Nucleic acid aptamer for targeting CD34 positive orbit fibroblasts and application of nucleic acid aptamer

Abstract

The invention relates to a nucleic acid aptamer for targeting CD34 positive orbit fibroblasts, which is characterized in that the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO: 15. The nucleic acid aptamer provided by the invention has the advantages of high affinity, strong specificity, small molecular weight, good stability, simple synthesis, low cost, easy modification, no immunogenicity and the like, and can meet the requirements of rapid detection of thyroid-related ophthalmopathy at present.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology and clinical medicine, and relates to a nucleic acid aptamer sequence targeting CD34-positive orbital fibroblasts and an application thereof in preparing a medicine or a preparation for diagnosing and treating thyroid-related eye diseases. Background Art

[0002] Thyroid-related eye disease is the most common orbital disease in adults. Its pathogenesis is complex and is currently believed to be mainly related to disorders of the immune system. The clinical manifestations of thyroid-related eye disease are complex and diverse, including eyelid retraction and proptosis. Currently, the treatments for thyroid-related eye disease mainly include drug therapy, radiotherapy and surgery. Commonly used first-line drug treatments mainly include glucocorticoids, selenium supplementation, etc. However, due to the lack of clear therapeutic targets, traditional drug treatments usually have obvious side effects. Specific identification of pathogenic cells of thyroid-related eye disease has become an important factor in the diagnosis and treatment of thyroid-related eye disease.

[0003] CD34-positive orbital fibroblasts are cells that appear during the development of thyroid-related eye diseases. They are mainly derived from circulating fibroblasts and enter the orbit through interactions such as chemokines. In the orbit, they are affected by the disordered immune environment and differentiate into adipocytes and myofibroblasts, secreting a large amount of hyaluronic acid, increasing the intraorbital pressure and causing tissue dysfunction, such as limited extraocular muscle activity and optic nerve compression symptoms. Therefore, treatment targeting CD34-positive orbital fibroblasts can help improve the targeting of disease treatment and reduce side effects caused by treatment.

[0004] As a single-stranded DNA, aptamers can curl themselves to form complex three-dimensional structures under the conditions of electrostatic forces, hydrogen bonds and other interaction forces, and bind to targets through intermolecular forces. Aptamers are widely used in the fields of detection and targeted drug synthesis due to their simple chemical synthesis, high affinity, high stability and easy editing. Aptamers were originally composed of ribonucleotides, but due to the shortcomings of ribonucleotide chains being easily degraded and unstable, aptamers are currently more composed of deoxyribonucleotides. Aptamers are obtained based on the systematic evolution of ligands by exponential enrichment (SELEX), and with the continuous development of this technology, various improved SELEX technologies can be predicted for different types of targets, among which the SELEX technology targeting cells is called cell SELEX technology. Cell SELEX technology can screen out aptamers that specifically recognize target cells, but due to the diverse types of cell surface targets, the screened aptamers usually require further experiments to clarify their recognized targets.

[0005] Currently, there are no specific nucleic acid aptamers for CD34-positive orbital fibroblasts. Screening out nucleic acid aptamers that specifically recognize CD34-positive orbital fibroblasts through cell SELEX technology is of great significance for the targeted detection and treatment of thyroid-related eye diseases. Summary of the invention

[0006] The purpose of the present invention is to provide a nucleic acid aptamer targeting CD34 positive orbital fibroblasts with high specificity and application thereof.

[0007] To achieve the above object, the technical solution of the present invention is as follows:

[0008] A nucleic acid aptamer targeting CD34-positive orbital fibroblasts, wherein the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO:1 to SEQ ID NO:16; or a derivative of the nucleic acid aptamer having the same function obtained by chemical modification, chemical labeling or base change on the basis of SEQ ID NO:1 to SEQ ID NO:16;

[0009] SEQ ID NO: 1:

[0010] CAGCACCGTCAACTGAATCTCATTGCGGCGTCCGGCTGGACGTTATTGTTGGAACCGTGATGCGATGGAGATGT;

[0011] SEQ ID NO:2:

[0012] CAGCACCGTCAACTGAATCTCATTGCGGCGTTCGGCTGGACGTTATTGTTGGAACCGTGATGCGATGGAGATGT;

