Light-driven toxin-enriched composite hydrogel, preparation method thereof and application of light-driven toxin-enriched composite hydrogel in rapid toxin detection

Abstract

The invention discloses light-driven toxin-enriched composite hydrogel as well as a preparation method and application thereof. The composite hydrogel comprises light-driven hydrogel and detection hydrogel, the light-driven hydrogel is agarose hydrogel doped with Au (at) Ag core-shell nano particles; the detection hydrogel is a double strand formed by an okadaic acid aptamer and a complementary sequence cDNA thereof, and a double strand formed by a domoic acid aptamer and a complementary sequence DNAzyme thereof, the hairpin H1 is used for modifying a quenching group BHQ2 at the 3'end, the hairpin H2 is used for modifying a fluorophore Cy3 at the neck part, the hairpin H3 is used for modifying a fluorophore FAM and a quenching group BHQ1 at the two ends respectively, and the metal ion doped agarose hydrogel is used for catalyzing DNAzyme cyclic shearing; and the photo-thermal driving unit is positioned on the detection function unit. According to the present invention, with the composite system of upper layer photo-thermal enrichment and lower layer dual-signal detection, the rapid and high-sensitivity simultaneous detection of the okadaic acid and the domoic acid is achieved through the combination of the photo-thermal transpiration effect and the HCR and DNAzyme cyclic shearing reaction;

Description

Technical Field

[0001] This invention belongs to the field of food safety testing technology, and specifically relates to a photothermal-driven toxin enrichment composite hydrogel, its preparation method, and its application in rapid toxin detection. Background Technology

[0002] In the process of marine economic development and seafood consumption, frequent harmful algal blooms lead to the accumulation of various marine biotoxins (such as STX, OA, DA, BTX, etc.) in shellfish and fish. Therefore, multiple toxins often coexist in seafood. When multiple toxins coexist, there may be interactions or synergistic effects between different toxins, thus affecting the accuracy of detection. In existing technologies, the traditional mouse bioassay (MBA) has been phased out due to ethical and accuracy issues. While methods such as liquid chromatography-mass spectrometry (LC-MS) and immunoassay (IA) are highly sensitive, they are expensive, complex to operate, and difficult to implement for rapid on-site detection, especially in the circulation and consumption of aquatic products, where they cannot efficiently and accurately identify the types and amounts of toxins present in samples.

[0003] OA is a polyether-based marine biotoxin produced by the metabolism of toxic dinoflagellates. It specifically inhibits the activity of serine / threonine protein phosphatases and is a major causative agent of diarrhetic shellfish poisoning. This toxin accumulates in filter-feeding shellfish through the marine food chain. Humans who consume contaminated shellfish may experience acute gastroenteritis symptoms such as diarrhea, vomiting, and abdominal pain. Long-term exposure to OA may also induce apoptosis and promote tumor development, damaging organs such as the liver. my country's National Food Safety Standard for Determination of Diarrhetic Shellfish Toxins in Shellfish (GB 5009.212—2016) clearly stipulates that the maximum detection limit for OA in shellfish and other aquatic products is 10 μg / kg.

[0004] Domthoic acid (DA) is a potent neurotoxin produced by the genus *Pseudo-nitzschia*. This toxin binds with a high affinity to glutamate receptors, causing excessive excitation of nerve cells and leading to neurological damage such as memory impairment. Humans who ingest DA-contaminated shellfish may experience amnesic shellfish poisoning (ASP), with clinical symptoms including vomiting, diarrhea, headache, confusion, and persistent memory loss. To reduce the risk of poisoning, most countries set a maximum allowable limit of 20 μg / g for domthoic acid in wet shellfish tissue. my country's National Food Safety Standard, *Determination of Amnesic Shellfish Toxins in Shellfish* (GB 5009.198-2016), explicitly stipulates that the maximum allowable limit for DA in bivalve shellfish and other aquatic products is 0.03 μg / g.

[0005] Hydrogels are three-dimensional network polymer materials formed by the cross-linking of hydrophilic and hydrophobic groups, possessing porosity, high water absorption, and good biocompatibility. Their structure maintains morphological stability while allowing free diffusion of biomolecules, making them widely used in drug delivery, tissue engineering, and biosensing, particularly suitable as carrier platforms for bioactive substances such as nucleic acids and proteins. The three-dimensional network structure of hydrogels allows them to expand rapidly in water while maintaining their shape, making them ideal candidates for containing bioactive targets (such as nucleic acids and proteins). Furthermore, the physical properties of hydrogels can be flexibly adjusted by external stimuli such as temperature, light, and pH, enabling the development of intelligent responsive hydrogel platforms. These hydrogels possess signal-triggered gel-sol transition or stimulus-responsive stiffness regulation capabilities, and are not only widely used in early disease detection and diagnosis but also exhibit unique advantages in biomolecular detection—for example, light-responsive and temperature-responsive hydrogels can precisely regulate their physical properties through external stimuli to achieve "stimulus-response" detection. Furthermore, when using hydrogels for nucleic acid-related sensing, the presence of target molecules can initiate physical transformation or be prepared through nucleic acid-modified polymers, enabling rapid response to target analytes and giving them the potential to be effective tools for nucleic acid detection and sensing. However, existing hydrogel systems for toxin detection still have significant drawbacks: firstly, they are functionally limited, mostly serving only as probe carriers, and cannot meet the detection needs of trace toxins in complex matrices; secondly, their ability and accuracy for simultaneous multi-target detection are limited, making it difficult to simultaneously detect multiple targets, lacking nucleic acid amplification technology, resulting in weak signals, poor anti-interference capabilities, and difficulty in guaranteeing detection accuracy and reliability. Summary of the Invention

[0006] Objectives of the Invention: The first objective of this invention is to provide a photo-driven toxin enrichment composite hydrogel capable of simultaneously enriching and detecting OA and DA in a sample; the second objective of this invention is to provide a method for preparing the photo-driven toxin enrichment composite hydrogel; and the third objective of this invention is to provide applications of the photo-driven toxin enrichment composite hydrogel.

[0007] Technical Solution: The photo-driven toxin enrichment composite hydrogel of the present invention comprises a photo-driven hydrogel and a detection hydrogel; the photo-driven hydrogel is an agarose hydrogel doped with Au@Ag core-shell nanoparticles; the detection hydrogel is a double strand formed by OA-Aptamer and its complementary sequence cDNA, or a double strand formed by DA-Aptamer and its complementary sequence DNAzyme, with a hairpin H1 modified at the 3' end by a quencher group BHQ2, a hairpin H2 modified at the neck by a fluorescent group Cy3, and the ends modified with a fluorescent group FAM and a quencher group BHQ1, respectively. The device consists of a hairpin H3 and a metal-doped agarose hydrogel that catalyzes the cyclic shearing of DNAzyme. Okada acid binds to its aptamer, exposing the sticky ends of cDNA, which then opens hairpin H1. H1 then opens hairpin H2. Alginate binds to its aptamer, exposing the active site of the DNAzyme, which binds to hairpin H3 and shears H3 under the catalysis of metal ions. The double strands are fixed on the hydrogel, while hairpins H1, H2, and H3 are free within the hydrogel. A photothermal driving unit is located above the detection unit.

[0008] Preferably, the sequence (SEQ ID NO.1) of the okadaic acid aptamer is as follows:

[0009] GGTCACCAACAACAGGGAGCGCTACGCGAAGGGTCAATGTGACGTCATGCGGATGTGTGG;

[0010] The cDNA sequence (SEQ ID NO.2) is as follows:

[0011] CTCGAGGAATCGTTGTTGGTGACC;

[0012] The sequence of hairpin H1 (SEQ ID NO.3) is as follows:

[0013] GGTCACCAACAACGATTCCTCGAGCCCAGTCTCGAGGAATCGTTGTTG;

[0014] The hairpin H1 sequence modified with the quenching group BHQ2 at the 3' end is as follows:

[0015] GGTCACCAACAACGATTCCTCGAGCCCAGTCTCGAGGAATCGTTGTTG-BHQ2;

[0016] The sequence of hairpin H2 (SEQ ID NO.4) is as follows:

[0017] CTCGAGGAATCGTTGTTGGTGACCCAACAACGATTCCTCGAGACTGGG;

[0018] The sequence of the hairpin H2 of the neck-modified fluorescent group Cy3 is as follows:

[0019] CTCGAGGAATCGTTGTTGGTGACC-Cy3-CAACAACGATTCCTCGAGACTGGG;

[0020] Preferably, the sequence (SEQ ID NO.5) of the domoic acid aptamer is as follows:

[0021] TTATATTTAATCTCACTTTCTATGATCGTGGTATAATATTAGG;

[0022] The sequence of the DNAzyme (SEQ ID NO.6) is as follows:

[0023] CCTAATATTATCCACGTTCGTATTTACGCAACACTGATCTGGGATAGCTTATCAAGTCAGATTAAATATAA;

[0024] The sequence (SEQ ID NO.7) of hairpin H3 is as follows:

[0025] TTTTTTTTTTTTATGCTCGTTCGTAATGATAAGCTAGTAAATACGAACCTGGATAA.

