Efficient pichia pastoris base editor based on adenosine deaminase mutant

Abstract

The invention discloses an adenosine deaminase mutant. The adenosine deaminase mutant is an M61V mutant, a V69A mutant, an M70T mutant and a Y73C mutant based on a wild type. The invention further discloses a pichia pastoris base editor containing the adenosine deaminase mutant, the pichia pastoris base editor can achieve efficient editing of pichia pastoris genome bases, the editing efficiency can reach 90-100%, and a gene editing tool is provided for basic and application research based on pichia pastoris.

Description

Technical Field

[0001] The invention provides a DNA molecule composition, belonging to the technical field of nucleic acid. Background Art

[0002] Adenine base editor (ABE) is a CRISPR / Cas9 technology (CRISPR: clustered regularly interspaced short palindromic repeats; Cas9: CRISPR-associated protein 9) based on the base mutation of the genome target sequence from A·T to G·C without generating double-strand breaks in nucleic acids and without providing a specific nucleic acid template. The most widely used and most efficient ABE tools are all developed based on the deaminase ABE8e. It is reported that adenine base editors have been widely used in many species, such as rice, wheat, and mammalian cells.

[0003] Pichia pastoris ( pichia pastoris ) is an excellent and regulatable host for heterologous protein expression. AOX1 High-density fermentation is carried out under strict regulation of promoters, which is mainly used for the production of biopharmaceuticals and industrial enzymes. With the increasing application of Pichia pastoris in the expression of exogenous proteins, its shortcomings have become increasingly prominent. For example, Pichia pastoris often cannot effectively express oligomeric proteins, membrane proteins or certain protein complexes. In order to solve such problems, genetic engineering of Pichia pastoris and the establishment of more complex and efficient genetic manipulation tools are becoming increasingly necessary. Studies have reported that the Cre-loxp recombinase system, CRISPR / Cas9 gene editing system and cytosine base editor have been applied to Pichia pastoris. However, compared with other expression systems, Pichia pastoris lacks a complete and efficient set of genetic manipulation tools.

[0004] In order to construct an adenine base editor suitable for Pichia pastoris, we cited the deaminase ABE8e to construct two adenine base editors: N-ABE and C-ABE. Although the editing efficiency of N-ABE is slightly higher than that of C-ABE, the editing effect of some bases within the effective editing window of N-ABE is still limited. The purpose of the present invention is to provide an adenine base editor with better editing efficiency by directed evolution of ABE8e in Pichia pastoris N-ABE. Summary of the invention

[0005] Based on the above purpose, the present invention first provides an adenosine deaminase mutant, wherein the adenosine deaminase mutant is a wild-type M61V, V69A, M70T and Y73C mutant as shown in SEQ ID NO.1.

[0006] Secondly, the present invention provides a polynucleotide encoding the above-mentioned adenosine deaminase mutant, and the sequence of the polynucleotide is shown in SEQ ID NO.2.

[0007] Third, the present invention provides a Pichia base editor, which is a DNA molecule composition, comprising a first expression plasmid and a second expression plasmid, wherein the first expression plasmid contains a polynucleotide encoding an nCas9 protein and a polynucleotide encoding the adenosine deaminase mutant, and the second expression plasmid contains a gRNA, wherein the amino acid sequence of the nCas9 protein is shown in SEQ ID NO.3, and the spacer sequence length of the gRNA is 20 nt.

[0008] In a preferred embodiment, the sequence of the polynucleotide encoding the adenosine deaminase mutant is shown in SEQ ID NO.2, the sequence of the polynucleotide encoding the nCas9 protein is shown in SEQ ID NO.4, and the polynucleotide encoding the adenosine deaminase mutant and the polynucleotide encoding the nCas9 protein are separated by a sequence encoding (GGGGS) 10 The polynucleotides of the linked peptides are linked.

[0009] In a more preferred embodiment of the present invention, the polynucleotide encoding the adenosine deaminase mutant in the first expression plasmid is located at the 5' end of the polynucleotide encoding the nCas9 protein, and is fused to the polynucleotide encoding the nCas9 protein by encoding (GGGGS) 10 The polynucleotides of the connecting peptide are connected, wherein the 5' end of the polynucleotide encoding the adenosine deaminase mutant is provided with a polynucleotide encoding a nuclear localization signal peptide as shown in SEQ ID NO.5, and the 3' end of the polynucleotide encoding the nCas9 protein is provided with a polynucleotide encoding a nuclear localization signal peptide as shown in SEQ ID NO.5.