[0013] SEQ ID NO:3:

[0014] CAGCACCGTCAACTGAATCAGGGTTGGTTTTTCGTCTTGGAGTCTCGGGGTGAAGTCGTGATGCGATGGAGATGT;

[0015] SEQ ID NO:4:

[0016] CAGCACCGTCAACTGAATCTCATTACGGCGTTCGGCTGGACGTTATTGTTGGAACCGTGATGCGATGGAGATGT;

[0017] SEQ ID NO:5:

[0018] CAGCACCGTCAACTGAATCCCGGCGACCGGGGGTTCCCCGTTATTGTTGGAAGTCGGCGTGATGCGATGGAGATGT;

[0019] SEQ ID NO:6:

[0020] CAGCACCGTCAACTGAATTGCCACACCGCCGGGAGAGACGCGTACGGGACAGTTTATAGTGATGCGATGGAGATGT;

[0021] SEQ ID NO:7:

[0022] CAGCACCGTCAACTGAATCGGAAGCTCTACCTCCTCGTGTTGGTGTTTCTGGGTATGGTGATGCGATGGAGATGT;

[0023] SEQ ID NO:8:

[0024] CAGCACCGTCAACTGAATGGACCGGCTCGCGGCGTGAGTTATTGTTGAAACCGGTCGTGATGCGATGGAGATGT;

[0025] SEQ ID NO:9:

[0026] CAGCACCGTCAACTGAATTCTGTGGTATAGGTCCAGTGCCCCGCTCATGCTGTTGTCAGTGATGCGATGGAGATGT;

[0027] SEQ ID NO:10:

[0028] CAGCACCGTCAACTGAATGATTCTGTGGGTATATATCCTGCGTTCCGCTCATCATTACGTGATGCGATGGAGATGT;

[0029] SEQ ID NO:11:

[0030] CACCGTCAACTGAATCTCATTGCGGCGTCCGGCTGGACGTTATTGTTGGAACC GTGATGCGAT;

[0031] SEQ ID NO:12:

[0032] CACCGTCAACTGAATCTCATTGCGGCGTCCGGCTGGACGTT;

[0033] SEQ ID NO:13:

[0034] TTGTTGGAACCGTGATGCGAT;

[0035] SEQ ID NO:14:

[0036] CTCATTGCGGCGTCCGGCTGGACGTTATTGTTGGAACC;

[0037] SEQ ID NO:15:

[0038] CAGCACCGTCAACTGAATCTCATTGCGGCGTCCGGCTGGACGTTATTGTTGGA ACC;

[0039] SEQ ID NO:16:

[0040] CTCATTGCGGCGTCCGGCTGGACGTTATTGTTGGAACCGTGATGCGATGGAGA TGT.

[0041] Preferably, the above-mentioned chemical modification or base change includes one or more of phosphorylation, methylation, amination, carboxylation, sulfhydrylation or isotopization.

[0042] Preferably, the chemical labels include one or more of biotin, avidin, fluorescent groups, radioactive substances, digoxin, enzymes, antibodies, proteins, peptides, polymers, nanoluminescent materials or any other therapeutic substances.

[0043] Preferably, the nucleotide sequence of the nucleic acid aptamer has a homology of more than 60% with SEQ ID NO: 1 to SEQ ID NO: 16.

[0044] The present invention also includes a nucleotide sequence having a homology of more than 60% with the sequence shown in SEQ ID NO: 1 to SEQ ID NO: 16.

[0045] Preferably, the nucleotides include ribonucleotides and peptide nucleic acids.

[0046] The present invention also includes a kit for detecting CD34-positive orbital fibroblasts, comprising the nucleic acid aptamer or the nucleotide sequence.

[0047] The present invention also includes a molecular probe, comprising the nucleic acid aptamer or the nucleotide sequence.

[0048] The present invention also includes the use of the nucleic acid aptamer or the nucleotide sequence in diagnostic reagents, molecular imaging probes or targeting media.

[0049] The present invention also includes the use of the nucleic acid aptamer or the nucleotide sequence in the design and preparation of preparations for detecting, diagnosing and treating thyroid-related eye diseases.