[0026] The sequence of hairpin H3 modified with the fluorescent group FAM and the quenching group BHQ1 at both ends is as follows:

[0027] TTTTTTTTTT-BHQ1-TTATGCTCGTTCGTAATGATAAGCTA / rA / GTAAATACGAACCTGGATAA-FAM (rA is the cleavage site; DNAzyme cleaves this site, thus separating the fluorescence and quenching group, and restoring fluorescence).

[0028] Preferably, the Au@Ag core-shell nanoparticles have a particle size of 19.58±3.23 nm, and the gold has a particle size of 13.98±1.25 nm.

[0029] The method for preparing the photo-driven toxin enrichment composite hydrogel of the present invention is characterized by comprising the following steps:

[0030] S1. Preparation of photodriven hydrogels

[0031] Agarose was added to water and heated to dissolve it to obtain a hydrogel precursor solution. Then, Au@Ag core-shell nanoparticle solution was mixed with the hydrogel precursor, and after cooling and solidification, a photo-driven hydrogel was formed.

[0032] S2. Preparation of hydrogel for detection

[0033] (1) Add agarose to a buffer solution containing metal ions and heat to dissolve to obtain a hydrogel precursor solution;

[0034] (2) Mix cDNA and carboxyl-modified okadaic acid aptamers with buffer solution respectively, and then incubate the mixture to form okadaic acid aptamer / cDNA double-stranded solution;

[0035] (3) The carboxyl-modified DNAzyme and the domoic acid aptamer were mixed with the buffer solution respectively, and then incubated to form a domoic acid aptamer / DNAzyme double-stranded solution;

[0036] (4) Mix the double-stranded solutions prepared in steps (2) and (3), then add H1, H2 and H3 hairpin DNA in sequence, mix well, and then activate the carboxyl groups on the okada acid aptamer and DNAzyme to obtain DNA precursor solution.

[0037] (5) Mix the hydrogel precursor solution and the DNA precursor solution, and obtain the detection hydrogel after solidification;

[0038] The photo-driven hydrogel synthesized in step S1 is placed on top of the detection hydrogel synthesized in step S2 to obtain the photo-driven toxin enrichment composite hydrogel.

[0039] Preferably, in step S1, the concentration of agarose in the hydrogel precursor solution is 1.6%, the concentration of Au@Ag core-shell nanoparticle solution is 0.2-0.25 µM, and the volume ratio of the two is 1:1.

[0040] Preferably, the concentrations of the okadaic acid aptamer / cDNA double strand, the domucoid aptamer / DNAzyme, H1, H2, and H3 solutions are 90~110 nM, 90~110 nM, 75~85 nM, 75~85 nM, and 130~150 nM, respectively, with a volume ratio of 1:1:1:1:1.

[0041] Preferably, the metal ion is Mg. 2+ The concentration in the hydrogel was 35-45 mM.

[0042] The application of the photo-driven toxin enrichment composite hydrogel described in this invention in the detection of trace amounts of okadaic acid and domoic acid in seafood.

[0043] Preferably, the application method includes the following steps:

[0044] (1) Add the test sample containing okadaic acid and domoic acid to the lower layer of the composite hydrogel, and then apply ultraviolet light to the upper hydrogel to achieve the directional enrichment of the target toxin; after the enrichment is completed, incubate at 40~60℃ for 20~40 min; then detect the fluorescence intensity at 564 nm and 520 nm.

[0045] (2) Calculate the concentrations of okadaic acid and domoic acid in the sample based on the standard curves of fluorescence intensity versus okadaic acid or domoic acid concentrations; where the standard curve of okadaic acid concentration versus fluorescence intensity is y = 3248.979x + 15560.167, and the standard curve of domoic acid concentration versus fluorescence intensity is y = 2679.280x + 11664.583, where x is the concentration of okadaic acid / domoic acid and y is the fluorescence intensity.

[0046] Mechanism of Invention: Light irradiation triggers efficient evaporation of the upper photothermal enrichment hydrogel, driving OA and DA in the sample (seawater or seafood extract) to migrate with the water vapor to the lower detection hydrogel for enrichment. After DNA is activated by carboxyl groups, its surface is modified with NHS ester (-COO-NHS). Subsequently, the hydrogel is simultaneously modified with complementary double strands of cDNA and OA-Aptamer, as well as complementary double strands of DNAzyme and DA-Aptamer, to construct the detection hydrogel. In the presence of OA and DA, when OA is present, it binds to OA-Aptamer, exposing the sticky ends of the cDNA. This opens the hairpin structure H1, which is modified with quenching groups BHQ2 at both ends. This structure then further opens the hairpin structure H2, modified with fluorescent groups Cy3, ultimately forming an ultra-long DNA structure. During this process, the quenching group at the end of H1 and the fluorescent group at the neck of H2 are brought closer together, quenching the fluorescence and reducing the fluorescence of the hydrogel, thus enabling the detection of OA content. DA binds to DA-Aptamer, exposing the active site of the DNAzyme, and then binds to the hairpin structure H3 modified with fluorescent groups FAM and quenching groups BHQ1 at both ends, in Mg 2+ Catalytic cyclic shearing of H3, at which point Mg 2+ Catalyzed by the DNAzyme, the active site of the DNAzyme uncleaves the DNA hairpin H3 embedded in the hydrogel, causing the originally adjacent quenching group and fluorescent group to move away, thus restoring the quenched fluorescence signal and enhancing the DA fluorescence detection signal.

[0047] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) Through the composite system of "upper layer photothermal enrichment + lower layer dual signal detection", the target can be rapidly migrated, enriched and detected in situ under light control, without the need for additional sample pretreatment, thus solving the problem of insufficient sensitivity in the detection of trace toxins in complex matrices; (2) Through the selection of aptamers, the specific detection of various marine toxins can be achieved, and the accuracy and sensitivity of the detection method can be greatly improved by the aid of nucleic acid amplification technology, which is suitable for the detection of ultra-trace amounts of various marine toxins; (3) The present invention converts the content of marine toxins into the fluorescence intensity value of the fluorescence instrument. The detection method is simple and convenient to operate and the detection is rapid. The method uses an enzyme-linked immunosorbent assay (ELISA) reader to detect fluorescence signals. The detection limits of okadaic acid and domoic acid are as low as 0.103 pM and 0.199 pM, respectively, and the linear ranges are 0.1 pM~10 nM and 0.1 pM~100 nM, respectively. Attached Figure Description

[0048] Figure 1 This is a schematic diagram of the composite hydrogel for simultaneous detection of OA and DA by light-controlled driving as described in this invention, wherein (a) is a schematic diagram of the composite hydrogel synthesis mechanism; and (b) is a schematic diagram of the composite hydrogel realizing simultaneous detection of multiple targets.

[0049] Figure 2 The material characterization diagrams for Au NPs are as follows: (a) UV-Vis absorption spectra and corresponding color diagrams of gold nanoparticle solutions after adding sodium citrate solutions of different concentrations; (b) Zeta potential diagrams of gold nanoparticle solutions after adding sodium citrate solutions of different concentrations.

[0050] Figure 3 The images show the morphology and particle size characterization of Au NPs. (af) are transmission electron microscope images and particle size distribution diagrams of Au NPs synthesized by adding different concentrations of sodium citrate, respectively.

[0051] Figure 4 The following are the photothermal characterization diagrams of Au NPs: (a) Thermal imaging of gold nanoparticles of different sizes under laser irradiation during room temperature heating and cooling; (b) Ultraviolet absorption spectrum of Au NPs solution; (c) Temperature change of Au NPs solution during natural cooling after irradiation with a 400 nm laser for 25 minutes; (d) Relationship between cooling time and −ln θ (natural logarithm of temperature driving force under cooling state); (e) Corresponding thermal imaging of Au NPs.

[0052] Figure 5 The following are material characterization diagrams of Au@Ag NPs: (a) UV-Vis absorption spectra and corresponding color diagrams of Au@Ag NPs solutions after adding different concentrations of AgNO3 solution; (b) Zeta potential diagrams of gold nanoparticle solutions after adding different concentrations of AgNO3 solution.

[0053] Figure 6 The images show the morphology and particle size of Au@Ag NPs. (af) are transmission electron microscope images and particle size distribution diagrams of gold and silver nanoparticles synthesized by adding different concentrations of AgNO3, respectively.

[0054] Figure 7 The following are the photothermal performance characterization diagrams of Au@Ag NPs: (a) Thermal imaging of Au@Ag NPs of different sizes under laser irradiation during room temperature heating and cooling; (b) Cyclic heating curve of Au@Ag NPs; (c) Heating and cooling mechanism diagram of Au@Ag NPs; (d) Temperature change diagram of Au@Ag NPs solution during natural cooling after irradiation with a 400 nm laser for 25 minutes; (e) Ultraviolet absorption spectrum of Au@Ag NPs solution; (f) Relationship between cooling time and −ln θ (natural logarithm of temperature driving force under cooling state); (g) Corresponding thermal imaging diagram of Au@Ag NPs.

[0055] Figure 8 Scanning electron microscope images of photothermal responsive hydrogels: (ac) agarose hydrogel image; (bd) light-driven hydrogel image; (e) elemental energy spectrum of photothermal responsive hydrogels.