[0010] More preferably, the sequence of the segment from the polynucleotide encoding the adenosine deaminase mutant to the polynucleotide encoding the nCas9 protein in the first expression plasmid is as shown in SEQ ID NO. 6. In the present invention, the first expression plasmid having this sequence setting is named "pN-ABE".

[0011] In another more preferred embodiment of the present invention, the polynucleotide encoding the nCas9 protein in the first expression plasmid is located at the 5' end of the polynucleotide encoding the adenosine deaminase mutant, and is connected to the polynucleotide encoding the adenosine deaminase mutant by encoding (GGGGS) 10 The polynucleotide of the connecting peptide is connected, wherein the 3' end of the polynucleotide encoding the nCas9 protein is provided with a polynucleotide encoding a nuclear localization signal peptide as shown in SEQ ID NO.5.

[0012] More preferably, the sequence of the segment from the polynucleotide encoding the nCas9 protein to the polynucleotide encoding the adenosine deaminase mutant in the first expression plasmid is as shown in SEQ ID NO. 7. In the present invention, the first expression plasmid having this sequence setting is named "pC-ABE".

[0013] Fourth, the present invention provides a Pichia pastoris host cell transfected with the above-mentioned Pichia base editor.

[0014] Finally, the present invention provides a method for base editing a Pichia target gene using the above-mentioned Pichia base editor, the method comprising the following steps: (1) transfecting a first expression plasmid containing the polynucleotide encoding the adenosine deaminase mutant and the polynucleotide encoding the nCas9 protein, and a second expression plasmid containing gRNA into a Pichia yeast cell containing a target gene to be edited, wherein the gRNA targets the target gene to be edited and the length of the spacer sequence of the gRNA is 20 nt; (2) Screening positive clones of Pichia pastoris in which the target gene to be edited is specifically edited.

[0015] The method provided by the present invention can be used to achieve targeted gene editing of target cells, thereby realizing industrial applications in the basic and applied research fields of Pichia pastoris.

[0016] The adenosine deaminase mutant and Pichia adenine base editor provided by the present invention can more efficiently complete the conversion of base A to base G. The adenosine deaminase mutant can cover 14 bases in the target within the editing window, and compared with the wild-type ABE8e, it significantly improves the editing efficiency of base A at each site in the window. This feature is extremely advantageous in applications such as directed protein evolution, because it reduces the preference of amino acids, increases the diversity of mutations, and provides a strong tool foundation for the development of adenine base editors with broad targeting in other species. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 . Schematic diagram of the pN-ABE and pC-ABE vector structures; Figure 2 . Colony PCR and agarose gel electrophoresis were used to identify positive clones after pN-ABE transformation; Figure 3 . Colony PCR and agarose gel electrophoresis were used to identify positive clones after pC-ABE transformation; Figure 4 . Sanger sequencing results of pN-ABE positive clones; Figure 5 . Sanger sequencing results of pC-ABE positive clones; Figure 6 . Identification of positive strains after pN-ABE and pC-ABE recombinant vectors were integrated into GS115. 1-5 are clones identified after pN-ABE integration, and 6-10 are clones identified after pC-ABE integration; Figure 7 . Schematic diagram of the pTEF-AC vector structure; Figure 8 . Agarose gel electrophoresis results after pTEF-AC colony PCR; Fig. 9 . Sanger sequencing results of pTEF-AC positive clones; Fig.10 . Typical mutation results from base A to base G in the target sequence after pTEF-AC was transferred into N-ABE / GS115 and C-ABE / GS115; Fig.11 . Statistical analysis of Sanger sequencing results of target sequences after pTEF-AC was transferred into N-ABE / GS115 and C-ABE / GS115; Fig.12 . Statistical analysis of Sanger sequencing results of target sequences after pTEF-AC was transferred into N-ABE / GS115 and ABEhem / GS115; Fig.13 . Statistical analysis of high-throughput sequencing results after pTEF-AC was transferred into N-ABE / GS115 and ABEhem / GS115; Fig.14 . ABEhem sequence mutation alignment. DETAILED DESCRIPTION