[0050] The present invention extracts primary orbital fibroblasts from orbital fat tissue of patients with thyroid-related eye diseases by primary cell separation technology. The cell type and the expression amount of CD34 in the cell are identified by immunofluorescence and flow cytometry, and CD34-positive orbital fibroblasts and CD34-negative orbital fibroblasts are sorted from the primary orbital fibroblasts by flow sorting technology. The screened library sequence is CAGCACCGTCAACTGAAT(N40)GTGATGCGATGGAGATGT, and an aptamer library with high affinity is obtained by continuous screening. The sequences in the aptamer library are identified by high-throughput sequencing technology. The top five nucleic acid aptamers in the high-throughput sequencing results are synthesized, and the affinity of the nucleic acid aptamer to the CD34-positive orbital fibroblasts is identified by flow cytometry. The secondary structure of the target nucleic acid aptamer is obtained by NUPACK software, and the affinity of the nucleic acid aptamer to the CD34-positive orbital fibroblasts is identified after the nucleic acid aptamer is truncated and optimized.

[0051] The beneficial effects of the present invention are:

[0052] The nucleic acid aptamer involved in the present invention has the advantages of high affinity, strong specificity, small molecular weight, good stability, simple synthesis, low cost, easy modification, and non-immunogenicity, and can meet the current requirements for rapid detection of CD34-positive orbital fibroblasts. Each aptamer in the present invention can stably bind to the target cell within 30 minutes without binding to other cells. By appropriately modifying or labeling the nucleic acid aptamer, it can be used for rapid detection and diagnosis of diseases in which CD34-positive orbital fibroblasts participate in the pathogenesis. In summary, the new DNA nucleic acid aptamer involved in the present invention is of great significance for the clinical detection of CD34-positive orbital fibroblasts and the diagnosis of thyroid-related eye diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 This is a picture showing the identification of primary orbital fibroblasts by immunofluorescence staining;

[0054] Figure 2 The expression of CD34 in primary orbital fibroblasts was identified by flow cytometry;

[0055] Figure 3 This is the expression diagram of CD34 in two subpopulations of primary orbital fibroblasts identified by flow cytometry;

[0056] Figure 4 The figure shows the flow cytometry results of affinity detection between CD34-positive and CD34-negative orbital fibroblasts and nucleic acid aptamers;

[0057] Figure 5 This is a graph showing the affinity test between CD34-positive orbital fibroblasts and the synthesized nucleic acid aptamer;

[0058] Figure 6 Figure 2 is the result diagram of nucleic acid aptamer binding specificity;

[0059] Figure 7 The secondary structure simulation diagram of the nucleic acid aptamer and the affinity result diagram of the truncated nucleic acid aptamer binding to CD34 positive orbital fibroblasts;

[0060] Figure 8 This is the equilibrium dissociation constant result diagram of the truncated nucleic acid aptamer binding to CD34 positive orbital fibroblasts;

[0061] Fig. 9 This is a graph showing the results of serum stability testing of nucleic acid aptamers.

[0062] Fig.10 is the amount of CD34-positive orbital fibroblasts in orbital fat of different patients; A is the flow cytometry result of patients with less CD34-positive orbital fibroblasts, and B is the flow cytometry result of patients with more CD34-positive orbital fibroblasts. Specific implementation plan

[0063] The present invention is further described in detail below in conjunction with examples. However, these examples are limited to illustrating the present invention and are not intended to limit the scope of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified, and the reagents, methods and equipment used are conventional reagents, methods and equipment in the art unless otherwise specified.

[0064] Example 1

[0065] Isolation and characterization of CD34 positive and negative primary orbital fibroblasts