[0056] Figure 9 The figures show the photoevaporation performance of the photothermally responsive hydrogels. (a) shows the mass change curves of the blank sample, Au NPs, and Au@Ag NPs-doped hydrogels under UV irradiation; (b) shows the evaporation efficiency curves of the blank sample, Au NPs, and Au@Ag NPs-doped hydrogels under UV irradiation; and (c) shows the evaporation rate curves of the blank sample, Au NPs, and Au@Ag NPs-doped hydrogels.

[0057] Figure 10 Optimized diagram for OA detection; (a) OA-Aptamer / cDNA concentration diagram; (b) H1 concentration diagram; (c) H1 to H2 ratio; (d) Mg 2+ (e) Concentration graph; (f) Reaction temperature graph; (g) Reaction time graph;

[0058] Figure 11 Optimized DA detection graph; (a) DA-Aptamer / DNAzyme concentration graph; (b) H3 concentration graph; (c) Mg 2+ (d) Concentration graph; (e) Reaction temperature graph; (d) Reaction time graph;

[0059] Figure 12Scanning electron microscope (SEM) images of Agarose hydrogel and DNA-functionalized hydrogel: (a) and (b) are SEM images of Agarose hydrogel and DNA-functionalized hydrogel at a scale of 500 µm.

[0060] Figure 13 Zeta potential images of agarose hydrogel, DNA, and DNA-functionalized hydrogel;

[0061] Figure 14 The UV-Vis absorption spectra of agarose hydrogel, DNA, and DNA-functionalized hydrogel are shown.

[0062] Figure 15 FT-IR spectra of agarose hydrogel and DNA-functionalized hydrogel;

[0063] Figure 16 Swelling rate diagrams for Agarose hydrogel and DNA-functionalized hydrogel;

[0064] Figure 17 (a) Frequency scan of DNA-functionalized hydrogel; (b) Temperature scan of DNA-functionalized hydrogel.

[0065] Figure 18Agarose gel electrophoresis diagram of OA signal HCR amplification reaction and fluorescence spectrum for feasibility verification: Where (a) is agarose gel electrophoresis diagram, 1 is DNA marker (25-500 bp), 2 is OA-Apt, 3 is cDNA, 4 is H1, 5 is H2, 6 is OA-Apt / cDNA, 7 is OA-Apt / cDNA+OA, 8 is H1+H2, 9 is H1+H2+OA, 10 is OA-Apt / cDNA+H1+H2, 11 is OA-Apt / cDNA+H1+H2+OA (low concentration), 12 is OA-Apt / cDNA+H1+H2+OA (high concentration), 13 is DNA marker (25-500 bp). (a) is the fluorescence spectrum of Blank, OA-Apt, cDNA, H1, H2, OA-Apt / cDNA, H1+H2, OA-Apt / cDNA+H1+H2, and OA-Apt / cDNA+H1+H2+OA;

[0066] Figure 19 The agarose gel electrophoresis diagram and fluorescence spectrum for feasibility verification of the DNAzyme cleavage amplification reaction of the DA signal are shown below: (a) is the agarose gel electrophoresis diagram, where 1 is the DNA marker (25-500 bp), 2 is DA-Apt, 3 is DNAzyme, 4 is H3, 5 is DA-Apt / DNAzyme, 6 is DA-Apt / DNAzyme+DA, 7 is DA-Apt / DNAzyme+DA+H3, 8 is DA-Apt / DNAzyme+DA+H3, and 9 is DA-Apt / DNAzyme+DA+H3+Mg. 2+ , 10 is DNA marker (25-500 bp); (b) is Blank, DA-Apt, DNAzyme, H3, DNAzyme / DA-Apt, DNAzyme / DA-Apt+H3, DNAzyme / DA-Apt+H3+DA, DNAzyme / DA-Apt+H3+DA+Mg 2+ Fluorescence spectrum;

[0067] Figure 20 For the calibration curves of (a) OA at different concentrations, recorded at 564 nm; and (b) DA at different concentrations, recorded at 520 nm.

[0068] Figure 21 Specificity graphs for the developed OA and DA detection methods;

[0069] Figure 22 Stability plots for the developed OA and DA detection methods. Detailed Implementation

[0070] The technical solution of the present invention will be further described below with reference to the embodiments.

[0071] Example 1

[0072] Preparation of Au@Ag core-shell nanoparticle solution:

[0073] S1. Using the Turkevich method, add 1 mL of 1% chloroauric acid solution and 99 mL of deionized water to a three-necked flask, place it in an oil bath at 140°C for reflux heating and stirring; after the solution boils, add 0.25 mM, 0.5 mM, 0.75 mM, 1 mM, 1.25 mM, and 1.5 mM sodium citrate solutions respectively, and continue heating and stirring at 140°C for 10-15 min until the solution turns wine red; stop heating, continue stirring until the system cools to room temperature to obtain Au NPs solution, and store it at 4°C for later use.

[0074] S2. Take the Au NPs solution obtained in step S1 and vortex mix it with 0.5 mL of 0.1 mol / L ascorbic acid solution. Then slowly add AgNO3 solutions with concentrations of 50 µM, 100 µM, 150 µM, 200 µM, 250 µM, and 300 µM, respectively. After stirring for 30 min, centrifuge at 5000 rpm for 10 min. Repeat the centrifugation operation 3 times to purify the product. Redissolve the centrifuged precipitate in 10 mL of deionized water to obtain Au@Ag core-shell nanoparticle solution, and store it at 4℃ in the dark.

[0075] Figure 2 This is a material characterization diagram of Au NPs; Figure 2(a) shows the UV-Vis absorption spectra of Au NPs with different particle sizes: As shown in (a), the characteristic absorption peak near 520 nm is the plasmon resonance UV absorption characteristic peak of Au NPs. The shape and position of this absorption peak significantly depend on the particle size, dispersion characteristics, and particle morphology of the Au NPs. When using sodium citrate as a reducing agent to prepare Au NPs, the maximum UV absorption peak positions appeared sequentially at 536 nm, 522 nm, 518 nm, 517 nm, 517 nm, and 517 nm. Experimental results show that with the increase of sodium citrate dosage, the maximum absorption wavelength exhibits a blue shift (moving towards shorter wavelengths); when the sodium citrate dosage reaches a critical value, the position of the maximum UV absorption peak of Au NPs tends to stabilize and no longer shifts. The appearance of this characteristic absorption peak and the regular change in wavelength with the amount of sodium citrate not only directly confirmed the successful synthesis of the target Au NPs, but also laid the material basis for subsequent systematic research on photothermal properties because the nano-gold samples corresponding to different absorption peaks have different structural characteristics (particle size, dispersibility, etc.). Figure 2 (b) The Zeta potential test results of gold nanoparticles synthesized under different concentrations of sodium citrate show that the Zeta potential of all samples is negative. With increasing sodium citrate concentration, the absolute value of the Zeta potential gradually increases (i.e., the potential becomes more negative); when the sodium citrate concentration reaches a certain threshold, the Zeta potential no longer changes significantly. This result not only confirms that sodium citrate successfully adsorbs and modifies the surface of Au NPs, endowing the particles with a stable negative surface charge, but also corroborates the successful synthesis of Au NPs from the perspective of surface charge regulation. Furthermore, it indicates that the modification effect of sodium citrate on the surface charge of Au NPs has a clear saturation characteristic, providing experimental basis for subsequent regulation of particle dispersion stability and structural properties.

[0076] Figure 3 The images show TEM images of gold particles with different sizes obtained with sodium citrate concentrations ranging from 0.25 mM to 1.5 mM. (af) The particle sizes are 62.56 nm, 26.22 nm, 16.16 nm, 14.34 nm, 13.98 nm, and 13.16 nm, respectively. As the amount of sodium citrate increases, the diameter of the Au NPs gradually decreases, and the measured UV-Vis absorption peaks of the Au NPs gradually shift towards shorter wavelengths, which is consistent with the theoretical results.

[0077] Figure 4 The image shows the photothermal performance characterization of Au NPs. To investigate the feasibility of Au NPs as a photothermal material, the photothermal conversion efficiency (η) of Au NPs nanoparticles is evaluated using the following formula:

[0078] (1) ;

[0079] (2) ;

[0080] (3) ;

[0081] Where h is the heat transfer coefficient, A is the surface area of ​​the container, A is the absorbance of the material in the aqueous solution at a wavelength of 520 nm, Tmax is the maximum solution temperature, Tsur is the ambient temperature, and hA is calculated by analyzing the linear relationship between time and -lnθ through the cooling curve of the nanoparticles, and the photothermal conversion efficiency η is calculated according to formulas (1)-(3). i The mass of each component in the solution system is denoted as C. Since the mass of the solvent is much greater than the mass of the solute, this is recorded as the mass of the solvent, i.e., the mass of water. p,j Let be the specific heat capacity of each component in the solution system, which in this case is the specific heat capacity of water, 4.2 (J·g). -1 ·℃ -1 ).