[0018] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0019] Experimental materials used in the examples of the present invention Pichia pastoris ( Pichia pastoris )GS115 is stored in this laboratory; Escherichia coli ( Escherichia coli )TOP 10 was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. YPD (1% yeast powder, 2% peptone, 2% glucose) medium was used for routine culture of yeast cells, YPDS (1% yeast powder, 2% peptone, 2% glucose, 1M sorbitol) medium and MD (2% glucose, 1.34% yeast nitrogen base (YNB)) medium were used for screening of yeast mutant strains. LB (0.5% yeast powder, 1% peptone, 1% sodium chloride) medium and LLB (0.5% yeast powder, 1% peptone, 0.5% sodium chloride) medium were used for the culture of Escherichia coli. Solid culture medium needs to be supplemented with 20 g / L agar powder as a selection marker, and the concentration of ampicillin (A+) is 100 mg / L, and the concentration of zeocin (Z+) is 100 mg / L.

[0020] Restriction enzymes, ligases, and dephosphorylases were purchased from NEB; KOD FX Neo was purchased from TOYOBO; homologous recombination kits were purchased from Nanjing Novozyme Biotechnology Co., Ltd.; plasmid extraction kits were purchased from QIAGEN; nucleic acid gel recovery kits were purchased from Omega Bio-Tek; peptone and yeast powder were purchased from OXOID; agar powder was purchased from Beijing Solebow Co., Ltd.; agarose and sorbitol were purchased from SIGMA; ampicillin was purchased from SAITONC; bleomycin was purchased from Invitrogen; other chemical reagents were purchased from Sinopharm Chemical Reagent Co., Ltd. Electroporator (GenePulser Xcell) and PCR instrument (C1000 Touch) were purchased from Bio-Rad. Unless otherwise specified, gene sequence synthesis and sequencing were completed by Suzhou Jinweizhi Biotechnology Co., Ltd.

[0021] Example 1. Construction of ABE recombinant plasmid and ABE recombinant strain 1. Construction of ABE recombinant plasmid Adenosine deaminase ABE8e published by NCBI (GenBank of ABE8e: UNJ19119.1) 20-185 Adenosine deaminase ABE8e 20-185 The amino acid sequence is shown in SEQ ID NO.1. The yeast codons were optimized and two wild-type ABE expression plasmids with different sequences were constructed, pN-ABE: pGAP-ABE8e-(GGGGS) 10 -nCas9 (sequence as shown in SEQ ID NO.6) and pC-ABE: pGAP-nCas9-(GGGGS) 10-ABE8e (the sequence is shown in SEQ ID NO.7).

[0022] In the present invention, the pGAP-ABE8e-(GGGGS) 10 The key component of -nCas9 (pN-ABE) is obtained by fusion of adenosine deaminase ABE8e to the N-terminus of CRISPR-associated protein Cas9 mutant (D10A), and the fusion protein is connected by a connecting peptide (GGGGS) in the middle. 10 The fusion protein was connected to the Cas9 (D10A) sequence and the nuclear localization signal sequence (NLS) PKKKRKV (SEQ ID NO.5) was incorporated into the C-terminus of the Cas9 (D10A) sequence. In addition, the nuclear localization signal sequence (PKKKRKV) was also incorporated into the N-terminus of ABE8e to ensure that the fusion protein can be accurately localized to the cell nucleus. The plasmid map is attached. Figure 1 .

[0023] In the present invention, the pGAP-nCas9-(GGGGS) 10 -ABE8e (pC-ABE) is a key component of adenosine deaminase ABE8e fused to the C-terminus of CRISPR-associated protein Cas9 mutant (D10A), and the fusion protein is connected by a connecting peptide (GGGGS) in the middle. 10 The Cas9 (D10A) sequence was connected and the nuclear localization signal sequence (NLS) PKKKRKV (SEQ ID NO.5) was integrated into the C-terminus of the Cas9 (D10A) sequence to ensure that the fusion protein can be accurately localized in the cell nucleus. The plasmid map is attached. Figure 1 .