[0066] Orbital fat tissue was obtained from patients with moderate to severe quiescent thyroid-related eye disease, and the tissue was washed with 5 ml PBS buffer (purchased from Wuhan Punosai Life Science Co., Ltd.), and the vascular tissue on the surface of the tissue was removed. The tissue was soaked in 1 ml high-glucose basal medium (purchased from Wuhan Punosai Life Science Co., Ltd.), and the tissue was cut into pieces with a diameter of about 1 mm using sterilized ophthalmic scissors to form a tissue homogenate. The above tissue homogenate was transferred to a 10 ml centrifuge tube, and an appropriate amount of type II collagenase (purchased from Worthington Biochemical) was added to the centrifuge tube and mixed. The centrifuge tube was transferred to 37 ° C and incubated for 1 hour, and 1 ml of fetal bovine serum (purchased from Yikesai Biotechnology Co., Ltd.) was added to terminate the digestion. The tissue homogenate was filtered through a mesh and washed with PBS buffer. The collected filtered suspension was centrifuged, and the supernatant was removed and lysed with red blood cell lysis buffer (purchased from Beijing Solebow Technology Co., Ltd.), and after centrifugation, the red blood cells were washed once with 1 ml of PBS buffer and transferred to a culture dish, and cultured with high-glucose complete medium (high-glucose basal medium containing 10% fetal bovine serum and 1% penicillin-streptomycin (purchased from Beijing Solebow Technology Co., Ltd.)) to obtain primary cells.

[0067] Primary cells were inoculated onto cell slides. When the primary cells grew to 80%, the culture medium was discarded and the cells were washed once with 1 ml PBS buffer. 1 ml paraformaldehyde was added to fix the cells for 30 min, and 1 ml PBS buffer was used to wash 3 times, each time for 10 min. Then 1 ml 0.1% Triton was added to incubate for 5 min, and 1 ml PBS buffer was used to wash 3 times, each time for 10 min. The washed primary cells were incubated with 1 ml of PBS buffer containing 5% BSA (purchased from Aimejie Technology Co., Ltd.) for 1 h, 1% anti-vimentin and anti-fibronectin primary antibodies (purchased from Proteintech) were added and incubated with the cells overnight, and the cells were washed 3 times with 1 ml of PBS buffer and then the secondary antibody (purchased from Proteintech) was added and incubated for 1 h. After washing 3 times, DAPI (4',6-diamidino-2-phenylindole) staining solution was added, and after incubation for 5 min, the cells were washed 3 times with PBS buffer and the expression of vimentin and fibronectin was observed under a fluorescence microscope to determine that the primary cells had obvious expression of vimentin and fibronectin, and the primary cell type was determined to be primary orbital fibroblasts (such as Figure 1 ).

[0068] Another dish of primary orbital fibroblasts was digested and divided into two groups, and PBS buffer (control group) and CD34 flow cytometry fluorescent antibody (experimental group) (purchased from Proteintech) were added respectively. After incubation for 1 hour, they were washed twice with PBS buffer, and the content of CD34 expressed by primary orbital fibroblasts was detected by flow cytometry. The flow cytometer was set to inject 10 μL, and then the control group cells were gated, and the proportion of cells in the gate position in the experimental group was calculated. The results are shown in Figure 2 As shown, the proportion of orbital fibroblasts expressing CD34 accounted for 51.73% of the total cells, indicating that the next step was flow cytometry sorting.

[0069] The primary orbital fibroblasts were divided into CD34-positive orbital fibroblasts and CD34-negative orbital fibroblasts using a flow cytometer. After the two groups of cells were expanded and cultured (high-glucose complete medium), the content of CD34 expressed in the cells was detected again using a flow cytometer (operation as described above). The results are as follows: Figure 3 As shown, the peaks of CD34-negative orbital fibroblasts and the control group basically overlap, while the peaks of CD34-positive orbital fibroblasts and the control group are very different, confirming that the sorted cells are primary CD34-positive orbital fibroblasts and CD34-negative orbital fibroblasts, respectively.

[0070] Example 2

[0071] Screening of nucleic acid aptamers using SELEX technology

[0072] The nucleic acid aptamer library used in the design and synthesis is CAGCACCGTCAACTGAAT(N40)GTGATGCGATGGAGATGT (SEQ ID NO: 17), wherein N40 represents a random nucleotide sequence of 40 A, T, C or G. The number of this sequence is 10 10 -10 12 The screening method used is SELEX technology, and the specific operation steps are as follows:

[0073] 2.1. According to the sorting results in Example 1, positive screening targets and negative screening targets were set, wherein CD34-positive orbital fibroblasts were positive screening targets and CD34-negative orbital fibroblasts were negative screening targets. In order to minimize the loss of nucleic acid aptamers with high affinity during the initial screening process, only positive screening targets were introduced in the screening in rounds 1-2, and negative screening targets were introduced from round 3. 1OD of the initial library was dissolved in enzyme-free sterile water, and the dissolved initial library was denatured at 95°C for 10 minutes and immediately placed on ice for 10 minutes.