[0082] Figure 4 (a) shows the temperature rise and fall curves of gold with different particle sizes after 25 min of UV exposure. As can be seen from the figure, the addition of 1.25 mM sodium citrate resulted in the best photothermal effect for Au NPs with a particle size of around 13.98 nm, with a temperature increase of 17.93 °C (photoelectric power of 142% W / m). 2 ). Figure 4 (b) shows the absorbance of the optimal photothermal Au NPs at 517 nm, which is 0.534. (c) shows the temperature change over time for the optimal photothermal Au NPs. The ambient temperature was 23.2℃, and after deducting the ambient temperature, the temperature increased by a maximum of about 30℃. Figure 4 (d) is a graph showing the relationship between cooling time and −ln θ (the natural logarithm of the temperature driving force under cooling conditions). Based on the formula, the photothermal conversion efficiency can be calculated to be 36.7%. Figure 4 (e) shows the infrared thermal images of the 1.25 mM Au NPs sample during the photothermal process (highest and lowest temperature states) (23.20℃ at 0 min, 52.63℃ at 25 min, and 27.8℃ at 50 min), which intuitively presents its temperature change characteristics.

[0083] Figure 5 This is a material characterization diagram of Au@Ag NPs. Figure 5(a) shows the UV-Vis absorption spectra of Au@Ag NPs with different core-shell sizes: with increasing AgNO3 dosage (Ag shell thickness), the characteristic absorption peak of the system gradually blue-shifts from 520 nm at the Au core to 400 nm—this 400 nm absorption peak is the characteristic peak of localized surface plasmon resonance (LSPR) of Au@Ag NPs, and its peak position shift is directly related to the formation of the core-shell structure and the control of shell thickness, confirming the successful synthesis of the Au@Ag core-shell structure. Meanwhile, the high extinction properties of the silver-based material significantly enhance the absorption intensity of Au@Ag NPs, demonstrating the optical enhancement effect of the core-shell structure. Figure 5 The Zeta potential results in (b) show that both the Au core and Au@Ag NPs with different Ag shell thicknesses exhibit negative potentials, and the absolute value of the Zeta potential does not fluctuate significantly with increasing AgNO3 dosage (remaining at a similar level). This phenomenon indicates that the surface charge characteristics of the system remain stable during Ag shell growth, further confirming the uniform deposition of Ag on the Au core surface (without aggregation of independent Ag particles), while ensuring the dispersion stability of Au@Ag NPs.

[0084] Figure 6 The transmission electron microscopy (TEM) morphology and particle size distribution of Au@Ag NPs under different AgNO3 concentrations were presented: at an AgNO3 concentration of 50 µM (… Figure 6 a) 100 µM ( Figure 6 b) 150 µM ( Figure 6 c) 200 µM ( Figure 6 d) and 250 µM ( Figure 6 e) As the amount of AgNO3 increases, the core-shell structure of the particles in the TEM image gradually becomes clearer, the shell thickness continues to increase, and the corresponding particle size distribution also shows a regular expansion (the particle size is concentrated at about 14 nm at 50 µM, about 15 nm at 100 µM, about 16 nm at 150 µM, about 18 nm at 200 µM, and about 20 nm at 250 µM). This phenomenon confirms that AgNO3... + It can stably deposit on the surface of Au cores, achieving controllable adjustment of core-shell thickness, and the particles at a concentration of 250 µM still maintain good dispersion and a regular core-shell structure. However, when the AgNO3 concentration is further increased to 300 µM ( Figure 6 In step f), significant particle aggregation appears in the TEM image, with a broadened particle size distribution (dispersed to around 30 nm) and blurred core-shell structure boundaries—this is due to excess Ag. +The reduction rate of Ag is much higher than its deposition rate on the Au core surface, resulting in the generation and aggregation of a large number of free Ag particles, which disrupts the orderliness of the core-shell structure and ultimately leads to a decrease in the uniformity of the shell thickness.

[0085] Figure 7 The photothermal properties and related characterization results of Au@Ag NPs are as follows: Figure 7 (a) shows the photothermal heating-cooling curves under 400 nm ultraviolet laser irradiation. The results show that the sample corresponding to 250 µM AgNO3 has the best photothermal effect, with a temperature rise of 35.7℃. Figure 7 (b) The four heating and cooling cycle curves are basically consistent, which confirms that the sample has good photothermal cycling stability. Figure 7 The heating mechanism diagram in (c) clearly shows that its photothermal effect originates from the localized surface plasmon resonance (LSPR) effect of the core-shell structure—particles absorb photons under laser irradiation and convert them into heat energy to achieve a temperature increase; after irradiation stops, the heat energy diffuses into the environment, causing the temperature to drop. Combined with the test results of the UV-Vis spectrophotometer (the absorbance of the 250 µM sample at the UV excitation wavelength is 1.732, and the optical power density is 142 W / m²), the photothermal conversion efficiency η of the sample is calculated to be 77.14% using formulas (1)-(3), further confirming its excellent photothermal performance; and Figure 7 The infrared thermal image (g) visually presents the temperature change process of the sample (23.50℃ at 0 min, 74.93℃ at 25 min, and 28.87℃ at 50 min), which corresponds to the curve trend in Figure 7(a), and visually verifies its photothermal response characteristics.

[0086] Example 2

[0087] Photodriven hydrogel preparation:

[0088] A 1.6 wt% agarose solution was heated to boiling in a microwave oven to obtain a hydrogel precursor solution. The Au@Ag core-shell nanoparticle solution (particle size 19.58 nm, concentration 250 µM) prepared in Example 1 was then mixed with the 1.6% agarose solution at a volume ratio of 1:1. After thorough mixing, the mixture was allowed to stand for 10 min and then refrigerated for 12 h. Upon cooling, a 1 cm³ hydrogel with optimized pore structure and uniform dispersion of Au@Ag elements was formed. 3 Cylindrical light-driven hydrogel (η=77.14%).

[0089] Figure 8 The following are the scanning electron microscopy (SEM) and energy dispersive spectroscopy (EDS) characterization results of agarose hydrogels before and after Au@Ag NPs doping: Figure 8 (a) and (c) are SEM images of pure agarose hydrogels. Figure 8(b) and (d) show the morphology of the photothermal hydrogel after doping with Au@Ag NPs. As can be seen from the comparison, the pore size of the hydrogel is significantly increased after doping. This change stems from the fact that Au@Ag NPs, acting as "space-occupying units," are embedded in the network structure of agarose molecules during the hydrogel crosslinking process, hindering the excessively tight crosslinking of agarose molecular chains. Simultaneously, the interaction between the particles and the gel matrix alters the arrangement of the molecular chains, ultimately expanding the pore structure of the gel network. This increased pore size not only improves the swelling performance and mass transport efficiency of the hydrogel but also provides more ample loading space for the photothermal particles, facilitating the uniform release and transfer of their photothermal effects. Figure 8 The EDS elemental distribution diagram in (e) further confirms that Au and Ag elements exhibit uniform distribution characteristics in the hydrogel matrix (corresponding to the blue-green signal of Au and the red signal of Ag in the figure). At the same time, characteristic elemental signals of the hydrogel matrix such as C and O can be observed, indicating that Au@Ag NPs have been successfully and uniformly loaded in the hydrogel system. Combined with the above optimization of the pore structure, it provides a dual structural and material basis for the efficient performance of the photothermal properties of the hydrogel.

[0090] Figure 9 The mass change Δm, evaporation efficiency Re, and evaporation rate η of blank agarose hydrogel, Au NPs-doped hydrogel (hydrogel prepared by mixing Au NPs solution and 1.6% agarose solution at a volume ratio of 1:1, with Au particle size of 13.98 nm and concentration of 1.25 mM in the Au NPs solution), and Au@Ag NPs photothermal hydrogel under 15 A xenon lamp irradiation are calculated using the following formulas:

[0091] (4) ;

[0092] (5) ;

[0093] (6) ;

[0094] Where Δm is the change in mass per unit area (kg·m²) -2 The expression represents the mass change of the hydrogel under light-driven conditions, where m2 is the mass of the hydrogel before light exposure, m1 is the mass of the hydrogel after light exposure, A is the area of ​​the hydrogel, Re is the evaporation rate of the hydrogel, Δt is the evaporation time, and η is the evaporation efficiency of the hydrogel. 初 W represents the initial water content of the solution. 终 This represents the final moisture content after evaporation.

[0095] Figure 9 The image shows the photoevaporation properties of the photothermally responsive hydrogel. Figure 9(a) is the mass change curve of the hydrogel under ultraviolet irradiation. As the irradiation time increases, the mass change of Au@Ag NPs photothermal hydrogel is significantly greater than that of other samples, which shows that it has a stronger water migration ability driven by photothermal. This is due to the efficient photothermal effect of Au@Ag accelerating water vaporization, which lays the power foundation for the active transport system of "upper photothermal gel driving lower gel absorption". Figure 9 (b) shows that the evaporation efficiency of Au@Ag NPs photothermal gel is much higher than that of the control sample. Combined with the initial water content, it can be seen that its water evaporates more fully, which further confirms the high efficiency of photothermal-driven water migration. Figure 9 The evaporation rate in (c) indicates that the Au@Ag NPs photothermal hydrogel consistently exhibits a higher and more stable evaporation rate. This characteristic drives the evaporation of water vapor from the upper photothermal hydrogel, promoting the migration of the solution to the lower detection hydrogel, thus enabling the active transport and enrichment of target substances such as marine toxins, providing a feasible basis for subsequent detection. In summary, the excellent evaporation performance of the Au@Ag NPs photodriven hydrogel supports the design of a "photothermal-driven - active transport - detection and enrichment" system.