[0024] The designed vectors were sent to Beijing Sino-US Taihe Biotechnology Co., Ltd. to synthesize the recombinant vectors pN-ABE and pC-ABE. The recombinant vectors were then transformed into Escherichia coli. The results of colony PCR and agarose gel electrophoresis were as follows: Figure 2 and Figure 3 As shown in the figure, the target size bands (1022 bp and 835 bp) were successfully amplified. Figure 4 and Figure 5 The Sanger sequencing results confirmed that the ABE recombinant vector was correct.

[0025] 2. Construction of ABE / GS115 recombinant strain The recombinant vectors pN-ABE and pC-ABE were integrated into the genome of Pichia pastoris GS115, and then positive strains were identified and sequenced. Nhe I am HIS4The circular vector was linearized on the element, and then the linearized vector was transferred into GS115 competent cells by electroporation and cultured for 2-3 days. The positive clones were then identified by primers GAP-F / CYC-R: (CGTCGCTGGCAATAATAGCG / CCTTCCTTTTCGGTTAGAGC) and confirmed by sequencing.

[0026] The successfully constructed recombinant vector is linearized and then transferred into GS115 competent cells by electroporation. In the present invention, the ABE / GS115 recombinant strain constructed by the pN-ABE recombinant vector is named N-ABE / GS115 strain, and the ABE / GS115 recombinant strain constructed by the pC-ABE recombinant vector is named C-ABE / GS115 strain. Figure 6 The agarose gel electrophoresis results showed that the positive clones were preliminarily identified, and the subsequent Sanger sequencing indicated that the recombinant vector was successfully integrated to obtain the ABE / GS115 recombinant strain.

[0027] Example 2. Functional evaluation of the Pichia pastoris ABE system 1. Cloning of recombinant gRNA-AC vector pTEF is used as the gRNA expression vector and is stored in our laboratory. Unless otherwise specified in this article, all gRNA expression vectors carry the bleomycin resistance gene. Construction of gRNA-AC expression vector: XM_002489805.1 The gene selects a sequence rich in base A ( XM_002489805.1 2745-2746 :SEQ ID NO.8:ACACAACACACACACATTAG) to comprehensively characterize the editing efficiency and editing window of the adenine base editor. The target fragment was obtained by synthesizing primers AC-F / AC-R:AGGACGAAACGAGTAAGCTCGTCTCAGATCACACAACACACACACATTAG / ATTTTAACTTGCTATTTCTAGCTCTAAAACCTAATGTGTGTGTGTTGTGT and overlapping extension PCR. Subsequently, the correct pTEF-AC was constructed through seamless cloning, transformation and sequencing after identification. Its structural schematic diagram is shown in Figure 7 As shown, Figure 8 Agarose gel electrophoresis and Fig. 9 According to the Sanger sequencing results, the recombinant gRNA vector pTEF-AC was successfully constructed.

[0028] The present invention designs and constructs a pTEF-AC expression vector based on the sequence on the yeast genome, and names it as gRNA-AC.

[0029] 2. Functional verification of ABE base editing gRNA-AC was transferred into N-ABE / GS115 and C-ABE / GS115 competent cells by electroporation, and positive clones were screened on YPDS Z+ solid plates. Then 10 single clones were picked to amplify the AC target sequence using primers AC-F2 / R2 (AAGTCTTTGTTTCAGGTCGTC / CGGTGCTGAATAAGTCCCAA) and sent for sequencing analysis of the editing of base A on the target, and the experiment was repeated three times. Sanger sequencing results showed that both N-ABE and C-ABE could achieve mutations from base A to base G ( Fig.10 ). The statistical analysis results of N-ABE and C-ABE base editing are shown in Fig.11 As shown, the editing windows of N-ABE and C-ABE are both A3-A14. In N-ABE, the editing efficiency of A5 and A6 is 6% (94% vs 88%) and 20% (85% vs 65%) higher than that of C-ABE. For A3 (25% vs 21.67%), A10 (35.67% vs 35%), A12 (25% vs 18.33%) and A14 (7.67% vs 6.67%), only the editing efficiency of A8 is 28.33% lower than that of C-ABE (16.67% vs 45%). Therefore, in order to obtain a base editing tool with higher efficiency or a wider editing window for all bases in the targeting range, the ABE8e nuclease was modified by N-ABE self-evolution.