[0074] 2.2. Observe the cell fusion of the CD34-positive orbital fibroblasts after the last step of flow sorting and expansion culture in Example 1 under a microscope. After the cell fusion of the CD34-positive orbital fibroblasts reaches 90%, remove the high-glucose complete medium, wash twice with 2 ml PBS, and then add 100 μL of binding buffer (4.5 g / L glucose, 5 nM MgCl2, 1 mg / mL BSA and 1 mg / mL yeast tRNA dissolved in DPBS), and incubate with the nucleic acid aptamer library for 2 hours. The incubation conditions are incubation on a 3D shaker at a temperature of 4°C.

[0075] 2.3. After incubation, centrifuge at 2000 rpm for 3 minutes, remove the supernatant, add washing buffer (4.5 g / L glucose and 5 nM MgCl2 dissolved in DPBS) to wash once, add 100 μL enzyme-free sterile water to resuspend after centrifugation, denature at 95°C for 10 minutes, and immediately place on ice for 10 minutes. After centrifugation, take the supernatant and name it Template 1.

[0076] 2.4, take 100 μL template 1 for PCR amplification, add 2×Mix buffer, FAM front primer and Biotin-back primer to make a 200 μL system, the amplification conditions are 95℃5min, 95℃30s, 55.6℃30s, 72℃20s, 10 cycles, 72℃2min. The amplification system is shown in the following table. The front primer sequence is: 5'-CAGCACCGTCAACTGAAT-3' (SEQ ID NO: 18), and the back primer is 5'-ACATCTCCATCGCATCAC-3' (SEQ ID NO: 19). The product obtained after amplification is named template 2. This amplification is named PCR1.

[0077] Table 1 PCR1 amplification system

[0078]

[0079] The amplified product was taken for secondary PCR amplification. The amplification system was configured with 60 μL, the template was the product of the previous round of PCR amplification, and 1.1×Mix buffer, FAM front primer and Biotin-back primer were added. The amplification system is shown in the following table. The front primer sequence is: 5'-CAGCACCGTCAACTGAAT-3' (SEQ ID NO: 20), and the back primer is 5'-ACATCTCCATCGCATCAC-3' (SEQ ID NO: 21). This amplification is named PCR2.

[0080] Table 2 PCR2 amplification system

[0081]

[0082]

[0083] The amplification conditions were 95℃5min, 95℃30s, 55.6℃30s, 72℃20s, 72℃2min, and the number of cycles was set to 10, 12, 14, 16, 18, 20. After PCR amplification, the optimal number of cycles was determined by agarose gel electrophoresis. Template 2 was taken for PCR amplification, and the amplification system was configured with 2000μL, and 1.1×Mix buffer, FAM front primer and Biotin-back primer were added. The amplification conditions were 95℃5min, 95℃30s, 55.6℃30s, 72℃20s, 72℃2min, and the number of cycles was set to the optimal number of cycles determined by PCR2. The amplification system is shown in the table below. This PCR was named PCR3. The product obtained by PCR3 was recovered.

[0084] Table 3 PCR3 amplification system

[0085]

[0086] 2.5. Take 50 μL of streptavidin-agarose beads, wash them twice with PBS, incubate them with the recovered PCR3 amplification products at a ratio of 50 μL / 1 ml for 1 hour, remove the supernatant by centrifugation, and recover the streptavidin-agarose beads.

[0087] 2.6. Take a NAP-5 nucleic acid purification column. In order to efficiently wash the streptavidin-agarose beads, you need to first remove the salting column in the column, and then use 1ml PBS buffer to wash the nucleic acid purification column 3 times. Use 1ml PBS buffer to resuspend the streptavidin-agarose beads and transfer them to the NAP-5 nucleic acid purification column, and add 10ml PBS buffer to wash the agarose beads.

[0088] 2.7. Turn off the switch at the bottom of the NAP-5 nucleic acid purification column, add 500 μL of 0.2 M NaOH solution and incubate for 5 minutes, then collect the incubated solution.