[0096] Example 3

[0097] OA detection optimization: Using a pipette, a certain amount of OA-Aptamer, OA-cDNA, H1, and H2 were pipetted and a 10 μM stock solution was prepared with enzyme-free ultrapure water. The solution was aliquoted and stored at -20°C. Before use, it was thawed and mixed at room temperature. Mg2+ was prepared based on Tris-HCl buffer. 2+ A series of buffer solutions with concentrations of 20, 30, 40, 50, and 60 mM were prepared. 0.001 g of EDC and NHS powder were dissolved in 50 μL of enzyme-free ultrapure water to prepare 20 mg / mL fresh solutions. OA standard was dissolved in methanol and diluted to a 1 nM stock solution. In the optimization phase, a single-factor variable method was used, fixing the initial levels of other parameters (OA-Aptamer / cDNA = 80 nM, H1 = 60 nM, H1:H2 = 1:1, Mg...). 2+=20 mM, temperature=30℃, time=30 min), each parameter has 3 parallel samples: When optimizing the OA-Aptamer / cDNA concentration, take 50 μL of serial concentration of OA-Aptamer and the same concentration of OA-cDNA, incubate at 37℃ for 30 min to form double strands, then add H1 and H2, and weigh the corresponding mass of agarose, dissolve in Tris-HCl buffer to prepare 0.8% agarose suspension, heat to dissolve, mix with the above solution and solidify, add 60 μL of 1 nM OA, incubate at room temperature for 30 min, and then detect the fluorescence intensity at 564 nm using a microplate reader; the H1 concentration optimization is carried out in the same way, only changing the H1 and H2 concentrations (keeping the ratio 1:1); the H1 and H2 ratio optimization fixes the total concentration of the two and adjusts the volume ratio to 3:1, 2:1, 1:1, 1:2, 1:3; Mg 2+ Concentration optimization involves replacing the agarose solvent with different Mg... 2+ The concentration of Tris-HCl buffer was adjusted, and the incubation temperature was optimized (40, 50, 60, 70, 80℃). The reaction time was optimized (20, 30, 40, 50, 60 min), with fluorescence intensity as the indicator to screen for the optimal value. For validation of the optimal conditions, the screened parameters (OA-Aptamer / cDNA = 100 nM, H1 = H2 = 80 nM, H1:H2 = 1:1, Mg...) were used. 2+ Repeat the above procedure (40 mM, temperature 60℃, time 40 min), setting up blank controls and standard controls to ensure that the fluorescence detection RSD is ≤5%.

[0098] The sequences of cDNA, carboxylated OA-Aptamer, H1 modified with BHQ2, and H2 modified with Cy3 are shown in Table 1. All were synthesized by Shanghai Sangon Biotech Co., Ltd. All DNA samples were heated at 95°C for 5 min and then cooled at room temperature for 3 h to allow for stable DNA structure formation before subsequent dilution.

[0099] Table 1 Nucleic acid sequences corresponding to HCR reactions

[0100] name sequence cDNA 5'-CTCGAGGAATCGTTGTTGGTGACC-3' Carboxylated OA-Aptamer 5'-COOH-GGTCACCAACAACAGGGAGCGCTACGCGAAGGGTCAATGTGACGTCATGCGGATGTGTGG-3' H1 that modifies BHQ2 5'-GGTCACCAACAACGATTCCTCGAGCCCAGTCTCGAGGAATCGTTGTTG-BHQ2-3' H2 that modifies Cy3 CTCGAGGAATCGTTGTTGGTGACC-Cy3-CAACAACGATTCCTCGAGACTGGG

[0101] Figure 10 This is an optimized diagram for OA detection. It shows the concentration of OA-Aptamer / cDNA, the concentration of H1, the ratio of H1 to H2, and Mg. 2+ The concentration of OA-Aptamer / cDNA, the HCR reaction temperature, and the HCR reaction time are all optimized, which have a key impact on the detection performance of OA. The concentrations of OA-Aptamer / cDNA (60, 80, 100, 120, 140 nM) were optimized. Figure 10(a) The highest fluorescence intensity was obtained at a concentration of 100 nM OA-Aptamer / cDNA because the reaction reaches equilibrium at 100 nM, and excess OA-Aptamer / cDNA remains in the nucleic acid modification solution and cannot participate in subsequent analyte sensing. Therefore, a concentration of 100 nM OA-Aptamer was ultimately selected as the optimal reaction condition. The concentrations of hairpin H1 (40, 60, 80, 100, 120 nM) were optimized. Figure 10 (b) shows that H1 obtained the highest fluorescence intensity at a concentration of 80 nM. This is because the reaction reaches equilibrium when the concentration reaches 80 nM. Excess H1 does not participate in the HCR reaction or ineffectively consumes the initiating strand cDNA and is not used for subsequent analyte sensing. Therefore, an H1 concentration of 80 nM was ultimately selected as the optimal reaction condition. Figure 10 (c) The ratios of H1 and H2 in the hairpin (3:1, 2:1, 1:1, 1:2, 1:3) were optimized. A 1:1 ratio resulted in equilibrium, where H1 and H2 could alternately and efficiently participate in chain extension, forming a long and stable HCR polymer. Excessive H1 or H2 could reduce signal amplification efficiency or lead to excessively high background signal. Therefore, a 1:1 ratio of H1 to H2 was chosen as the optimal reaction condition. (Regarding Mg...) 2+ The concentrations (20, 30, 40, 50, 60 mM) were optimized. Figure 10 As shown in (d), in Mg 2+ The fluorescence intensity reached its peak at a concentration of 40 mM, but to maintain both amplification reactions, 40 mM was chosen as the concentration of Mg. 2+ The optimal concentration and HCR reaction temperature (40, 50, 60, 70, 80℃) were determined. Figure 10 As shown in (e), 60℃ is the peak temperature for the HCR reaction. Excessively high temperatures can affect the reaction process between H1 and H2; therefore, 60℃ is chosen as the optimal condition for the HCR reaction. The HCR reaction time (20, 30, 40, 50, 60 min) was optimized. Figure 10 As shown in (f), the reaction tends to reach equilibrium at 40 min, and the HCR reaction reaches equilibrium. In order to save detection time, 40 min is selected as the optimal HCR reaction time.

[0102] Example 4

[0103] DA assay optimization: Using a pipette, a certain amount of DA-Aptamer, DNAzyme, and H3 was pipetted and a 10 μM stock solution was prepared with enzyme-free ultrapure water. The solution was aliquoted and stored at -20°C. Before use, it was thawed and mixed at room temperature. Mg2+ was prepared based on Tris-HCl buffer. 2+A series of buffer solutions with concentrations of 20, 30, 40, 50, and 60 mM were prepared; 0.001 g of EDC and NHS powder were dissolved in 50 μL of enzyme-free ultrapure water to prepare a 20 mg / mL fresh solution; DA standard was dissolved in methanol and diluted to a 1 nM stock solution.

[0104] The optimization phase employed a single-factor variable method, fixing the initial levels of other parameters (DNAzyme / DA-Aptamer = 80 nM, H3 = 100 nM, Mg...). 2+ =30 mM, DNAzyme shearing temperature=40℃, time=30 min), with 3 replicates for each parameter: When optimizing the DNAzyme / DA-Aptamer concentration, 50 μL of a series of concentrations (2.4, 3.2, 4.0, 4.8, 5.6 μM) of DNAzyme was mixed with the same concentration of DA-Aptamer, 100 μL of buffer was added, and the mixture was incubated at 37℃ for 30 min to form a complex. After adding H3, the corresponding mass of agarose was weighed and dissolved in Tris-HCl buffer to prepare a 0.8% agarose suspension. After heating to dissolve, the suspension was mixed with the above solution and solidified. Then, 60 μL of 1 nM DA was added, and the suspension was incubated at room temperature for 30 min. The fluorescence intensity was detected using a microplate reader. The H3 concentration optimization was performed using the same procedure, only the H3 concentration was changed (setting gradients of 80, 100, 120, 140, 160 nM). Mg 2+ Concentration optimization involves replacing the agarose solvent with different Mg... 2+ The optimal concentration of Tris-HCl buffer was selected based on fluorescence intensity. The incubation temperature for the DNAzyme cleavage reaction was optimized by adjusting the incubation temperature (30, 40, 50, 60, 70℃), and the reaction time was optimized by changing the reaction duration (20, 30, 40, 50, 60 min). Optimal conditions were validated using the selected parameters (DNAzyme / DA-Aptamer = 120 nM, H3 = 140 nM, Mg...). 2+(40 mM, DNAzyme shearing temperature = 40℃, time = 40 min) Repeat the above procedure, set up blank control and standard control, and ensure that the fluorescence detection RSD ≤ 5%. Finally, the optimal conditions were used to prepare the nucleic acid-modified hydrogel: 50 μL of 4 μM DA-APT and 50 μL of 4 μM DNAzyme, and 50 μL of 4 μM OA-APT and 50 μL of 4 μM OA-cDNA were incubated at 37℃ for 30 min, respectively. After mixing, 50 μL of 5.6 μM H3, 50 μL of 3.2 μM H1, and 50 μL of 3.2 μM H2 were added, followed by 50 μL of EDC and activation at 25℃ for 30 min. Then, 50 μL of NHS was added and the mixture was shaken for 5 min. The activated system was then added to 150 μL of 0.8% agarose suspension and incubated overnight at 4℃. 1.35 mL of 1% agarose suspension was added to solidify the mixture. After standing at room temperature for 5 min, the mixture was frozen at -20℃ and finally freeze-dried to obtain the sample. Throughout the experiment, care must be taken to avoid repeated freeze-thaw cycles of the nucleic acid stock solution, ensure precise pipetting, promptly detect the signal after the DNAzyme shearing reaction, and prepare and use EDC and NHS solutions immediately. Temperature adjustments must be made while considering the compatibility of the two systems. The sequences of the DA-DNAzyme and the H3 of BHQ1 at the ends of the carboxylated DA-Aptamer are shown in Table 2, and both were synthesized by Shanghai Sangon Biotech Co., Ltd. All DNA samples were heated at 95°C for 5 min and then cooled at room temperature for 3 h to allow the DNA to stabilize for subsequent dilution.