[0030] Example 3. Acquisition of adenosine deaminase mutants 1. Construction of gRNA-ABEs mutation library For ABE8e 1-501 48 pairs of primers were designed based on the full-length nucleotide sequence to construct 48 targeting gRNAs of ABE8e. First, the fragments containing the targeting sequence were obtained by overlapping extension PCR with 48 pairs of primers, and restriction endonucleases were used to Afl Ⅱ The pTEF vector was purified and recovered after single restriction digestion, and then the 48 fragments were inserted into the pTEF vector by seamless cloning to obtain recombinant products. The 48 recombinant products were transformed into TOP10 competent cells, and the positive clones were identified and sequenced by primers gRNA-F / 3AOX (AGTAAGCTCGTCTCAGATCTTAAG / GCAAATGGCATTCTGACATCC) to obtain 48 ABE8e 1-501 The recombinant gRNA with full gene coverage was obtained by mixing these 48 gRNAs in equal amounts to obtain the gRNA-ABEs mutation library. The sequences of the 48 primer pairs targeting ABE8e are shown in Table 1, and the targeting sequences of the 48 gRNA-ABEs are shown in Table 2.

[0031] Table 1. ABE8e targeting primer sequences

[0032]

[0033]

[0034] Table 2. ABE8e targeting sequences

[0035] 2. Transform the gRNA-ABEs plasmid library into N-ABE competent cells The gRNA-ABEs plasmid library was transformed into N-ABE competent cells by electroporation, and positive clones were screened on YPDS Z+ solid plates. The ABE8e mutant sequence was amplified by primers GAP-F / GAP-R (CGTCGCTGGCAATAATAGCG / TGGCGATCGGTATTGCCCAGA) and sent for sequencing analysis. Finally, we obtained 51 ABEs carrying the ABE8e mutant.

[0036] Example 4. Verification of base editing function of adenosine deaminase mutants gRNA-AC was transferred into 51 ABEs competent cells carrying the ABE8e mutant by electroporation, and positive clones were screened on YPDS Z+ solid plates. Then 10 single clones were picked to amplify the AC sequence using primers AC-F2 / R2 (AAGTCTTTGTTTCAGGTCGTC / CGGTGCTGAATAAGTCCCAA) and sent for sequencing to analyze the editing of base A on the target. After statistical analysis, one ABEhem carrying the ABE8e mutant had an increased editing efficiency ( Fig.12As shown in the figure, although the editing efficiency of base A at position A12 of ABEhem was reduced by 16% compared with N-ABE (16.5% vs 32.5%), the editing efficiency of base A at other positions was improved, among which the editing efficiency of base A at position A3 was increased by 10% (45% vs 35%), the editing efficiency of base A at position A5 was increased by 2.5% (97.5% vs 95%), the editing efficiency of base A at position A6 was increased by 0.5% (92.5% vs 93%), the editing efficiency of base A at position A8 was increased by 27.5% (45% vs 17.5%), the editing efficiency of base A at position A10 was increased by 5% (42.5% vs 37.5%), and the editing efficiency of base A at position A14 was increased by 10% (22.5% vs 12.5%).

[0037] In order to more accurately analyze the editing efficiency and editing window of the evolved adenosine deaminase mutant, we transferred gRNA-AC into N-ABE and ABEhem competent cells, respectively, and performed high-throughput sequencing analysis on all positive clones obtained by screening on YPDS Z+ solid plates. Fig.13 As shown in the figure, compared with N-ABE, the editing efficiency of base A in the editing window of ABEhem has been improved. For example, the editing efficiency of A3, A6 and A8 increased by 17.03%, 12.73% and 6.25%, respectively. The high-throughput sequencing results are basically consistent with the above Sanger sequencing results. The sequence of ABE8e mutant in ABEhem was sequenced and analyzed. The results are shown in the figure. Fig.14 As shown, the ABE8e mutant sequence carries base mutations at four sites, and its amino acid mutations are M61V, V69A, M70T and Y73C. The modified ABEhem can achieve efficient editing of all bases within a wider editing window. The significant advantage of ABEhem is that it can improve the efficiency of gene mutations in a wider range, thereby enriching the diversity of phenotypes. This feature is particularly suitable for technical means such as large-scale editing of target genes and silent gene expression. In the research fields of microbial cell evolution, protein engineering, metabolic engineering and synthetic biology based on Pichia pastoris, this editor is expected to play an important role and accelerate the research process of drug screening and protein expression based on Pichia pastoris. In addition, it also provides a valuable reference for the establishment of similar editors in other species.