[0089] 2.8. Transfer the collected incubation solution to a new NAP-5 nucleic acid purification column. After the liquid in the column flows out naturally, add 1 ml of enzyme-free sterile water and collect the enzyme-free sterile water that flows out naturally from the column.

[0090] 2.9. Incubate the collected enzyme-free sterile water with 100 μL sodium acetate and 2750 μL anhydrous ethanol at -20°C for 30 min. Centrifuge at 15000 rpm for 15 min after incubation. Remove the supernatant and blow dry.

[0091] 2.10. Add 50 μL of enzyme-free sterile water to dissolve the dried precipitate, and use an ELISA reader to measure the concentration of the nucleic acid aptamer in the solution at an absorbance parameter of 260 nm.

[0092] 2.11. Name the above 2.2-2.10 operations as one round of screening, and increase the screening pressure after each round of screening: reduce the amount of nucleic acid aptamer library, reduce the amount of positive screening cells and the time of positive screening, increase the amount of negative screening cells and the time of negative screening, and increase the number, intensity and time of washing after incubation.

[0093] 2.12. A total of 8 rounds of screening were performed. After all the screening was completed, the products obtained from each round of screening were incubated with CD34-positive orbital fibroblasts to detect whether the affinity was improved: equal amounts of CD34-positive orbital fibroblasts were incubated with equal amounts of products after each round of screening for 1 hour. After incubation, they were washed twice with washing buffer, centrifuged at 2000 rpm for 3 minutes, and the supernatant was removed. 100 μL of washing buffer was added for resuspending, and the affinity of the nucleic acid aptamer to the positive screening cells was detected by flow cytometry (operation as described above) to determine the round of screening endpoint. The results showed that with the continuous increase in the number of screening rounds, the affinity of the nucleic acid aptamer to the positive target continued to increase, and the increase and the rounds were better than those of the negative control, indicating that the nucleic acid aptamer with affinity to the positive target was enriched. Since the nucleic acid aptamer obtained after the 8th round of screening had the highest affinity with the positive target, the 8th round of screening was determined as the terminal screening round (such as Figure 4 ). During this process, due to the changes in the first 8 rounds of screening conditions and the inconsistency of the amplified templates obtained after screening, the results of the samples sent for sequencing in each round were inconsistent. In addition, due to the long screening time, multiple experimental variables affected the experimental results at different time points during the screening process, so the results of the entire SELEX screening had a certain degree of randomness.

[0094] 2.13. Send the nucleic acid aptamers at the end round of screening to high-throughput sequencing.

[0095] Example 3

[0096] Aptamer affinity testing

[0097] 3.1. According to the high-throughput sequencing results, the nucleic acid aptamers were sorted according to the number, and the top 10 nucleic acid aptamers in the high-throughput sequencing results were synthesized, and the numbers were OF-1 (SEQ ID NO: 1), OF-2 (SEQ ID NO: 2), OF-3 (SEQ ID NO: 3), OF-4 (SEQ ID NO: 4), OF-5 (SEQ ID NO: 5), OF-6 (SEQ ID NO: 6), OF-7 (SEQ ID NO: 7), OF-8 (SEQ ID NO: 8), OF-9 (SEQ ID NO: 9), and OF-10 (SEQ ID NO: 10). Since the binding ability of nucleic acid aptamers depends on their complex spatial structure, and the complex spatial structure is closely related to the secondary structure of nucleic acid aptamers. Therefore, in this process, the secondary structure of the aptamer also needs to be analyzed. Usually, the aptamers that can form complex secondary structures such as stem-loops are retained. Through a large number of high-throughput sequencing and countless verification experiments, it is found that some secondary structures of the aptamer bind to the target molecule through hydrogen bonds, hydrophobic interactions, pseudobase pair stacking, and shape matching to form a complex with strong affinity. However, the form is complex and the action forms are diverse, so its selection is quite difficult. Therefore, the selection result needs to rely on years of experience and subjective judgment.