[0105] Table 2 Nucleic acid sequences corresponding to DNAzyme cycle cleavage

[0106] name sequence DA-Aptamer 5'-TTATATTTAATCTCACTTTCTATGATCGTGGTATAATATTAGG-3' Carboxylated DNAzyme 5'-COOH-CCTAATATTATCCACGTTCGTATTTACGCAACACTGATCTGGGATAGCTTATCAAGTCAGATTAAATATAA-3' H3 at both ends are FAM and BHQ1 respectively TTTTTTTTTT-BHQ1-TTATGCTCGTTCGTAATGATAAGCTA / rA / GTAAATACGAACCTGGATAA-FAM

[0107] Figure 11 This is an optimized graph for DA detection. It shows the concentrations of DA-Aptamer, H3, and Mg. 2+ The concentration, DNAzyme cleavage reaction temperature, and DNAzyme cleavage reaction time optimization all have a crucial impact on DA detection performance. Figure 11 (a) The concentrations of DNAzyme / Aptamer (60, 80, 100, 120, 140 nM) were optimized. When the reaction reached equilibrium, the excess DNAzyme / Aptamer remained in the nucleic acid modification solution and could not participate in the subsequent analyte sensing. The signal reached the plateau, indicating that the concentration of 120 nM DNAzyme / Aptamer was the optimal concentration. Figure 11(b) The concentrations of H3 (80, 100, 120, 140, 160 nM) were optimized. When the H3 concentration was 140 nM, the reaction reached equilibrium. Due to steric hindrance, excess H3 could not approach the magnetic nanoprobe and failed to participate in the reaction. Therefore, 140 nM was chosen as the optimal concentration of H3. (Regarding Mg...) 2+ The concentrations (20, 30, 40, 50, 60 mM) were optimized. Figure 11 (c) Shows 40 mM as Mg 2+ The optimal concentration was determined. The DNAzyme cleavage reaction temperature (30, 40, 50, 60, 70 °C) was optimized. Figure 11 (d) shows that 60℃ is the optimal reaction temperature for DNAzyme cleavage. This is because temperature affects the binding efficiency of DNAzyme to substrate H3, but considering the binding of both systems, a subsequent temperature of 40℃ was chosen. The DNAzyme cleavage reaction time (20, 30, 40, 50, 60 min) was optimized, and the reaction reached equilibrium at 40 min. Figure 11 (e) shows that 40 min is the optimal temperature for DNAzyme cleavage reaction.

[0108] Example 5

[0109] Preparation of photo-driven toxin enrichment composite hydrogel:

[0110] S1, Preparation of DNA Precursor Solution

[0111] (1) Prepare a 4 μM DNA solution by mixing cDNA and carboxylated OA-Aptamer with Tris buffer, wherein the volume ratio of carboxylated OA-Aptamer to cDNA is 1:1. Then mix and incubate at 37°C for 30 min to form a double-stranded solution.

[0112] (2) Prepare a 4 μM DNA solution by mixing DA-DNAzyme and carboxylated DA-Aptamer with Tris buffer, wherein the volume ratio of DA-Aptamer to carboxylated DA-DNAzyme is 1:1. Then mix and incubate at 37°C for 30 min to form a double-stranded solution.

[0113] (3) Mix the double-stranded solutions from steps (1) and (2) at a volume ratio of 1:1. Then, add hairpin DNA modified with BHQ2, modified with Cy3, and with FAM and BHQ1 at both ends respectively at a volume ratio of 1:1:1:1. The concentrations are 3.2 μM, 3.2 μM, and 5.6 μM, respectively. Finally, add a mixed solution of EDC and NHS at a volume ratio of 1:1 (EDC and NHS are mixed at a volume ratio of 1:1, and the concentrations of EDC and NHS are both 20 mg / mL). React at 37℃ for 30 min to obtain the DNA precursor solution.

[0114] The sequences of cDNA, carboxylated OA-Aptamer, DA-DNAzyme, H1 of BHQ2 modified by carboxylated DA-Aptamer, H2 of Cy3 modified by carboxylated DA-Aptamer, and H3 of FAM and BHQ1 at both ends are the same as those in Tables 1 and 2.

[0115] S2, precursor solution for synthesizing hydrogel

[0116] Dissolve agarose in 40 mM Mg 2+ A 0.8 wt% agarose solution was prepared in Tris buffer solution; then the solution was heated to boiling in a microwave for 10 s and then removed to obtain the agarose hydrogel precursor solution.

[0117] S3. Preparation of detection hydrogel (DNA-functionalized hydrogel)

[0118] Add 25 µL of the DNA precursor solution from S1 to each well of the microplate, followed immediately by 75 µL of the 0.8% agarose solution prepared in S2. Incubate at room temperature for 5 min, then incubate overnight at 4°C to obtain 0.1 cm⁻¹ DNA. 3 Cylindrical detection hydrogel.

[0119] S4, Composite Hydrogel Assembly

[0120] The photo-driven hydrogel prepared in Example 2 and the detection hydrogel obtained in step S3 were placed sequentially in a 48-well plate, with the photo-driven hydrogel placed on top of the detection hydrogel, forming a photo-driven toxin enrichment composite hydrogel with a composite structure of "upper layer photothermal driving unit - lower layer detection functional unit". When in use, the detection hydrogel is immersed in the test solution, while the photo-driven hydrogel is not immersed in the test solution.

[0121] Figure 12These are scanning electron microscope (SEM) images of agarose hydrogel (a) and DNA-functionalized hydrogel (b) at a scale of 500 µm. As can be observed from the images, the pore structure of pure agarose gel is relatively loose, with an average pore size of about 199 µm; while the pore size of the agarose gel loaded with DNA is significantly reduced, with an average pore size of about 79 µm, indicating that DNA molecules successfully filled the three-dimensional network structure of the agarose gel.

[0122] Figure 13 The diagram shows the zeta potentials of agarose hydrogel, DNA precursor solution, and DNA-functionalized hydrogel: the agarose hydrogel alone is negatively charged (-5 to -7 mV), the DNA nucleic acid chain is negatively charged, and the potential of the combination of the two is the lowest compared to the former two, proving that the DNA has been modified into the hydrogel.

[0123] Figure 14 The UV-Vis absorption spectra of agarose hydrogel, DNA, and DNA-functionalized hydrogel are shown. The hydrogel itself does not have a significant absorption peak at 260 nm, but after DNA modification, a significant UV characteristic peak appears at 260 nm, further proving that OA-Aptamer / cDNA and DA-Aptamer / DNAzyme were successfully modified onto the hydrogel material.

[0124] Figure 15 These are the FT-IR spectra of agarose hydrogel and DNA-functionalized hydrogel, with the agarose hydrogel and DNA-functionalized hydrogel at 3277 cm⁻¹. -1 and 1034 cm -1 The infrared characteristic peaks at 1738 cm⁻¹ exhibit OH and CO vibrations, respectively. DNA-functionalized hydrogels show these peaks at 1738 cm⁻¹. -1 The presence of C=O stretching vibration at the point of origin confirms the successful binding of the nucleic acid capture probe to the agarose hydrogel, indicating successful DNA modification.

[0125] Figure 16The swelling rates of agarose hydrogel and DNA-functionalized hydrogel were compared: the results showed that the swelling rate of DNA-functionalized hydrogel was significantly lower than that of pure agarose, with a decrease of approximately 50%, consistent with the nanoscale densification observed by SEM. The swelling rate was faster in the initial stage (0-10 h), indicating that the macroporous structure still allowed for rapid water molecule penetration; the swelling rate tended to level off in the later stage (10-48 h), reflecting the inhibitory effect of the DNA cross-linking network on swelling.