Claims

1. An adenosine deaminase mutant, characterized in that: The adenosine deaminase mutants are wild-type M61V, V69A, M70T and Y73C mutants as shown in SEQ ID NO.

1.

2. A polynucleotide encoding the adenosine deaminase mutant according to claim 1, characterized in that: The sequence of the polynucleotide is shown as SEQ ID NO.

2.

3. A Pichia pastoris base editor, characterized in that: The Pichia pastoris base editor is A DNA molecule composition, comprising a first expression plasmid and a second expression plasmid, wherein the first expression plasmid contains a polynucleotide encoding an nCas9 protein and a polynucleotide encoding the adenosine deaminase mutant according to claim 1, and the second expression plasmid contains a gRNA, wherein the amino acid sequence of the nCas9 protein is as shown in SEQ ID NO.3, and the length of the spacer sequence of the gRNA is 20 nt.

4. The Pichia pastoris base editor according to claim 3, characterized in that The sequence of the polynucleotide encoding the adenosine deaminase mutant is shown in SEQ ID NO.2, the sequence of the polynucleotide encoding the nCas9 protein is shown in SEQ ID NO.4, and the polynucleotide encoding the adenosine deaminase mutant and the polynucleotide encoding the nCas9 protein are separated by a sequence encoding (GGGGS) 10 The polynucleotides of the linked peptides are linked.

5. The Pichia pastoris base editor according to claim 4, characterized in that The polynucleotide encoding the adenosine deaminase mutant in the first expression plasmid is located at the 5′ end of the polynucleotide encoding the nCas9 protein, and is ligated to the polynucleotide encoding the nCas9 protein by encoding (GGGGS). 10 The polynucleotides of the connecting peptide are connected, wherein the 5′ end of the polynucleotide encoding the adenosine deaminase mutant is provided with a polynucleotide encoding a nuclear localization signal peptide as shown in SEQ ID NO.5, and the 3′ end of the polynucleotide encoding the nCas9 protein is provided with a polynucleotide encoding a nuclear localization signal peptide as shown in SEQ ID NO.

5.

6. The Pichia pastoris base editor according to claim 5, characterized in that The sequence of the segment from the polynucleotide encoding the adenosine deaminase mutant to the polynucleotide encoding the nCas9 protein in the first expression plasmid is shown in SEQ ID NO.

6.

7. The Pichia pastoris base editor according to claim 4, characterized in that The polynucleotide encoding the nCas9 protein in the first expression plasmid is located at the 5′ end of the polynucleotide encoding the adenosine deaminase mutant, and is coupled to the polynucleotide encoding the adenosine deaminase mutant via the coding sequence (GGGGS). 10 The polynucleotide of the connecting peptide is connected, wherein the 3′ end of the polynucleotide encoding the nCas9 protein is provided with a polynucleotide encoding a nuclear localization signal peptide as shown in SEQ ID NO.

5.

8. The Pichia pastoris base editor according to claim 7, characterized in that The sequence of the segment from the polynucleotide encoding the nCas9 protein to the polynucleotide encoding the adenosine deaminase mutant in the first expression plasmid is shown as SEQ ID NO.

7.

9. A Pichia pastoris host cell transfected with the Pichia base editor of any one of claims 3-8.

10. A method for base editing a Pichia target gene using the Pichia base editor according to any one of claims 3 to 8, characterized in that: The method comprises the following steps: (1) Transfecting a first expression plasmid containing the polynucleotide encoding the adenosine deaminase mutant according to claim 1 and the polynucleotide encoding the nCas9 protein, and a second expression plasmid containing gRNA into a Pichia pastoris cell containing a target gene to be edited, wherein the gRNA targets the target gene to be edited and the length of the spacer sequence of the gRNA is 20 nt; (2) Screening positive clones of Pichia pastoris in which the target gene to be edited is specifically edited.

Images