[0098] 3.2. Take 2 dishes of CD34-positive orbital fibroblasts, remove the culture medium and wash the cells with 2m PBS buffer, add 1ml trypsin to digest the cells. The collected cells were grouped into experimental group, control group (cells incubated with initial library) and blank group (cells incubated with binding buffer). The grouped cells were incubated with 2.5μL 10μM synthetic nucleic acid aptamers OF-1 to OF-10 with FAM fluorescent groups (synthesized by General Bio (Anhui) Co., Ltd.), and the binding buffer was added to the incubation system to 100μL. The cells were mixed in the system, and the incubation conditions were 4℃ in the dark for 1h. After incubation, centrifugation was performed at 2000rpm for 3min. After removing the supernatant, the cells were washed once with 200μL washing buffer, and then the cells were resuspended with 100μL washing buffer and sent to flow cytometer for detection (operation as described above). The results showed that compared with the initial library (OF-0th), OF-1 to OF-10 had significantly higher binding abilities to positive targets, and OF-1 to OF-10 were identified as target aptamers (e.g. Figure 5 As shown, due to space limitations, Figure 5 Only the results of OF-1 are provided, the other results are similar).

[0099] Example 4

[0100] Aptamer specificity detection

[0101] Take 1 dish of CD34 negative orbital fibroblasts, remove the culture medium and wash the cells with 2m PBS buffer, add 1ml trypsin to digest the cells. The collected cells were grouped into experimental group, control group (cells incubated with initial library) and blank group (cells incubated with binding buffer). The grouped cells were incubated with 2.5μL 10μM synthetic nucleic acid aptamers OF-1 to OF-10 with FAM fluorescent groups (synthesized in General Bio (Anhui) Co., Ltd.), and the binding buffer was added to the incubation system to 100μL. The cells were mixed in the system, and the incubation conditions were 4℃ in the dark for 1h. After incubation, centrifugation was performed at 2800rpm for 3min. After removing the supernatant, the cells were washed once with 200μL washing buffer, and the cells were resuspended with 100μL washing buffer and sent to flow cytometer for detection (operation as described above). The results showed that compared with the initial library (OF-0th), the binding ability of OF-1 to negative targets did not increase significantly, that is, OF-1 to OF-10 only bound to positive targets but not to negative targets, confirming that OF-1 has binding specificity (such as Figure 6 As shown, due to space limitations, Figure 6 Only the results of OF-1 are provided, and the other results are similar). This proves that the nucleic acid aptamer of the present invention has great application value in the differential diagnosis of CD34-positive orbital fibroblasts and the development of targeted drugs.

[0102] Example 5

[0103] Aptamer truncation optimization

[0104] The secondary structure of OF-1 was simulated by NUPACK software (such as Figure 3 ), find the truncation optimization site, and design the truncation optimization sequence according to the truncation optimization site, and name them as OF-1a (SEQ ID NO: 11), OF-1b (SEQ ID NO: 12), OF-1c (SEQ ID NO: 13), OF-1d (SEQ ID NO: 14), OF-1e (SEQ ID NO: 15), and OF-1f (SEQID NO: 16). The structure simulation of the truncated sequence was performed by NUACK software, and the results are as follows Figure 7 OF-1a, OF-1b, OF-1c, OF-1d, OF-1e, and OF-1f (synthesized by General Biotechnology (Anhui) Co., Ltd.) were synthesized and the affinity of the aptamers was tested according to 3.2. The results showed that compared with the control group and OF-1, the peak shift of the OF-1f group was the largest and the sequence was the shortest. Therefore, OF-1f was determined to be a truncated and optimized nucleic acid aptamer (such as Figure 7 ).

[0105] Example 6

[0106] Equilibrium dissociation constant determination

[0107] Take 1OD of synthesized OF-1f, add deionized water according to the instructions, and prepare 100μL of nucleic acid aptamer solutions with concentrations of 0nM, 7.8125nM, 15.625nM, 31.25nM, 62.5nM, 125nM, 250nM, 500nM, and 1000nM. Take 2 dishes of CD34-positive orbital fibroblasts, use a pipette to remove the culture medium in the culture dish, and wash the cells with PBS buffer. Use pancreatic enzyme to digest the cells from the culture dish and divide them into 9 groups, which are incubated with nucleic acid aptamers of different concentrations on a 3D shaker. The incubation temperature is 4°C and the incubation time is 30min. After the incubation was completed, the cells were centrifuged at 2800 rpm for 3 min, the supernatant was removed, and the cells were washed twice with PBS, and then 300 μL of PBS was added to resuspend the cells. The absorbance of the cells in each group was detected by flow cytometry according to the operation described in Example 2. The cells in each group were measured repeatedly and the average value was taken as the fluorescence intensity in each group. The fluorescence intensity was simulated using Y=Vmax*X / (Kd+X) to calculate the size of Kd. The calculation results showed that Kd was 6.484 nM, indicating that OF-1f had a high affinity (such as Figure 8 ). At the same time, the equilibrium dissociation constants of the other 15 sequences were determined by the same method, and the Kd values ​​obtained were also less than 100 nM, indicating that the other 15 nucleic acid aptamers had high affinity with the target.