[0126] Figure 17 Frequency (a) and temperature (b) scans of the DNA-functionalized hydrogel were performed under constant strain conditions of 1%, with frequency scans ranging from 0.1 to 100 Hz and temperature scans ranging from 20°C to 80°C to evaluate the stability of the DNA-functionalized hydrogel. The oscillation frequency test results showed that... Figure 17 In (a), G' is always higher than G'' in the DNA-functionalized hydrogel, indicating that the material is dominated by elastic behavior and forms a stable three-dimensional network structure. G' and G'' increase with frequency but have no intersection point, indicating that DNA cross-linking enhances the mechanical stability and rigidity of the gel, which is consistent with the nanoscale densification observed by SEM. Figure 17 (b) During the heating process, the G' of the DNA-functionalized hydrogel showed a typical non-linear decreasing trend with increasing temperature. The modulus remained relatively stable in the initial stage, and a significant turning point occurred when the temperature reached the critical range, but G' > G'' was always present, indicating that it remained in a gel state between 25-80℃. Therefore, the DNA-functionalized hydrogel is consistent with this experiment.

[0127] Example 6

[0128] The feasibility of the two amplification methods, HCR reaction and DNAzyme cycle shearing, was verified by combining fluorescence spectroscopy and agarose gel electrophoresis.

[0129] Figure 18(a) is an agarose gel electrophoresis diagram of the OA signal HCR amplification reaction. Lanes 1 to 5 are for DNA marker, OA-aptamer, cDNA, H1, and H2, respectively. After the OA aptamer hybridizes with the cDNA, a new band at a higher position appears in lane 6, indicating the formation of a larger molecular weight dsDNA. When OA is added, the aptamer can hybridize with OA, leading to the release of cDNA. A lighter dsDNA band is observed in lane 7, providing evidence of the OA response to the aptamer. Lane 8 shows H1 and H2. In the absence of OA, there is no interaction between H1 and H2, resulting in a stronger intensity observed in the corresponding bands than in lanes 4 and 5 (lane 8). Lane 9 shows no significant change in intensity after the addition of OA compared to lane 8, indicating no nonspecific interaction between H1 and H2. In lane 10, it can be seen that dsDNA does not react with H1 and H2 without the addition of OA. In lane 11, it was observed that when OA was added, the aptamer hybridized with OA, the dsDNA band became lighter, the aptamer was competitively removed by the target substance, and cDNA was released. The cDNA then opened the DNA hairpin H1 embedded inside the hydrogel, and the end of H1 then opened hairpin H2. Subsequently, H2 opened H1, ultimately forming an ultra-long DNA structure. In lane 12, the concentration of OA added was higher than in lane 11, and the electrophoresis image showed that the final DNA structure formed was even longer. Figure 18 (b) is the fluorescence spectrum of the OA signal HCR amplification reaction, which verifies the quenching effect of the fluorescent group Cy3 and the quenching group BHQ2 in the HCR reaction. As can be seen from the figure, OA-Aptamer, cDNA, and H1 are not modified with any fluorescent groups, so there is no fluorescence intensity. Therefore, OA-Aptamer / cDNA also has no fluorescence signal. However, due to the modification of Cy3 on H2, the fluorescence intensity of pure H2 solution reaches the strongest at 564 nm. After adding H1 and H2 at the same time, its fluorescence intensity decreases slightly, indicating that H1 and H2 have some slight non-specific amplification. When OA-Aptamer / cDNA is added to the H1+H2 solution, the solution is slightly quenched. However, after the toxin is added, the aptamer can hybridize with OA. The aptamer is competed for by the target and releases cDNA. The cDNA opens H1, and the end of H1 opens the hairpin H2. Then H2 opens H1. The distance between the fluorescent group and the quenching group becomes closer, and the fluorescence decreases significantly. In conclusion, both methods demonstrate the feasibility of the HCR reaction.

[0130] Figure 19Lane a is an agarose gel electrophoresis image of the DNAzyme cleavage amplification reaction of the DA signal. Lanes 1 to 4 represent the DNA marker, DNAzyme, DA-Aptamer, and H3, respectively. After the DNAzyme hybridized with the DA-Aptamer, a new band positioned higher appeared in lane 5, indicating the formation of a larger molecular weight dsDNA. When DA was added, the aptamer hybridized with DA, leading to the release of the DNAzyme. A lighter dsDNA band was observed in lane 6, providing evidence of the DA response to the aptamer. Lane 7 shows that dsDNA and H3 did not react with each other in the absence of OA, resulting in the same intensity observed in lanes 4 and 6 (lane 7). Lane 8 shows the addition of DA but without the addition of Mg. 2+ Catalysis revealed a lighter dsDNA band, but the H3 band intensity remained unchanged. In lane 9, the dsDNA band lightened upon the addition of DA; DA binds to DA-Aptamer, releasing DNAzyme, which then reacts with Mg. 2+ The H3 band was sheared by the triggering reaction, and the H3 band became lighter, proving that the reaction could proceed smoothly. Figure 19 As shown in figure b, the fluorescence recovery effects of the fluorescent group FAM and the quenching group BHQ1 during DNAzyme cyclic cleavage were verified. The figure shows that DA-Aptamer and DNAzyme were not modified with any fluorescent groups, therefore there was no fluorescence intensity, and OA-Aptamer / DNAzyme also showed no fluorescence signal. However, H3 was modified with FAM and BHQ1, but because FAM and BHQ1 were close together, the fluorescence was quenched. After double-stranded dsDNA bound to H3, the fluorescence of H3 recovered slightly, indicating that some DNAzyme did not completely bind to DA-Aptamer. When DA was added but Mg was not added... 2+ When DA and Mg were added, no significant change in fluorescence could be observed. 2+ The fluorescence spectrum later showed a sharp increase in fluorescence at 564 nm, indicating that the aptamer could hybridize with DA after the addition of the toxin. The aptamer was then competitively displaced by the target, exposing the active site of the DNAzyme. At this point, in Mg 2+ Catalyzed by [catalysis], the active site of the DNAzyme uncleaves the DNA hairpin H3 embedded inside the hydrogel, causing the fluorescent beacon modified on H3 to separate from the quenching molecule, resulting in enhanced fluorescence and enabling the detection of DA. In summary, the above experiments collectively demonstrate the feasibility of this method.

[0131] Example 7

[0132] Calibration curves for OA and DA: To establish the quantitative relationship between OA (okadaic acid) and DA (dominoic acid) concentrations and fluorescence intensity, and to clarify the linear range, linear equation, correlation coefficient (r²), and limit of detection (LOD) of the method, this experiment used the composite hydrogel prepared in Example 5. Before the experiment, OA and DA standards were prepared into 100 nM stock solutions with methanol, and then 40 mM Mg was added. 2+ Tris-HCl buffer was serially diluted to prepare a series of standard solutions of OA (0.1 pM~10 nM) and DA (0.1 pM~100 nM). Then, 60 μL of a mixed standard solution of OA and DA at various concentrations was added to the lower layer of the composite hydrogel (with 3 parallel wells and 11 blank control groups). After UV irradiation for 10 min to allow all samples to enter the detection hydrogel, the gel was incubated at 60℃ in the dark for 40 min. Fluorescence signals were then collected at 520 nm (DA, FAM channel) and 564 nm (OA, Cy3 channel) using a microplate reader that had been preheated for 30 min. The correction value was obtained by subtracting the average value of the blank group from the fluorescence intensity of the standard group. Data processing was performed using Excel to calculate the average value of parallel samples and RSD% (ensuring <5%). A linear equation was fitted using Origin software with the logarithm of concentration as the x-axis and the corrected fluorescence intensity as the y-axis. The limit of detection was calculated using LOD=3σ / k (σ is the blank standard deviation, k is the slope). The test results are as follows: Figure 20 As shown.

[0133] Figure 20 The calibration curves for different concentrations of OA and DA were recorded at 564 nm and 520 nm, respectively. Figure 20 (a) shows the logarithmic fitting curve of fluorescence intensity versus OA concentration, demonstrating a linear relationship between analyte OA concentration and fluorescence intensity. This figure shows a linear range from 0.1 pM to 10 nM, exhibiting high linearity (r). 2 =0.995), the linear curve is y = 3248.979 x(OA) + 15560.167, the LOD of this method is 0.103 pM, and after three repeated experiments, the relative standard deviation (RSD%) is less than 5%, indicating good reproducibility. Figure 20 (b) shows the logarithmic fitting curve of fluorescence intensity versus DA concentration, demonstrating a linear relationship between analyte DA concentration and fluorescence intensity. This figure shows a linear range from 0.1 pM to 100 nM, exhibiting high linearity (r). 2 = 0.991), the linear curve is y = 2679.280x (DA) +11664.583, the LOD of this method is 0.199 pM, and after 3 repeated experiments, the relative standard deviation (RSD%) is less than 5%, indicating good reproducibility.

[0134] Example 8

[0135] The light-driven toxin enrichment composite hydrogel prepared in Example 5, which simultaneously detects OA and DA, was used for the detection of seafood samples. The specific detection steps are as follows:

[0136] The materials prepared in the experiment were stored in the upper part of a 4°C refrigerator for later use. All DNA used was heated in a 95°C water bath for 5 minutes and then cooled to room temperature.

