I24T, G25N, V27Y, T41V, N160A / M / R.

3. The xylanase mutant according to claim 2, characterized in that The mutant comprises a substitution combination of at least one amino acid in the following group: I24T / S65Q; G25N / S65Q; V27Y / S65Q; T41V / S65Q; I24T / G25N / S65Q; I24T / V27Y / S65Q; I24T / T41V / S65Q; G25N / T41V / S65Q; I24T / S65Q / N160A; I24T / S65Q / N160M; I24T / S65Q / N160R; G25N / S65Q / N160A; G25N / S65Q / N160M; G25N / S65Q / N160R; T41V / S65Q / N160A; T41V / S65Q / N160M; T41V / S65Q / N160R; I24T / G25N / V27Y / S65Q; I24T / G25N / T41V / S65Q; I24T / V27Y / T41V / S65Q; G25N / V27Y / T41V / S65Q; I24T / G25N / V27Y / T41V / S65Q; I24T / G25N / V27Y / S65Q / N160A; I24T / G25N / V27Y / S65Q / N160M; I24T / G25N / V27Y / S65Q / N160R; I24T / G25N / T41V / S65Q / N160A; I24T / G25N / T41V / S65Q / N160M; I24T / G25N / T41V / S65Q / N160R; I24T / V27Y / T41V / S65Q / N160A; I24T / V27Y / T41V / S65Q / N160M; I24T / V27Y / T41V / S65Q / N160R; G25N / V27Y / T41V / S65Q / N160A; G25N / V27Y / T41V / S65Q / N160M; G25N / V27Y / T41V / S65Q / N160R; I24T / G25N / V27Y / T41V / S65Q / N160A; I24T / G25N / V27Y / T41V / S65Q / N160M; I24T / G25N / V27Y / T41V / S65Q / N160R.

4. A DNA molecule encoding the xylanase mutant according to any one of claims 1 to 3.

5. A recombinant expression plasmid comprising the DNA molecule of claim 4.

6. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 5; the host cell is a non-plant cell.

7. The host cell according to claim 6, characterized in that The host cell is Pichia pastoris ( Pichia pastoris ) or Trichoderma reesei ( Trichoderma reesei ).

8. Use of the xylanase mutant according to any one of claims 1 to 3 in the field of feed.