[0108] Example 7

[0109] The serum stability of OF-1f was tested.

[0110] 7.1. Take 9 PCR tubes and add 95 μL serum and 5 μL OF-1f into each tube.

[0111] 7.2. Place the above solution in a 37°C constant temperature incubator for incubation. Take out a PCR tube after 0, 2, 4, 6, 8, 16, 24, 48, and 72 hours and place it at -80°C.

[0112] 7.3. Take 0.6g agarose powder and add 30ml electrophoresis buffer, mix well and boil until the liquid is transparent. Add ethidium bromide and pour into the gelatin plate and wait for it to cool.

[0113] 7.4. The PCR tube was taken out of the -80℃ refrigerator, and the sample was loaded on the gel plate for electrophoresis. The results showed that OF-1f gradually degraded with the extension of incubation time. After incubation in serum for 6 hours, the nucleic acid aptamer was degraded by 50%, indicating that the nucleic acid aptamer has good stability in serum. This provides pharmacokinetic evidence for the development and application of subsequent drugs (such as Fig. 9 ).

[0114] Example 8

[0115] To establish the relationship between the number of CD34-positive orbital fibroblasts and the clinical manifestations of patients with thyroid-associated eye disease

[0116] Orbital fat samples were taken from patients with moderate to severe quiescent thyroid-related eye disease to extract primary orbital fibroblasts. The primary cell extraction process is as described in Example 1. Two samples were randomly selected from a large number of samples, and the expression of CD34-positive orbital fibroblasts in the extracted cells was detected using CD34 flow cytometry fluorescent antibodies. The operation process is as shown in Example 1. The results showed that the proportion of CD34-positive orbital fibroblasts in the orbital fat of different patients was inconsistent (e.g. Fig.10 A and 10B). The clinical data of different patients were recorded and compared with those of patients with significant differences in the proportion of CD34-positive orbital fibroblasts to all orbital fibroblasts. The results showed that different patients with significant differences in the proportion of CD34-positive orbital fibroblasts to all orbital fibroblasts had significant differences in clinical manifestations. Patients with a high proportion of CD34-positive orbital fibroblasts had a shorter course of disease, a higher CAS score, and more significant inflammatory changes in the eyelids, conjunctiva, and caruncle. Repeated multiple times, selected different samples, corresponding to the proportion of CD34-positive orbital fibroblasts to all orbital fibroblasts and the clinical data of the patients, and the same conclusion was drawn. Therefore, OF-1f can be used to detect the proportion of CD34-positive orbital fibroblasts to evaluate the clinical manifestations of patients, providing auxiliary quantitative indicators for the formulation of patient treatment strategies and the evaluation of prognosis.

[0117] It should be noted that when the present invention involves a numerical range, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as those in the embodiments, in order to avoid redundancy, the present invention describes a preferred embodiment. Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they know the basic creative concept. Therefore, the attached claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0118] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A nucleic acid aptamer targeting CD34-positive orbital fibroblasts, characterized in that: The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO: 15; SEQ ID NO:15: CAGCACCGTCAACTGAATCTCATTGCGGCGTCCGGCTGGACGTTATTGTTGGAACC.

2. A kit for detecting and diagnosing thyroid-related eye diseases, characterized in that: Comprising the nucleic acid aptamer as claimed in claim 1.

3. A molecular probe, characterized in that Comprising the nucleic acid aptamer as claimed in claim 1.

4. Use of the nucleic acid aptamer according to claim 1 in the preparation of diagnostic reagents, molecular imaging probes or targeting media.

5. Use of the nucleic acid aptamer as claimed in claim 1 in preparing a preparation for detecting and diagnosing thyroid-related eye diseases.

Images