[0137] Actual samples, including mussels, oysters, scallops, and seawater, were tested and spiked. OA spiked concentrations were 0.001 nM, 0.1 nM, and 1 nM, while DA spiked concentrations were 0.001 nM, 0.1 nM, and 10 nM. The testing procedure was as follows: Mussels, oysters, and scallops were fresh seafood purchased online. After removing the tissue from the shells, the tissue was thoroughly rinsed with deionized water and then ground into a homogeneous paste using a laboratory multi-functional grinder. The paste was then filtered through a 20-mesh sieve to form a homogenate. 1 g of the homogenate was dispersed in 4 mL of 50% methanol solution and vortexed for 5 min. The methanol extract was then centrifuged at 8000 rpm for 10 min. The supernatant was filtered through a 0.22 µm filter membrane and dispersed into clean centrifuge tubes. Different concentrations of OA / DA solutions were then added to the extract solution. For seawater samples, a 0.22 µm filter membrane was used directly to obtain the required extract. Take 60 μL of actual samples with different concentrations of standards (OA: 0.001, 0.1, 1 nM; DA: 0.001, 0.1, 10 nM) and add them to the lower layer of the composite hydrogel. Then, apply ultraviolet light to the upper hydrogel to achieve targeted enrichment of the target toxin. After 10 min, when all the samples have entered the detection hydrogel, the enrichment is complete. After incubation at 60℃ for 40 min, the fluorescence intensity of the system at wavelengths of 564 nm and 520 nm is detected by an ELISA reader.

[0138] To evaluate the effectiveness of the established method on actual samples, mussels, oysters, scallops, and seawater were selected to detect the spiked content of OA and DA; the results are shown in Table 1.

[0139] Table 1. Spike recoveries of OA and DA in reagent samples (n=3)

[0140]

[0141] a Relative recovery rate = detected concentration / original concentration

[0142] As shown in Table 1, the method has a minimum spiking concentration of 0.001 nM for OA and DA, and the corresponding concentrations can be stably detected in all matrices, indicating that its limit of quantitation is as low as 0.001 nM and its sensitivity is high, which can meet the detection requirements of trace marine toxins. The relative recoveries of OA and DA are 82.4%~111% (meeting the analytical standard of 80%~120%), and the RSD of the detected concentration is ≤8.7% (most <6%), indicating that the method has good quantitative accuracy, excellent precision and little matrix interference.

[0143] Figure 21 This diagram shows the specificity of the detection methods for OA and DA. The fluorescence response values ​​recorded at 564 nm and 520 nm are for different marine toxins STX, TTX, NEO, GTX-2, GTX-3, and GTX-6, respectively. No significant signal response was observed for other marine toxins. Given the very high affinity of OA-Aptamer and DA-Aptamer for their respective targets, the developed methods exhibit high specificity for OA and DA.

[0144] Figure 22 To assess the stability of the OA and DA detection methods, fluorescence detection signals at 564 nm and 520 nm were recorded by the sensor over 1-7 days. It can be observed that the fluorescence signal values ​​remained essentially unchanged over 1-7 days, demonstrating the sensor's good stability over 7 days.

Claims

1. A light-driven toxin enrichment composite hydrogel, characterized in that, The application relates to a photo-driven hydrogel and a detection hydrogel; the photo-driven hydrogel is an agarose hydrogel doped with Au@Ag core-shell nanoparticles; the detection hydrogel is agarose hydrogel doped with a double strand formed by an okadaic acid aptamer and a complementary sequence cDNA, a double strand formed by a cartouche acid aptamer and a complementary sequence DNAzyme, a cartouche H1 with a 3' end modified with a quenching group BHQ2, a cartouche H2 with a neck modified with a fluorescent group Cy3, a cartouche H3 with a fluorescent group FAM and a quenching group BHQ1 at two ends respectively and metal ions for catalyzing the cyclic shearing of DNAzyme; wherein the sticky end of the cDNA is exposed after the okadaic acid is combined with the aptamer, thereby opening the clamp H1, and then H1 continues to open the clamp H2; the active site of the DNAzyme is exposed after the cartouche acid is combined with the aptamer, combines with the cartouche H3 and is sheared under the catalysis of the metal ions; the double strand is fixed on the hydrogel, and the cartouches H1, H2 and H3 are free in the hydrogel; the photo-thermal driving unit is located above the detection function unit.

2. The photo-driven toxin enrichment composite hydrogel according to claim 1, wherein, The sequence of the okadaic acid aptamer is as follows: GGTCACCAACAACAGGGAGCGCTACGCGAAGGGTCAATGTGACGTCATGCGGATGTGTGG. The sequence of the cDNA is as follows: CTCGAGGAATCGTTGTTGGTGACC. The sequence of the cartouche H1 with the 3' end modified with the quenching group BHQ2 is as follows: GGTCACCAACAACGATTCCTCGAGCCCAGTCTCGAGGAATCGTTGTTG-BHQ2. The sequence of the cartouche H2 with the neck modified with the fluorescent group Cy3 is as follows: CTCGAGGAATCGTTGTTGGTGACC-Cy3-CAACAACGATTCCTCGAGACTGGG. The sequence of the cartouche H3 with the fluorescent group FAM and the quenching group BHQ1 at two ends respectively is as follows: TTTTTTTTTT-BHQ1-TTATGCTCGTTCGTAATGATAAGCTA / rA / GTAAATACGAACCTGGATAA-FAM. The particle size of the Au@Ag core-shell nanoparticles is 19.58+3.23 nm, and the particle size of gold is 13.98+1.25 nm. The application further relates to a preparation method of the photo-driven hydrogel and the detection hydrogel. S1, preparation of the photo-driven hydrogel 3. The photo-driven toxin enrichment composite hydrogel of claim 1, wherein, Agarose is added into water, heated and dissolved to obtain a hydrogel precursor solution, then the Au@Ag core-shell nanoparticle solution is mixed with the hydrogel precursor, and the photo-driven hydrogel is formed after cooling and solidification; S2, preparation of the detection hydrogel ​ ​ ​ ​ 4. The photo-driven toxin enrichment composite hydrogel of claim 1, wherein, ​ 5. A method for preparing the light-driven toxin-enriched composite hydrogel according to any one of claims 1 to 4, characterized in that, ​ ​ ​ ​ (1) adding agarose into a buffer solution containing metal ions, heating to dissolve to obtain a hydrogel precursor solution; (2) mixing cDNA and carboxyl-modified okadaic acid aptamer with a buffer solution respectively, then incubating after mixing to form an okadaic acid aptamer / cDNA double-stranded solution; (3) mixing carboxyl-modified DNAzyme and domoic acid aptamer with a buffer solution respectively, then incubating after mixing to form a domoic acid aptamer / DNAzyme double-stranded solution; (4) mixing the double-stranded solutions prepared in steps (2) and (3), then adding H1, H2 and H3 hairpin DNA in sequence, mixing, then activating the carboxyl groups on the okadaic acid aptamer and DNAzyme to obtain a DNA precursor solution; (5) mixing the hydrogel precursor solution and the DNA precursor solution, and obtaining a detection hydrogel after solidification; placing the light-driven hydrogel synthesized in step S1 on the detection hydrogel synthesized in step S2 to obtain the light-driven toxin enrichment composite hydrogel.

6. The method of claim 5, wherein the photo-driven toxin enrichment composite hydrogel is prepared by the steps of: (a) mixing the photoactive polymer, the toxin, and the crosslinker to form a mixture; (b) exposing the mixture to light to form the photo-driven toxin enrichment composite hydrogel. In step S1, the concentration of agarose in the hydrogel precursor solution is 1.6%, the concentration of Au@Ag core-shell nanoparticle solution is 0.2~0.25 µM, and the volume ratio of the two is 1:

1.

7. The method for preparing the photo-driven toxin enrichment composite hydrogel according to claim 1, characterized in that, The concentrations of the okadaic acid aptamer / cDNA double-stranded solution, the domoic acid aptamer / DNAzyme double-stranded solution, H1, H2 and H3 are 90~110 nM, 90~110 nM, 75~85 nM, 75~85 nM and 130~150 nM respectively, and the volume ratio is 1:1:1:1:

1.

8. The method for preparing the photo-driven toxin enrichment composite hydrogel according to claim 1, characterized in that, The metal ion is Mg 2+ The concentration in the detection hydrogel is 35-45 mM.

9. Use of the light-driven toxin enrichment composite hydrogel of any one of claims 1-4 in detecting trace okadaic acid and domoic acid in marine products.

10. Use according to claim 9, characterized in that, The application method comprises the following steps: (1) adding a sample containing okadaic acid and domoic acid to be detected in the lower layer of the composite hydrogel, then applying ultraviolet light to the upper layer hydrogel to realize directional enrichment of the target toxin; after enrichment is completed, then incubating at 40~60℃ for 20~40 min; detecting the fluorescence intensity at 564 nm and 520 nm; (2) calculating the concentrations of okadaic acid and domoic acid in the sample to be detected according to the standard curve of fluorescence intensity and okadaic acid or domoic acid concentration; wherein the standard curve of fluorescence intensity and okadaic acid concentration is y = 3248.979 x + 15560.167, and the standard curve of fluorescence intensity and domoic acid concentration is y = 2679.280x + 11664.583, x is the concentration of okadaic acid / domoic acid, and y is the fluorescence intensity.

Images